Previous Article | Next Article ![]()
Infect Immun, January 1998, p. 353-355, Vol. 66, No. 1
Department of Immunology and Infectious
Diseases, Harvard School of Public Health, Boston, Massachusetts
02125
Received 19 May 1997/Returned for modification 23 July
1997/Accepted 14 October 1997
A family of genes, called ariel, are named for and
encode asparagine-rich Entamoeba histolytica antigens
containing 2 to 16 octapeptide repeats. Ariel proteins, which
are constitutively expressed by trophozoites, belong to a large
antigen family that includes the serine-rich E. histolytica
protein (SREHP), an amebic vaccine candidate.
Entamoeba histolytica is
a protozoan parasite that causes tens of millions of cases of amebic
colitis and liver abscess each year in the developing world
(21). With the goal of preventing amebic infection, human
antiamebic sera have been used to identify vaccine candidates on the
parasite surface. One such candidate is the serine-rich E. histolytica protein (SREHP), also known as the K2 protein, which
is located on the parasite surface and is composed of an amino-terminal
leader sequence and a hydrophobic carboxy-terminal anchor surrounding a
series of tetrapeptide and octapeptide repeats (12, 25).
SREHP repeats, which are recognized by most human antiamebic sera, are
composed of hydrophilic and acidic amino acids (20). SREHP
repeats immunize gerbils and SCID mice against liver challenge with
E. histolytica trophozoites, while SREHP gene polymorphisms
may be used to distinguish axenic strains and clinical isolates of
E. histolytica (4, 22, 30).
The E. histolytica chitinase, encoded by a single-copy
chit gene, contains a series of degenerate heptapeptide
repeats (D/E-I/S/T/V-K-H/P-D/E-S-S) which are located between an
amino-terminal signal sequence and a carboxy-half catalytic domain
(6). Although the amino acid composition of the chitinase
repeats is almost identical to that of the SREHP repeats, the amino
acid sequence and codon usage of the chitinase repeats are different
from those of SREHP, indicating their independent genetic origin. The
amebic chitinase genes are polymorphic from one clinical isolate to the
next, making chit genes (in conjunction with
srehp genes) useful for molecular epidemiological studies
(22).
To discover another single-copy, polymorphic repeat gene from E. histolytica, the coding region of the SREHP gene was used to
identify a gray (weakly hybridizing) plaque in an E. histolytica HM-1 genomic DNA (gDNA) library (13,
25). The plaque encoded a novel repeat protein which was called
Ariel, for asparagine-rich E. histolytica protein (Fig.
1). Four more unique ariel
genes were amplified from E. histolytica gDNA by using PCR
with sense (GAGTCTATTCATGAAAAT) and antisense
(CCACAATAATAGCAAAGAGAA) primers flanking the repeats in the
ariel gDNA library clone (14). Three unique
ariel genes and one ariel gene matching a PCR
product were found by screening an E. histolytica cDNA
library and by using 5' and 3' rapid amplification of cDNA ends (RACE)
with the same antisense and sense ariel primers,
respectively (8). The longest ariel gene, which
encodes a 23-kDa protein with 16 octapeptide repeats, was labeled
ariel-1, while the shortest, which encodes an 11-kDa protein
with 2 octapeptide repeats, was labeled ariel-8.
0019-9567/98/$04.00+0
Copyright © 1998, American Society for Microbiology. All rights reserved.
A New Gene Family (ariel) Encodes
Asparagine-Rich Entamoeba histolytica Antigens, Which
Resemble the Amebic Vaccine Candidate Serine-Rich E. histolytica Protein
![]()
ABSTRACT
Top
Abstract
Text
References
![]()
TEXT
Top
Abstract
Text
References

View larger version (69K):
[in a new window]
FIG. 1.
Alignment of amino acids, in single letter code, of
eight predicted E. histolytica Ariel proteins (Ariel-1 to
Ariel-8) with those of SREHP and SREDP. Because the Ariel proteins
differ only in the number and sequence of the octapeptide repeats
(shaded boxes), single amino- and carboxy-terminal Ariel sequences are
shown. Sequences identical to Ariel-1 are marked with dashes, gaps are
marked with dots, and COOH-terminal stop codons are marked with
asterisks. Arrows indicate the locations of primers used for PCR and
RACE. Tetrapeptide and octapeptide repeats of SREHP and SREDP are
marked with unshaded boxes. Ariel-1, Ariel-2, Ariel-4, and Ariel-5 are
derived from a cDNA library or RACE, while Ariel-2, Ariel-3, Ariel-6,
Ariel-7, and Ariel-8 are derived from a gDNA library or PCR products.
Multicopy ariel genes are genetically related to the srehp gene. Eight ariel genes encode predicted proteins identical over the first 58 amino acids (aa) at the amino termini and the last 29 aa at the carboxy termini, which show 55% and 76% positional identities, respectively, with those of SREHP (Fig. 1) (25). The ariel genes, then, belong to the same family of genes as srehp and sredp, which encodes the serine-rich protein of Entamoeba dispar (formerly known as nonpathogenic E. histolytica) (7, 12). Conserved in the amino termini of the Ariel proteins and SREHP are a putative signal sequence and a series of charged amino acids prior to the repeats (Fig. 1) (29). Conserved at the carboxy termini of the Ariel proteins and SREHP are putative hydrophobic anchors (11, 25). However, it is possible that Ariel proteins are anchored by glycophosphoinositol, as is the P. falciparum circumsporozoite protein (CSP), a vaccine candidate with a hydrophobic carboxy terminus similar to those of Ariel and SREHP (17, 24, 25). Whether Ariel proteins, like SREHP, are phosphorylated and acetylated and have O-linked terminal N-acetylglucosamine residues also remains to be determined (26).
The hydrophilic and acidic octapeptide repeats of the Ariel proteins resemble those of SREHP in amino acid composition, sequence, and codon usage (Fig. 1 and data not shown) (12, 25). However, the asparagine residues frequent in Ariel repeats are absent in SREHP repeats, and the tetrapeptide repeats present in SREHP are absent in the Ariel proteins. The Ariel octapeptide repeats (D/N/S-E-S-S-D/N-N-K-P) are identical in four or five positions to those of SREHP (E-A-S-S-S/T-D/N-K-P), while the last 4 amino acids of the Ariel octapeptide repeats are identical in three or four positions to the SREHP tetrapeptide (D-N-K-P). The same D-N-K-P tetrapeptide is tandemly repeated in protein A of Staphylococcus aureus (28). These results suggest that the Ariel repeats may contain some antigens in common with and some distinct from those of SREHP.Constitutive expression of ariel genes. Four ariel genes are expressed by cultured trophozoites, because their cDNAs were obtained from the cDNA library or by RACE (8). Multiple ariel genes were expressed simultaneously by trophozoites cloned on soft agar, including ariel-1 (major 440-bp product) and numerous smaller (faint) ariel genes (Fig. 2) (19). Because ariel reverse transcription (RT)-PCR products from each amebic clone look similar, it appears that the ariel genes are constitutively rather than variantly expressed.
|
Antigenicity of Ariel repeats. A prediction of the Hopp and Woods plot is that the hydrophilic repeats of the Ariel proteins are immunogenic, as has been shown for SREHP (11, 20, 25, 30). Pooled sera from patients with amebic liver abscesses reacted on Western blots with the Ariel repeats expressed as a glutathione S-transferase (GST) fusion protein (Fig. 3) (10, 23). Although it is possible that the human antibodies were raised against another amebic immunogen such as SREHP, it appears that the Ariel repeats are antigenic. Antiamebic human sera also recognized GST fusion proteins containing E. histolytica chitinase repeats (weakly) or alcohol dehydrogenase 1 at the carboxy termini but did not react with GST alone (6, 13). Whether an E. histolytica Ariel protein, like SREHP, may be useful as a serodiagnostic reagent for amebic infection or as a component of an antiamebic vaccine remains to be determined (11, 20, 25, 30). Whether antiamebic sera recognize antigens with few repeats (e.g., Ariel-8) also remains to be determined.
|
New conclusions about antigenic diversity in E. histolytica. (i) The same ancestral gene may lead to two different repeat antigens (Ariel and SREHP) with common amino and carboxy termini surrounding distinctive repeats. This is similar to what has been described for merozoite surface protein 1 (MSP-1) and S-antigen of Plasmodium falciparum (1, 2, 16).
(ii) Amebic repeat antigens may be encoded by multiple ariel genes, making these genes useless for molecular epidemiological studies. In contrast, polymorphic chit and srehp genes are present in one or two copies and so are useful for epidemiology (4, 6, 12, 22, 25). Single-copy polymorphic repeat genes of P. falciparum, useful for epidemiological studies, encode MSP-1, MSP-2, S-antigens, and CSP (1, 2, 5, 9, 16). (iii) At least four ariel genes are constitutively expressed, so antigenic diversity may exist within a single parasite isolate rather than between separate parasite isolates (as is the case for SREHP and amebic chitinase) (4, 22). It is unclear whether amebae have any variably expressed antigens, such as the var proteins of P. falciparum, the variable surface proteins of Giardia lamblia, and the variable surface glycoproteins of Trypanosoma brucei (3, 18, 27).| |
ACKNOWLEDGMENTS |
|---|
This work was supported in part by a grant from the NIH.
Thanks to Sam Stanley and colleagues at Washington University for extensive characterization of SREHP and to Egbert Tannich of the Nocht Institute in Hamburg for the E. histolytica cDNA library.
| |
FOOTNOTES |
|---|
* Corresponding author. Mailing address: Department of Immunology and Infectious Diseases, Harvard School of Public Health, 665 Huntington Ave., Boston, MA 02125. Phone: (617) 432-4670. Fax: (617) 738-4914. E-mail: jsamuels{at}hsph.harvard.edu.
Editor: S. H. E. Kaufmann
| |
REFERENCES |
|---|
|
|
|---|
| 1. | Anders, R. F., D. J. McColl, and R. L. Coppel. 1993. Molecular variation in Plasmodium falciparum: polymorphic antigens of asexual erythrocyte stages. Acta Tropica 53:239-253[Medline]. |
| 2. | Bickel, Q., R. F. Anders, K. Day, and R. L. Coppel. 1993. The S-antigen of Plasmodium falciparum: repertoire and origin of diversity. Mol. Biochem. Parasitol. 61:189-196[Medline]. |
| 3. | Borst, P. 1986. Discontinuous transcription and antigenic variation in trypanosomes. Annu. Rev. Biochem. 55:701-732[Medline]. |
| 4. | Clark, C. G., and L. S. Diamond. 1993. Entamoeba histolytica: a method for isolate identification. Exp. Parasitol. 77:450-455[Medline]. |
| 5. |
De la Cruz, V. F.,
A. A. Lal, and T. F. McCutchan.
1987.
Sequence variation in putative functional domains of the circumsporozoite protein of Plasmodium falciparum: implications for vaccine development.
J. Biol. Chem.
262:11935-11939 |
| 6. | de la Vega, H., C. A. Specht, C. E. Semino, P. W. Robbins, D. Eichinger, D. Caplivski, S. Ghosh, and J. Samuelson. 1997. Cloning and expression of chitinases of Entamoebae. Mol. Biochem. Parasitol. 85:139-147[Medline]. |
| 7. | Diamond, L. S., and C. G. Clark. 1993. A redescription of Entamoeba histolytica Schaudinn, 1903 (emended Walker, 1911) separating it from Entamoeba dispar Brumpt, 1925. J. Eukaryot. Microbiol. 40:340-344[Medline]. |
| 8. |
Frohman, M. A.,
M. K. Dush, and G. R. Martin.
1988.
Rapid production of full-length cDNAs from rare transcripts: amplification using a single gene-specific oligonucleotide primer.
Proc. Natl. Acad. Sci. USA
85:8998-9002 |
| 9. |
Gupta, S.,
K. Treenholme,
R. M. Anderson, and K. P. Day.
1994.
Antigenic diversity and the transmission dynamics of Plasmodium falciparum.
Science
263:961-963 |
| 10. | Harlow, E., and D. Lane. 1988. . Antibodies: a laboratory manual. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y. |
| 11. |
Hopp, T. P., and K. R. Woods.
1981.
Prediction of protein antigenic determinants from amino acid sequences.
Proc. Natl. Acad. Sci. USA
78:3824-3828 |
| 12. | Kohler, S., and E. Tannich. 1993. A family of transcripts (K2) of Entamoeba histolytica contains polymorphic repetitive regions with highly conserved elements. Mol. Biochem. Parasitol. 59:49-58[Medline]. |
| 13. |
Kumar, A.,
P.-S. Shen,
S. Descoteaux,
J. Pohl,
G. Bailey, and J. Samuelson.
1992.
Cloning and expression of an NADP+-dependent alcohol dehydrogenase gene of Entamoeba histolytica.
Proc. Natl. Acad. Sci. USA
89:10188-10192 |
| 14. |
Lee, C. C.,
X. Wu,
R. A. Gibbs,
R. G. Cook,
D. M. Muzny, and C. T. Caskey.
1988.
Generation of cDNA probes directed by amino acid sequence: cloning of urate oxidase.
Science
239:1288-1291 |
| 15. | Leippe, M., E. Tannich, R. Nickel, R. D. Horstmann, and H. J. Muller-Eberhard. 1992. Primary structure of the pore-forming peptide of pathogenic Entamoeba histolytica. EMBO J. 11:3501-3506[Medline]. |
| 16. | Miller, L. H., T. Roberts, M. Shahabuddin, and T. McCutchan. 1993. Analysis of sequence diversity in the Plasmodium falciparum merozoite surface protein-1 (MSP-1). Mol. Biochem. Parasitol. 59:1-14[Medline]. |
| 17. |
Moran, P., and I. W. Caras.
1994.
Requirements for glycosylphosphatidylinositol attachment are similar but not identical in mammalian cells and parasitic protozoa.
J. Cell Biol.
125:333-343 |
| 18. |
Mowatt, M. R.,
B.-Y. T. Nguyen,
J. T. Conrad,
R. D. Adam, and T. E. Nash.
1994.
Size heterogeneity among antigenically related Giardia lamblia variant-specific surface proteins is due to differences in tandem repeat copy number.
Infect. Immun.
62:1213-1218 |
| 19. | Mueller, D. E., and W. A. Petri, Jr. 1995. Clonal growth in Petri dishes of Entamoeba histolytica. Trans. R. Soc. Trop. Med. Hyg. 89:123[Medline]. |
| 20. | Myung, K., D. Burch, T. F. H. G. Jackson, and S. L. Stanley, Jr. 1992. Serodiagnosis of invasive amebiasis using a recombinant Entamoeba histolytica antigen-based ELISA. Arch. Med. Res. 23:285-288[Medline]. |
| 21. | Ravdin, J. I. 1995. Amebiasis: state-of-the-art clinical article. Clin. Infect. Dis. 20:1453-1464[Medline]. |
| 22. | Samuelson, J., D. Caplivski, K. Sturm-Ramirez, K. Kretsinger, S. Descoteaux, G. Hernandez, G. Vargas, R. Mammo, O. Newton, J. Santos, H. de la Vega, P. Robbins, C. Ganguly, and A. Lohia. 1997. A proposal for a molecular biologic system for classifying isolates of Entamoeba histolytica and Entamoeba dispar. Arch. Med. 28:S274-S275. |
| 23. | Smith, D. B., and K. S. Johnson. 1988. Single-step purification of polypeptides expressed in Escherichia coli as fusions with glutathione S-transferase. Gene 67:31-40[Medline]. |
| 24. |
Soute, J. A.,
M. Slaoui,
G. Heppner,
P. Momin,
K. E. Kester,
P. Desmons,
B. T. Wellde,
N. Garcon,
U. Krzych,
M. Marchand,
W. R. Ballou, and J. D. Cohen.
1997.
A preliminary evaluation of a recombinant circumsporozoite protein vaccine against Plasmodium falciparum malaria.
N. Engl. J. Med.
336:86-91 |
| 25. |
Stanley, S. L., Jr.,
A. Becker,
C. Kunz-Jenkins,
L. Foster, and E. Li.
1990.
Cloning and expression of a membrane antigen of Entamoeba histolytica possessing multiple tandem repeats.
Proc. Natl. Acad. Sci. USA
87:4976-4980 |
| 26. |
Stanley, S. L., Jr.,
K. Tian,
J. P. Koester, and E. Li.
1995.
The serine-rich Entamoeba histolytica protein is a phosphorylated membrane protein containing O-linked terminal N-acetylglucosamine residues.
J. Biol. Chem.
270:4121-4126 |
| 27. | Su, X.-Z., V. M. Heatwole, S. P. Wertheimer, F. Guinet, J. A. Herrfeldt, D. S. Peterson, J. A. Ravetch, and T. E. Wellems. 1995. The large diverse gene family var encodes proteins involved in cytoadherence and antigenic variation of Plasmodium falciparum-infected erythrocytes. Cell 82:89[Medline]. |
| 28. |
Uhlen, M.,
B. Guss,
B. Nilsson,
S. Gatenbeck,
L. Philipson, and M. Lindberg.
1984.
Complete sequence of the staphylococcal gene encoding protein A: a gene evolved through multiple duplications.
J. Biol. Chem.
259:1695-1702 |
| 29. | von Heijne, G. 1985. Signal sequences. The limits of variation. J. Mol. Biol. 184:99-105[Medline]. |
| 30. |
Zhang, T.,
P. R. Cieslak, and S. L. Stanley, Jr.
1994.
Protection of gerbils from amebic liver abscess by immunization with a recombinant Entamoeba histolytica antigen.
Infect. Immun.
62:1166-1170 |
This article has been cited by other articles:
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| J. Bacteriol. | J. Virol. | Eukaryot. Cell |
|---|
| Microbiol. Mol. Biol. Rev. | Clin. Vaccine Immunol. | All ASM Journals |
|---|