IAI FigSearch
Home Help [Feedback] [For Subscribers] [Archive] [Search] [Contents]
This Article
Right arrow Full Text
Right arrow Full Text (PDF)
Right arrow An erratum has been published
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowReprints and Permissions
Right arrow Copyright Information
Right arrow Books from ASM Press
Right arrow MicrobeWorld
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Gramzinski, R. A.
Right arrow Articles by Hoffman, S. L.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Gramzinski, R. A.
Right arrow Articles by Hoffman, S. L.

 Previous Article  |  Next Article 

Infection and Immunity, March 2001, p. 1643-1649, Vol. 69, No. 3
0019-9567/01/$04.00+0   DOI: 10.1128/IAI.69.3.1643-1649.2001
Copyright © 2001, American Society for Microbiology. All rights reserved.

Interleukin-12- and Gamma Interferon-Dependent Protection against Malaria Conferred by CpG Oligodeoxynucleotide in Mice

Robert A. Gramzinski,1,dagger Denise L. Doolan,1,2 Martha Sedegah,1,3 Heather L. Davis,4,5 Arthur M. Krieg,6 and Stephen L. Hoffman1,*

Malaria Program, Naval Medical Research Center, Silver Spring, Maryland 20910-75001; Department of Molecular Microbiology and Immunology, School of Hygiene and Public Health, Johns Hopkins University, Baltimore, Maryland 21205-21792; Department of Microbiology, University of Maryland School of Medicine, Baltimore, Maryland 212013; Loeb Research Institute, Ottawa Civic Hospital,4 and Faculties of Health Sciences and Medicine, University of Ottawa,5 Ottawa, Canada K1Y 4E9; and Department of Internal Medicine, University of Iowa, Iowa City, Iowa 522426

Received 6 September 2000/Returned for modification 16 October 2000/Accepted 12 December 2000

Unmethylated CpG dinucleotides in bacterial DNA or synthetic oligodeoxynucleotides (ODNs) cause B-cell proliferation and immunoglobulin secretion, monocyte cytokine secretion, and activation of natural killer (NK) cell lytic activity and gamma interferon (IFN-gamma ) secretion in vivo and in vitro. The potent Th1-like immune activation by CpG ODNs suggests a possible utility for enhancing innate immunity against infectious pathogens. We therefore investigated whether the innate immune response could protect against malaria. Treatment of mice with CpG ODN 1826 (TCCATGACGTTCCTGACGTT, with the CpG dinucleotides underlined) or 1585 (ggGGTCAACGTTGAgggggG, with g representing diester linkages and phosphorothioate linkages being to the right of lowercase letters) in the absence of antigen 1 to 2 days prior to challenge with Plasmodium yoelii sporozoites conferred sterile protection against infection. A higher level of protection was consistently induced by CpG ODN 1826 compared with CpG ODN 1585. The protective effects of both CpG ODNs were dependent on interleukin-12, as well as IFN-gamma . Moreover, CD8+ T cells (but not CD4+ T cells), NK cells, and nitric oxide were implicated in the CpG ODN 1585-induced protection. These data establish that the protective mechanism induced by administration of CpG ODN 1585 in the absence of parasite antigen is similar in nature to the mechanism induced by immunization with radiation-attenuated P. yoelii sporozoites or with plasmid DNA encoding preerythrocytic-stage P. yoelii antigens. We were unable to confirm whether CD8+ T cells, NK cells, or nitric oxide were required for the CpG ODN 1826-induced protection, but this may reflect differences in the potency of the ODNs rather than a real difference in the mechanism of action of the two ODNs. This is the first report that stimulation of the innate immune system by CpG immunostimulatory motifs can confer sterile protection against malaria.


* Corresponding author. Mailing address: Malaria Program, Naval Medical Research Center, 503 Robert Grant Ave., Silver Spring, MD 20910-7500. Phone: (301) 319-7570. Fax: (301) 319-7545. E-mail: hoffmans{at}nmrc.navy.mil.

dagger Present address: Naval Medical Research Unit No. 2, Jakarta, Indonesia.


Infection and Immunity, March 2001, p. 1643-1649, Vol. 69, No. 3
0019-9567/01/$04.00+0   DOI: 10.1128/IAI.69.3.1643-1649.2001
Copyright © 2001, American Society for Microbiology. All rights reserved.



This article has been cited by other articles:




Home Help [Feedback] [For Subscribers] [Archive] [Search] [Contents]
J. Bacteriol. J. Virol. Eukaryot. Cell
Microbiol. Mol. Biol. Rev. Clin. Vaccine Immunol. All ASM Journals

Copyright © 2001 by the American Society for Microbiology. All rights reserved.