This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowReprints and Permissions
Right arrow Copyright Information
Right arrow Books from ASM Press
Right arrow MicrobeWorld
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Cue, D.
Right arrow Articles by Cleary, P. P.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Cue, D.
Right arrow Articles by Cleary, P. P.

 Previous Article  |  Next Article 

Infection and Immunity, October 1998, p. 4593-4601, Vol. 66, No. 10
0019-9567/98/$04.00+0
Copyright © 1998, American Society for Microbiology. All rights reserved.

Streptococcus pyogenes Serotype M1 Encodes Multiple Pathways for Entry into Human Epithelial Cells

D. Cue, P. E. Dombek, H. Lam, and P. P. Cleary*

Department of Microbiology, University of Minnesota, Minneapolis, Minnesota

Received 23 March 1998/Returned for modification 18 May 1998/Accepted 2 July 1998

    ABSTRACT
Top
Abstract
Introduction
Materials & Methods
Results
Discussion
References

The ability of a serotype M1 strain of Streptococcus pyogenes to efficiently invade A549 human lung epithelial cells was previously shown to be dependent on bacterial exposure to human or bovine serum proteins or synthetic peptides containing the sequence RGD. In this study, stimulation by invasion agonists was determined to be dependent on expression of the streptococcal cell surface protein, M1. Fetal bovine serum (FBS), fibronectin (Fn), the extracellular matrix protein laminin (Lm), and RGD-containing peptides were tested for their abilities to promote epithelial cell invasion and adherence by isogenic M1+ and M1- strains of S. pyogenes. In the absence of an agonist, invasion and adherence were comparable for the two bacterial strains. FBS, Fn, and Lm stimulated invasion of the M1+ strain as much as 70-fold but failed to significantly affect invasion by the M1- mutant. Adherence of the wild-type strain was stimulated by these same agonists. Epithelial cell adherence by the M1- strain, however, was unaffected by the presence of Fn or Lm. Several RGD-containing peptides were found to promote invasion independently of M1 expression. Binding of 125I-Fn was reduced 88% by the M1- mutation and Fn was found to bind purified M1 protein, suggesting that Fn mediates invasion by direct binding to M1. To determine if host integrins might be involved in internalization of streptococci, several anti-integrin monoclonal antibodies (MAbs) were tested for their abilities to inhibit invasion. Antibody directed against integrin beta 1 inhibited FBS-, Fn-, and Lm-mediated invasion but did not abrogate RGD-peptide-stimulated invasion. MAb directed against the epithelial cell Fn receptor, integrin alpha 5beta 1, inhibited Fn and FBS-mediated invasion but did not specifically inhibit Lm-mediated invasion. These results indicate that S. pyogenes has evolved multiple mechanisms for invasion of eukaryotic cells, at least two of which involve interactions between M1 protein, host integrins, and integrin ligands.

    INTRODUCTION
Top
Abstract
Introduction
Materials & Methods
Results
Discussion
References

Previous studies have demonstrated that the gram-positive human pathogen Streptococcus pyogenes is capable of invading and persisting within cultured human cells (18, 24, 30, 31, 37). Moreover, intracellular streptococci have been observed in tonsils removed from children with a history of recurrent pharyngitis (36). The capacity of S. pyogenes to invade host cells may provide a mechanism whereby the organism can gain access to deep tissues and blood. Intracellular streptococci may also be afforded at least partial protection from host defenses and antibiotics. The latter may contribute to the frequent recovery of S. pyogenes from throats of patients following a full 10-day course of penicillin treatment (16).

A number of bacterial pathogens (e.g., Listeria monocytogenes, Yersinia pseudotuberculosis [12, 13], Staphylococcus aureus [3], Neisseria gonorrhoeae [11, 17], and Mycobacterium spp. [26, 43]) are proficient at invading cultured cells. Although pathogens have evolved a number of strategies for intracellular invasion, some common themes have emerged (12, 13). For example, with the exception of S. aureus, invasion by the aforementioned bacteria has been shown to depend on expression of specific, bacterial cell surface proteins. In the case of S. pyogenes, multiple cell surface-exposed proteins have been implicated in the invasion process. In separate studies, the closely related fibronectin (Fn)-binding proteins Sfbl (31) and protein F (24) were found, at least in part, to mediate streptococcal invasion of HEp2 cells.

M protein is an important virulence factor expressed on the surface of S. pyogenes cells. Although there are more than 80 known serotypes of M protein, all are alpha-helical coiled-coil molecules capable of binding numerous plasma proteins (14). Two recent reports have demonstrated that at least two M proteins, serotypes 1 and 6, play roles in intracellular invasion by S. pyogenes (10a, 24). Recently, our laboratory found that intracellular invasion by a highly invasive M1 strain (strain 90-226) is heavily dependent on expression of M1 (10a). Invasion by this same strain was also shown to be equally dependent on bacterial exposure to mammalian serum proteins or small synthetic peptides containing the tripeptide sequence RGD (10).

Intracellular invasion by several bacterial pathogens is stimulated by microbial binding of mammalian serum/extracellular matrix (ECM) proteins such as vitronectin (11, 17), laminin (Lm) (43), or Fn (26, 47). Eukaryotic cells bind to ECM proteins via integrins, a family of heterodimeric transmembrane receptors (22). Integrins are utilized by enteropathogenic Yersinia species for entry into mammalian cells. Yersinia internalization is mediated by invasin, a bacterial cell surface protein with a high affinity for beta 1 integrins. Invasion binding to integrins results in activation of host cell signal transduction pathways, which leads to actin-mediated "zipper phagocytosis" of adherent bacteria (13, 23, 51). It seems likely that ECM protein-dependent intracellular invasion by pathogens occurs via a similar mechanism. In the latter case, however, engagement of eukaryotic receptors appears dependent on binding of ECM proteins to the surface of bacteria. The bound protein, in turn, binds to its cognate receptor on the surface of a host cell.

S. pyogenes 90-226 is a representative of a widely disseminated subclone of the M1 serotype (8, 32). This highly virulent subclone was demonstrated to invade epithelial cells at an unusually high frequency relative to other serotype M1 isolates (7, 30). Since strain 90-226 lacks the genes coding for protein F and Sfbl (33), the mechanism whereby it invades epithelial cells clearly must differ from that described for less virulent S. pyogenes isolates. Experiments described here demonstrate that both Fn and Lm promote high-frequency invasion by strain 90-226, apparently by fostering bacterial interaction with distinct epithelial cell integrins. Moreover, the ability of either agonist to facilitate invasion is dependent on bacterial expression of M1 protein. In contrast, invasion stimulated by RGD-containing peptides was found to be M1 independent. This study demonstrates that strain 90-226 has evolved at least three distinct pathways for invasion of human epithelial cells.

    MATERIALS AND METHODS
Top
Abstract
Introduction
Materials & Methods
Results
Discussion
References

Bacterial strains, plasmids, and culture media. S. pyogenes 90-226, a serotype M1 strain cultured from the blood of a patient with sepsis (10, 30), was obtained from the WHO Center for Reference and Research on Streptococci at the University of Minnesota. Strain 90-226 emm1::Km was constructed by insertional inactivation of emm1 with the aphA-3 (kanamycin resistance) gene (10a). S. pyogenes JRS4, which produces a type 6 M protein, and SAM1, an isogenic protein F- derivative of JRS4, were provided by M. Caparon (20). S. pyogenes AP1, which expresses a serotype M1 protein, was provided by L. Björck (15). Escherichia coli DH11S (Life Technologies Inc., Gaithersburg, Md.) served as the host for cloning experiments and plasmid maintenance. The protease-deficient E. coli strain BL21 (Novagen Inc., Madison, Wis.) was used for expression of the M42-382 fragment of M1 protein encoded by plasmid pM42-382.

Streptococci were grown in Todd-Hewitt broth supplemented with 2% neopeptone (Difco Laboratories, Detroit, Mich.). Solid media for streptococci were Todd-Hewitt broth or sheep blood agar. E. coli was grown in Luria-Bertani broth (LB) (45). Solid media contained 1.5% agar. The plasmid vectors pSport1 and pCYB4 were obtained from Life Technologies and New England Biolabs (Beverly, Mass.), respectively. Plasmid pMYB129, encoding an E. coli maltose-binding-intein fusion protein, was from New England Biolabs. Construction of plasmids pemm1 and pM42-382 is described below.

Proteins antibodies and peptides. Human fibrinogen (Fg) was obtained from Chromogenix Corp. (Molndal, Sweden). Human plasma Fn was obtained from Sigma Chemical Co. and Life Technologies. Mouse laminin-1 (mouse Lm) and human placental laminin (HLm) were purchased from Life Technologies. Monoclonal antibodies (MAbs) against integrins beta 1 and alpha 5beta 1 were purchased from Life Technologies and Chemicon International Inc. (Temecula, Calif.), respectively. Other MAbs recognizing integrin subunits were generously provided by the following University of Minnesota researchers: anti-integrin alpha 2 and alpha 3, P. Southern; anti-integrin alpha 5 and alpha 6, J. McCarthy; anti-integrin beta 2, Y. Schimizu; and anti-integrin beta 4, A. Skubitz. Sheep anti-human Fn antibody (Ab) was purchased from ICN Pharmaceuticals, Costa Mesa, Calif. Alkaline phosphatase conjugated to mouse anti-sheep immunoglobulin G (IgG) was from Sigma.

The six-amino-acid peptide GRGDTP was purchased from Sigma. The cyclic (N-acetyl-L-penicillamine-RGDC) RGD and RGDS peptides were purchased from Bachem California Inc. (Torrance, Calif.). Lyophilized peptides were dissolved in RPMI 1640 medium and filter sterilized; aliquots were stored at -80°C.

Cell culture and epithelial cell invasion assay. A549 human lung epithelial cells (ATCC CCL 185) were cultured in RPMI 1640 medium supplemented with 10% fetal bovine serum (FBS; Life Technologies). Cultures of A549 cells were maintained in medium containing penicillin (5 µg/ml) and streptomycin (100 µg/ml) (Sigma).

Assays of bacterial invasion and adherence were performed as previously described (10, 30). Assays were performed in unsupplemented RPMI 1640 medium or medium containing 10% FBS (RPMI-FBS), Fg (25 µg/ml), Fn (10 µg/ml), or mouse Lm (10 µg/ml). In some experiments, RPMI 1640 medium was supplemented with 10 µg of HLm per ml in place of mouse Lm. Monolayers of A549 cells (congruent 2 × 105 cells/well) were infected with 1 × 105 to 5 × 105 bacterial CFU and incubated for 2 h at 37°C in 5% CO2-95% air. Infected monolayers were then washed three times with 1 ml of Hanks balanced salt solution (HBSS) before RPMI-FBS containing gentamicin (100 µg/ml) and penicillin (5 µg/ml) was added. Following 2 h of incubation at 37°C, the monolayers were washed with HBSS, dispersed by the addition of 0.2 ml of 0.25% trypsin-1 mM EDTA (Life Technologies), and then lysed by dilution into 0.8 ml of sterile distilled H2O. The numbers of bacterial CFU released from the lysed epithelial cells were determined by plating of diluted lysates on Todd-Hewitt agar. Typically, less than 5 × 10-3% of input bacteria survive exposure to antibiotics in the absence of epithelial cells, and survival is unaffected by the presence of invasion agonists or the emm1::Km mutation.

To measure bacterial adherence, culture media were removed from monolayers at the end of the invasion period and discarded. The monolayers were then washed three times with HBSS to remove nonadherent bacteria. Epithelial cells were dispersed and lysed, and bacteria were plated as described above. While the numbers of CFU recovered from these wells is reflective of the number of adherent and internalized CFU, for simplicity we will refer to these bacteria as adherent CFU. The statistical significance of data was determined by Student's t test, using Microsoft Excel 97 software. P values of <0.005 were considered significant.

Poly-L-lysine-coated plates were used in invasion experiments that involved the addition of anti-integrin MAbs. One milliliter of poly-L-lysine (0.1 mg/ml; 30 to 70 kDa; Sigma) was added to each well of 24-well tissue culture plates, and the plates were incubated for 10 min at room temperature. The solution was then aspirated from the wells, and each well was washed three times with 1 ml of sterile distilled water. Plates were dried in a laminar-flow hood prior to inoculation with A549 cells.

DNA techniques. Plasmid DNA was isolated from E. coli strains by the alkaline lysis method (45). S. pyogenes chromosomal DNA was isolated as described previously (21). DNA sequencing was performed with reagents purchased from United States Biochemical. PCRs were performed by standard procedures (45).

The emm1 gene of strain 90-226 was amplified via PCR using primers complementary to the conserved 5' portion of M genes (GGGGGGGGATCCATAAGGAGCATAAAAATGGCT) (21, 40) and nucleotides 55 to 30 of the sic gene (AAGAAAGGATCCAAGGGATGTAAATAGTAGTGT) (1). BamHI restriction sites were added to the 5' ends of the primers to facilitate cloning of the fragment. The amplified DNA fragment was digested with BamHI, ligated with BamHI-digested pSportI, and transformed into E. coli. One plasmid isolate, designated pemm1, was chosen for further study. Restriction enzyme mapping and DNA sequencing were performed to verify that the plasmid carried emm1.

For expression of M1 fragments in E. coli, a portion of the emm1 gene was PCR amplified with pemm1 as the template. The oligonucleotide primers used were complementary to nucleotides 154 to 174 (GCGATGTCATGAACGGTGATGGTAATCCTAGG) and 1177 to 1156 (AGTCCCCCGGGAAGTTTTGCTTGTAGTTCAGC) of emm1 (21). The amplified fragment encodes the first 341 amino acid residues of the mature M1 protein (residues 42 to 382). The DNA fragment was purified, cut with BspHI and SmaI, and then ligated into NcoI-SmaI-digested pCYB4, to construct plasmid pM42-382. Cloning of the emm1 fragment into pCYB4 resulted in the construction of a hybrid gene wherein the M1 coding region is fused, at its 3' terminus, to the N-terminal coding region of an intein-chitin-binding protein (34, 52). The fusion protein has a predicted molecular mass of 94.5 kDa. E. coli transformed with pM42-382 can be induced to express the fusion protein, which can then be purified by chromatography of bacterial sonicates on a chitin affinity column (New England Biolabs). The addition of dithiothreitol to the column promotes intein-mediated autocleavage of the fusion protein, releasing the M42-382 fragment from the affinity matrix. The purified M42-382 fragment (39.5 kDa) is predicted to possess an N-terminal formylmethionine and a C-terminal glycine residue not present in native M1.

General protein techniques. Concentrations of protein solutions were determined according to the method of Bradford (4), using bovine serum albumin as the standard. Sodium dodecyl sulfate (SDS)-polyacrylamide gel electrophoresis (PAGE) was performed as described by Laemmli (27). For Western blotting, proteins were transferred to nitrocellulose membranes (Schleicher & Schuell, Keene, N.H.), using a Trans-Blot cell apparatus (Bio-Rad). Membranes were blocked with 0.25% gelatin, washed briefly in TBST (20 mM Tris [pH 7.5], 0.5 M NaCl, 0.05% Tween 20), and then incubated with anti-Fn Ab in TBST. Membranes were then incubated with alkaline phosphatase conjugated to mouse anti-sheep IgG, washed, and finally developed by using nitroblue tetrazolium-5-bromo-4-chloro-3-indolylphosphate phosphatase detection reagents (Life Technologies).

Detection of Fn binding to immobilized M42-382 was performed similarly except that membranes were blocked with 5% nonfat dry milk and incubated with Fn (25 µg/ml) prior to incubation with Abs.

Protein purifications. Fn and Fg were purified from commercially available Fg as follows (44). A 250-mg aliquot of lyophilized protein was suspended in 50 ml of HBSS (Life Technologies) containing 1 mM phenylmethylsulfonyl fluoride (PMSF) and filtered through a 0.22-µm-pore-size cellulose acetate filter to remove insoluble material. The protein was loaded onto a 1.5- by 5.7-cm gelatin-Sepharose (Pharmacia) column. Chromotography was performed at room temperature. The effluent, containing Fn-depleted Fg, was collected, and aliquots were stored at -20°C. No Fn was detected in Western blot analysis of the repurified Fg, using anti-Fn Ab. To recover Fn, the column was washed with 50 ml of HBSS-PMSF followed by 0.05 M sodium acetate-1 M sodium bromide. Fractions of 1.5 ml were collected, and protein-containing fractions were pooled and then dialyzed against HBSS. Aliquots of the purified Fn were stored at -20°C.

For purification of the M42-382 fragment, E. coli BL21/pM42-382 was grown in LB-ampicillin at 37°C to an optical density at 600 nm (OD600) of 0.2 and then at room temperature to an OD600 of 0.5. At that time, isopropyl-beta -D-thiogalactopyranoside (IPTG) was added to 1 mM and the culture was incubated at 15°C for 16 to 18 h. Cells were harvested by centrifugation and suspended in 50 ml of column buffer (20 mM Tris [pH 8.0], 0.5 M NaCl, 0.1 M EDTA, 0.1% Triton X-100) containing 1 µg of DNase I per ml and 1 mM PMSF. All subsequent steps were performed at 4°C. Bacterial cells were disrupted by passage through a French press at 8,000 lb/in2. Lysates were then clarified by centrifugation, and the resulting supernatants were loaded onto a 1.5- by 5-cm chitin affinity column (New England Biolabs). The column was washed with 100 ml of column buffer followed by 15 ml of cleavage buffer (20 mM Tris [pH8], 50 mM NaCl, 0.1 mM EDTA) containing 30 mM dithiothreitol. The column was incubated with cleavage buffer for 16 h at 4°C. The M1 fragment was then eluted by the addition of 15 ml of cleavage buffer. The eluted protein was dialyzed against 50 mM ammonium acetate (pH 6.9) and then concentrated by lyophilization. Lyophilized protein was suspended in phosphate-buffered saline (PBS) to 1 µg/ml, aliquoted, and stored at -80°C.

Fn binding assay. Fn suspended in 0.1 M sodium phosphate-0.15 M NaCl (pH 6.5) was labeled with 125I (Amersham), using Iodobeads iodination reagent (Pierce Chemical Co.), to a specific activity of approximately 106 cpm/µg of protein. Iodinated protein was separated from free label by chromatography on cross-linked dextran columns. Fractions were collected, and those containing 125I-Fn were pooled, aliquoted, and stored at -20°C.

Assay of Fn binding to streptococci was performed as described previously (20). Briefly, overnight cultures of streptococci were harvested by centrifugation, washed twice with 1 volume of PBS (pH 7.4), and finally suspended in PBSAT (PBS containing 0.02% sodium azide and 1% Tween 20) to an OD600 of 0.5; 100-µl portions of the cell suspensions were diluted into 800 µl of PBSAT; 1 to 100 µl of 125I-Fn was then added to duplicate tubes of the cell suspension, and the final reaction volumes were adjusted to 1 ml with PBS. Bacteria and labeled protein were then incubated at room temperature, with end-over-end rotation, for 2 h after which 50 µl of E. coli DH11S, suspended at an OD600 of 10 in PBSAT, was added to each tube. Tubes were centrifuged at 14,000 × g for 10 min at room temperature. Bacterial pellets were washed once with 1 volume of PBSAT, and the amount of radioactivity associated with the pellets was determined. Nonspecific binding was determined by adding the same amount of labeled Fn to tubes containing no streptococci. These reaction mixtures were incubated and bound counts were determined as described above. Radioactive counts recovered from the reaction mixtures were subtracted from those obtained from tubes containing streptococci. Regression analyses were performed by the method of least squares.

    RESULTS
Top
Abstract
Introduction
Materials & Methods
Results
Discussion
References

Effects of invasion agonists on adherence and internalization of M1+ and M1- streptococci. Intracellular invasion of A549 epithelial cells by S. pyogenes 90-226 is highly dependent on the presence of serum, plasma Fn, or the ECM protein Lm (Fig. 1). To determine if expression of M1 protein is required for the stimulation of invasion by these factors, invasion and adherence assays were performed with strains 90-226 (M1+) and 90-226 emm1::Km (M1-). Invasion by either strain was very inefficient in the absence of an agonist, with less than 1% internalization of the bacterial inoculum (Fig. 1a). The addition of FBS, Fn, or mouse Lm stimulated internalization of M1+ bacteria 35-, 70-, and 50-fold, respectively. In contrast, invasion by the M1- strain was unaffected by FBS or Fn addition and was stimulated only twofold by Lm.


View larger version (37K):
[in this window]
[in a new window]
 
FIG. 1.   Effects of agonists on adherence and internalization of M1+ and M1- streptococci. M1+ and M1- bacteria were suspended in RPMI 1640 medium (None), or in RPMI 1640 medium containing the indicated agonist, just prior to infection of monolayers. (a) Intracellular invasion. Percent invasion was calculated as (internalized CFU/CFU in the inoculum) × 100. (b) Streptococcal adherence to A549 cells. Percent adherence is expressed as the percentage of total CFU that remained associated with monolayers after three successive washings with buffer. Data are the means ± standard errors of the means from six to nine infected monolayers (two or three experiments, each performed in triplicate).

M1+ and M1- streptococci both adhere well to A549 cells in the absence of an invasion agonist. Typically, 20 to 30% of the wild-type CFU and 25 to 35% of the M1- CFU remain associated with epithelial cells after washing of the infected monolayers (Fig. 1b). FBS, Fn, or Lm stimulates adherence of the M1+ strain approximately twofold. Fn- and Lm-stimulated adherence is apparently M1 dependent, as adherence of the M1- mutant was not increased by these factors. FBS was found to increase adherence of M1- bacteria by approximately 30%. This result and the slightly higher adherence of the M1- mutant in the absence of agonist are not statistically significant, however.

Invasion by the M1+ strain was previously shown to positively respond to small RGD-containing peptides (10). To determine if M1 expression is required for peptide-mediated invasion, the potential of a four-amino-acid (RGDS) peptide to promote invasion by 90-226 emm1::Km was tested. In four independent experiments in which each assay was performed in triplicate (i.e., n = 12), the RGDS peptide increased internalization of M1- bacteria an average of 4.5 ± 1.1-fold. It should be noted that while the agonistic effect of small peptides is less than those of Fn or Lm, the effect is readily reproducible and statistically significant (P < 0.001). A peptide of the sequence GRGDTP and a cyclic peptide were also found to promote invasion by the M1- strain (Fig. 2). The tripeptide RGD had no measurable impact on bacterial internalization. These results are nearly identical to those obtained from experiments with the M1+ strain. These results demonstrate that strain 90-226 possesses at least two distinct mechanisms for invasion of epithelial cells: one mechanism that is dependent on M1 expression and the presence of either Fn or Lm, and a second, M1-independent mechanism that is stimulated by exposure to small peptides.


View larger version (22K):
[in this window]
[in a new window]
 
FIG. 2.   Expression of emm1 is not required for invasion stimulation by RGD peptides. M1- bacteria were suspended in unsupplemented RPMI 1640 medium (None) or in RPMI 1640 medium containing 0.5 mM indicated peptide and then inoculated onto monolayers. Percent invasion was calculated as (internalized CFU/CFU in the inoculum) × 100. Values are mean percentages from a representative experiment in which each assay was performed in triplicate.

Inhibition of invasion by Fn antiserum. We previously reported that human Fg could activate intracellular invasion by strain 90-226, whereas Fn could not (10). We have since determined that the Fg preparation used in earlier experiments contained approximately 1.6% Fn (Fig. 3). The Fn and Fg in this mixture were separated by chromatography on gelatin-Sepharose, and the recovered proteins were tested for invasion stimulation activity. The Fn-depleted Fg (Fig. 3) failed to stimulate invasion, while the Fg-depleted Fn was an active agonist. It is not clear why the Fn preparation used in the previous study failed to promote invasion. A second preparation of Fn, obtained from the same supplier (Sigma), was also inactive. Bovine and human plasma Fn, obtained from a different commercial source (Life Technologies), had activities comparable to that of the Fn purified from the Fg-Fn mixture.


View larger version (67K):
[in this window]
[in a new window]
 
FIG. 3.   SDS-PAGE and Western blot analysis of purified invasion agonists. Four micrograms of each of the indicated invasion agonists was electrophoresed through SDS-8% polyacrylamide minigels and then stained with Coomassie blue (a) or transferred to a nitrocellulose membrane and probed with sheep anti-human Fn Ab (b). Lanes: 1, inactive preparation of human Fn; 2, active preparation of human Fg contaminated with Fn; 3, active Fn preparation obtained from Life Technologies; 4, active Fn, purified from the Fg preparation shown in lane 2, by chromatography on gelatin-Sepharose; 5, Fn-depleted Fg (inactive) purified from the lane 2 preparation by gelatin-Sepharose chromatography; 6, HLm (active); 7, molecular weight standards. The numbers to the right indicate the molecular masses of the protein standards in kilodaltons. Fn bands are indicated by the arrows to the left.

In light of these results, it seemed plausible that our Lm preparations could have contained Fn, or vice versa, and that only one of these proteins facilitated invasion. It was also possible that all of the active protein preparations contained a common contaminant that was the true invasion agonist. Staining of SDS-polyacrylamide gels, however, did not reveal a contaminating factor that was present exclusively in active protein preparations (Fig. 3a). Dialysis of active protein preparations did not result in any appreciable losses in activity; thus, it is unlikely that agonistic activity is due to a low-molecular-weight contaminating factor (data not shown). Moreover, anti-Fn Ab did not react with an active preparation of HLm or with any protein found exclusively in active preparations (Fig. 3b). Anti-Fn Ab was found to inhibit internalization of streptococci when the agonist was FBS, Fn, or Fg-Fn. The same antiserum did not appreciably affect HLm-mediated invasion (Fig. 4), nor did it adversely affect bacterial growth (data not shown). These results are all consistent with Fn and Lm being distinct, bona fide invasion agonists.


View larger version (41K):
[in this window]
[in a new window]
 
FIG. 4.   Invasion inhibition by anti-fibronectin Ab. Sheep anti-human Fn Ab was added to RPMI 1640 medium containing the indicated agonist. M1+ bacteria were added to this medium and to identical media to which no Ab was added. The bacterial suspensions were then added to A549 monolayers. Thereafter, the standard invasion procedure was followed. Percent inhibition was calculated as (CFU recovered from control [no-MAb] wells - CFU recovered from MAb-containing wells/CFU from control wells) × 100. Data are means and ranges from assays performed in triplicate. The Fg, Fn, and HLm preparations used in this experiment were the same as those run in lanes 2, 3, and 6, respectively, of the gels shown in Fig. 3.

Sequencing of emm1. The emm1 gene of strain 90-226 was amplified by PCR using oligonucleotides complementary to the M-protein signal sequence (21, 40) and to a sequence in the 5' coding region of sic (1). The PCR fragment was cloned into pSport1 and transformed into E. coli. One plasmid isolate, pemm1, was chosen for sequencing of the cloned fragment. The entire 1,724-bp insert of pemm1 was sequenced and found to contain an open reading frame of 1,452 bp, predicted to encode a 484-amino-acid protein (Fig. 5). The 1,452-bp segment was 99.4% homologous to the emm1.0 gene of S. pyogenes AP1 (2). Of the eight nucleotide substitutions found, only one is predicted to affect the amino acid sequence of M1 protein. Amino acid residue 366 is predicted to be glutamic acid in the AP1 protein and glycine in the strain 90-226 protein. This result is consistent with the report of Musser et al. (32) that the globally disseminated M1 subclone, responsible for the majority of contemporary invasive streptococcal infections, carries the emm1.0 allele. The last 54 bp of the sequenced fragment were 100% homologous to the N-terminal coding region of sic. A 190-bp sequence was found between the emm1 stop codon and the sic start codon. The sph gene, found between emm1 and sic in some M1 strains (2), is apparently absent from this segment of the strain 90-226 chromosome.


View larger version (7K):
[in this window]
[in a new window]
 
FIG. 5.   Schematic representation of the domain structure of M1 protein. (a) Lettered boxes indicate the various domains of M1.0 protein of S. pyogenes AP1 (accession no. 1084197) as previously defined (2). The numbers below the boxes indicate the terminal amino acids residues of the domains. SS, signal sequence; A, N-terminal portion of mature M1 protein comprised of a unique sequence of 91 amino acids; B, B repeat domain, comprised of two repeats of a 28-amino-acid sequence, followed by a 6-amino-acid sequence identical to a portion of the 22-residue repeats, followed by a unique 38-amino-acid sequence; C, C repeat domain comprised of three imperfect repeats of 42, 42, and 31 amino acids; D, D region, C-terminal segment containing the cell wall anchor region, membrane-spanning region, and intracellular portion of M1. Residues 42 to approximately 380 are the extracellular portion of the protein. The amino acid predicted to differ between the M1 proteins of strain 90-226 and S. pyogenes AP1 is indicated at the top. (b) The bar indicates the portion of M1 encoded by plasmid pM42-382. Purified M42-382 is predicted to have a C-terminal glycine residue and an N-terminal formylmethionine not present in native M1 protein.

Fn binding by M1 protein. A number of S. pyogenes isolates express a cell surface Fn-binding protein, protein F, that mediates bacterial adherence to host cells. Protein F has been shown to foster adherence by binding soluble Fn which, in turn, binds to the ECM of host tissues (35). Fn and Lm could promote intracellular invasion by M1+ streptococci via a similar mechanism, although we know of no studies demonstrating binding of either agonist by M1 protein.

As a partial test of this mechanism, we first compared levels of binding of 125I-Fn to M1+ and M1- bacteria (Fig. 6). As controls, Fn binding by S. pyogenes JRS4, SAM1, and AP1 was also measured. JRS4 constitutively expresses protein F and binds Fn with high affinity. SAM1 is an isogenic protein F- derivative of JRS4 (20). S. pyogenes AP1 is a serotype M1 isolate that lacks the gene encoding protein F. AP1 is capable of binding Fn; however, this trait is at least partially attributable to expression of protein H (15). Fn binding by 90-226 was comparable to that by AP1, although the affinity of the M1 strains for Fn is significantly less than that of JRS4. Consistent with earlier work (20), the protein F- mutant SAM1 exhibited a greatly diminished capacity to bind Fn. Similarly, strain 90-226 was found to consistently bind Fn with a greater affinity than did its M1- derivative. Overall, Fn binding was reduced 88% for the M1- mutant.


View larger version (20K):
[in this window]
[in a new window]
 
FIG. 6.   Binding of 125I-labeled Fn by S. pyogenes JRS4 (cross ; M6+ protein F+), SAM1 (; M6+ protein F-), AP1 (open circle ; M1+ protein H+), 90-226 (), and 90-226 emm1::Km (black-triangle). Constant numbers of bacterial cells were suspended in PBSAT, mixed with various amounts of 125I-Fn, and rotated end over end for 2 h at room temperature. Bacterial cells were harvested by centrifugation, and the amount of radioactivity associated with the bacterial pellets was determined. The values plotted are the average counts recovered from duplicate tubes. Nonspecific binding was determined by adding the same amounts of labeled protein to tubes containing no bacteria. Counts recovered from these tubes were subtracted from the values plotted. Data for 90-226 and 90-226 emm1::Km are from three independent sets of experiments, each performed with a different preparation of 125I-labeled Fn.

While these results were consistent with direct binding of M1 to Fn, other explanations for these results were possible. Therefore, we tested whether purified M1 could bind Fn. To accomplish this, a DNA fragment coding for amino acid residues 42 to 382 of M1 was cloned into the E. coli expression vector pCYB4. The 343-amino-acid peptide encoded by this fragment corresponds to the extracellular portion of M1 plus 2 amino acids encoded by the vector (Fig. 5). The recombinant protein (M42-382) was expressed in E. coli and purified as described in Materials and Methods. Western blot analysis of M42-382 indicated that the purified protein reacted with M1 antiserum and could bind human Fg (data not shown). Thus, the recombinant protein possessed the properties predicted of M1 protein.

To test for Fn binding to M42-382, the protein was electrophoresed on SDS-polyacrylamide gels and then transferred to nitrocellulose membranes (Fig. 7). As a control, E. coli maltose-binding protein, purified from a strain carrying a derivative of pCYB4, and/or ovalbumin was run in separate lanes of the gels. Membranes were incubated successively with Fn, anti-Fn Ab, and labeled secondary Ab. Fn binding by M1 protein was readily detected in this assay (Fig. 7, lane 2). The higher-molecular-weight band visible in lane 2 appears to be a dimer of the M42-382 protein. As a control for binding of Abs directly to M1 protein, duplicate membranes were incubated with the primary and secondary Abs, without prior incubation with Fn (lane 3). Either no signal or a weak signal was obtained from this control. We conclude that M1 protein can directly bind Fn and that this interaction accounts for most of the Fn binding by strain 90-226. 


View larger version (76K):
[in this window]
[in a new window]
 
FIG. 7.   Fibronectin binding to purified M1 protein. Purified M42-382 protein (lanes 2 and 3) and E. coli maltose-binding protein (lane 1) were electrophoresed through SDS-10% acrylamide gels and transferred to a nitrocellulose membrane. The membrane was blocked and then sliced to remove the portion of the membrane containing the lane 3 sample. The portion of the membrane containing the lane 1 and 2 samples was successively incubated with Fn (25 µg/ml) in TBS, sheep anti-human Fn Ab, alkaline phosphatase conjugated to mouse anti-sheep IgG, and finally a chromogenic alkaline phosphatase substrate. The portion of the membrane containing the lane 3 sample was treated similarly except that Fn was omitted from the first membrane incubation. Lane 4 contained molecular weight standards. The numbers to the right indicate molecular masses of the standards in kilodaltons. The arrow indicates the 39.5-kDa M42-382 peptide. The higher-molecular-weight band present in lane 2 appears to be dimerized M42-382 protein.

Effects of anti-integrin MAbs on intracellular invasion efficiency. Integrins are the major receptors by which mammalian cells adhere to ECM proteins, such as Fn and Lm (22). Integrins have also been found to mediate intracellular invasion by some microbial pathogens (23). Since invasion by strain 90-226 is dependent on binding of Fn or Lm, the involvement of a host integrin(s) in internalization of streptococci seemed likely. To test this possibility, we assayed several MAbs for inhibition of invasion by M1+ bacteria. These experiments were performed in the presence of added Fn. MAbs directed against the integrin alpha 5 and beta 1 subunits were found to inhibit Fn-mediated invasion, whereas MAbs directed against integrins alpha 2, alpha 3, alpha 5, alpha 6, beta 1, beta 2, and beta 4 had slight to no inhibitory effects (Fig. 8). Control experiments were performed to verify that the inhibitory MAbs did not adversely affect bacterial viability or adherence of A549 cells to the substratum (data not shown). Since the two inhibitory MAbs should both react with the epithelial cell Fn receptor, integrin alpha 5beta 1, we obtained a MAb that specifically recognizes this receptor (5) and tested it for invasion inhibition. This MAb also inhibited Fn-mediated invasion, suggesting that Fn stimulates internalization of M1+ streptococci by facilitating bacterial interaction with integrin alpha 5beta 1.


View larger version (26K):
[in this window]
[in a new window]
 
FIG. 8.   Effects of anti-integrin MAbs on intracellular invasion. MAbs recognizing the indicated integrin subunits were diluted in RPMI 1640 medium containing Fn and incubated with A549 monolayers for 30 min prior to addition of bacteria. Thereafter, the standard assay procedure was followed. Purified MAbs against integrins alpha 5 and beta 1 were diluted to 0.35 and 0.5 µg/ml, respectively. Other MAbs were diluted 1:50; final concentrations of Abs varied from 4.8 to 38 µg/ml. Percent inhibition was calculated as described in the legend to Fig. 4. Data are means and ranges from assays performed in triplicate.

The potential of anti-integrin beta 1 and alpha 5beta 1 MAbs to inhibit invasion promoted by agonists other than Fn was also evaluated (Fig. 9a). Anti-integrin beta 1 MAb inhibited Fn-, Lm-, and FBS-mediated invasion by 91, 98, and 86%, respectively. Invasion in the presence of the GRGDTP peptide was also inhibited by 23%, but this inhibition appeared not to be specific for the peptide-promoted invasion pathway, since a comparable level of inhibition (21.5%) was observed when no agonist was present (Fig. 9a, None).


View larger version (49K):
[in this window]
[in a new window]
 
FIG. 9.   Invasion inhibition by anti-integrin beta 1 and alpha 5beta 1 MAbs. MAbs directed against integrin beta 1 (a) and integrin alpha 5beta 1 (b) were added to RPMI 1640 medium containing the indicated agonists. M1+ bacteria were added to this medium and to identical media to which MAb was not added. The bacterial suspensions were then inoculated onto A549 monolayers. Thereafter, the standard assay procedure was followed. Percent inhibition was calculated as described in the legend to Fig. 4. Data are mean percentages and ranges from a representative experiment in which each assay was performed in triplicate.

The anti-integrin alpha 5beta 1 MAb inhibited Fn-mediated invasion by 94% and FBS-mediated invasion by 80% (Fig. 9b). Lm-mediated invasion did not seem to be specifically inhibited by this Ab since the level of inhibition (32%) was comparable to that observed in the absence of an agonist (26%). The nonspecific effects of the MAbs could result from blocking bacterial access to other receptors or cross-reactions with other integrins, or perhaps they are the result of physiological effects on the epithelial cells. These results suggest that even though Fn and Lm are both dependent on M1 protein expression to stimulate invasion, the two agonists target bacteria to distinct host cell integrins.

    DISCUSSION
Top
Abstract
Introduction
Materials & Methods
Results
Discussion
References

The streptococcal M protein is an important virulence factor known to bind a number of human plasma proteins, including albumin, IgG, Fg, and complement components. M protein is known to play multiple roles in the pathogenesis of S. pyogenes infections, including resistance to phagocytosis, adherence to host tissues, microcolony formation subsequent to adherence, and intracellular invasion (6, 14, 24). Expression of serotype M1 protein by a highly invasive S. pyogenes isolate, strain 90-226, has been found to be required for adherence to and invasion of HeLa cells (10a). Invasion of A549 human lung epithelial cells by this strain has also been reported to be dependent on bacterial exposure to mammalian serum, human Fg, or RGD-containing peptides (10). The Fg preparation used in earlier experiments, however, contained approximately 1.6% Fn, and as reported here, Fn was the true invasion agonist. The results reported here indicate that Lm is also an effective agonist.

Fn and Lm are high-molecular-weight extracellular glycoproteins present in blood and the ECM of numerous tissues (41, 44, 49). Isogenic M1+ and M1- strains were tested for their responses to FBS, Fn, or Lm addition, with regard to invasion of A549 cells. In the absence of an agonist, invasion by either strain was very inefficient, with less than 1% internalization of the inoculum. FBS, Fn, or Lm stimulated invasion of M1+ streptococci up to 70-fold. FBS and Fn failed to promote invasion by the M1- mutant, and Lm stimulated invasion only twofold. Therefore, the ability of either Fn or Lm to stimulate invasion by strain 90-226 is dependent on expression of M1 protein. Abs directed against Fn or integrin alpha 5beta 1 were both effective at blocking invasion stimulation by Fn; however, neither Ab abrogated Lm-mediated invasion. These results establish that Fn and Lm are distinct, M1-dependent agonists.

Small synthetic peptides containing the tripeptide sequence RGD can promote epithelial cell invasion by strain 90-226 (10). The same peptides were found to be equally effective at promoting invasion by M1- streptococci; thus, peptide-promoted invasion is independent of M1 expression. Also, anti-integrin beta 1 MAb did not block peptide-promoted invasion, whereas the same MAb inhibited invasion in the presence of Fn or Lm. As a whole, these results indicate that strain 90-226 possesses at least three distinct mechanisms for invasion of epithelial cells. Enteropathogenic Yersinia also encode multiple, independent pathways for entry into cultured cells (12).

Strain 90-226 was previously shown to adhere to A549 cells independently of invasion agonists, but adherence could be stimulated approximately twofold by the addition of 10% FBS (10). Agonist-independent adherence is also M1 independent, as we found that M1+ and M1- bacteria adhered nearly equally well to cultured A549 cells suspended in unsupplemented medium. Adherence by the M1+ strain responded to Fn and Lm, as well as to FBS. In contrast, adherence by the M1- mutant was not appreciably affected by Fn or Lm. Thus, strain 90-226 possesses both factor-dependent and factor-independent adhesins for binding A549 cells. Epithelial cell binding via the latter is apparently insufficient for efficient internalization of bacteria. Adherence mediated by the factor-dependent adhesin, M1 protein, presumably targets bacteria to the appropriate cell receptor for efficient internalization to occur. This is consistent with the fact that invasion agonists have their greatest impact on the efficiency with which adherent bacteria are internalized by epithelial cells. Only 0.1 to 1% of M1+ bacteria that adhere to A549 cells in the absence of an agonist are internalized. This value is increased to approximately 6, 36, or 26% when FBS, Fn, or Lm, respectively, is present. In contrast, adherent M1- bacteria are inefficiently internalized even in the presence of these factors.

The potential of serum or ECM proteins to facilitate adherence to host tissues is a common trait of bacterial pathogens (39). For some microbial pathogens, intracellular invasion is facilitated by binding of host ECM proteins. Vitronectin and Fn can facilitate intracellular invasion by N. gonorrhoeae (11, 17) and Mycobacterium bovis (26), respectively, and invasion by M. leprae can be stimulated by microbial binding of Fn (47) or, as suggested by a recent report, Lm (43).

Two closely related Fn-binding proteins, SfbI and protein F, have been implicated in intracellular invasion by S. pyogenes. Molinari et al. (31) demonstrated that Fn binding by SfbI is apparently sufficient to trigger internalization of streptococci by HEp-2 cells. Jadoun et al. (24) recently reported that a mutation in the gene encoding protein F decreased invasion of HEp-2 cells about sevenfold. The latter study also demonstrated that expression of the cloned protein F gene in a noninvasive strain resulted in a significant increase in invasion efficiency. In both studies, invasion was tested in the presence of FBS, and it was not reported whether exogenous addition of Fn could stimulate internalization of streptococci. This seems likely to be the case, however, since soluble Fn has been shown to promote adherence of protein F+ strains to host cells, apparently by forming a bridge between bacterial cells and host tissues (35). A bridging effect also seems likely to account for Fn- and Lm-mediated invasion by M1+ streptococci. Ab directed against integrin alpha 5beta 1, known to be expressed by A549 cells (28), specifically abrogates Fn-mediated invasion, suggesting that Fn targets bacterial binding to this integrin. We propose that interaction with this receptor results in ligand-mediated endocytosis of bacteria by A549 cells. Since Fn is the only known alpha 5beta 1 ligand (22), it was not anticipated that MAb specific for this receptor would block invasion mediated by Lm. Ab directed against the beta 1 integrin subunit does abrogate Lm-mediated invasion, suggesting that Lm fosters bacterial interaction with one or more beta 1 integrins (alpha 1beta 1, alpha 2beta 1, alpha 3beta 1, alpha 6beta 1, or alpha 7beta 1) for which Lm is a ligand (22, 49). Although MAbs against the integrin alpha 2, alpha 3, and alpha 6 subunits were used in this study, these MAbs have thus far been tested only for inhibition of Fn-mediated invasion. The mechanism underlying M1-dependent entry of streptococci into cultured cells seems to most closely resemble that underlying uptake of Y. pseudotuberculosis. This organism also encodes multiple, independent pathways for entry into mammalian cells. One pathway is mediated by invasin, a 108-kDa outer membrane protein capable of binding at least four different beta 1 chain integrins, including the alpha 5beta 1 receptor (23). Interaction of invasin with alpha 5beta 1 is not dependent on Fn binding by either receptor. Rather, invasin binds directly to alpha 5beta 1 with high affinity and binding can be inhibited by Fn or RGD-containing peptides (51). This mechanism is clearly distinct from that used by M1+ streptococci, which is mediated by integrin ligands. It is not yet clear, however, whether integrin recognition of M1-bound ligands is sufficient to promote bacterial entry. Direct engagement of integrins or possibly other host receptor molecules by M1 may be required for efficient internalization of bacteria.

Among the numerous streptococcal proteins capable of binding Fn that have been described are protein F/SfbI, protein F2, serum opacity factor (SOF), protein H, glyceraldehyde-3-phosphate dehydrogenase (GPD), and Fbp54 (9, 15, 20, 25, 31, 38, 42). The clonal line of which strain 90-226 is representative reportedly lacks the genes encoding protein F/SfbI and SOF (33, 42), and results reported here suggest that the strain may also lack the gene encoding protein H. 90-226 does carry the Fbp54 gene, but anti-Fbp54 serum did not inhibit invasion by this strain (unpublished data). At present, we have no information regarding the presence of genes coding for F2 or GPD in this strain. Regardless of what other Fn-binding proteins may be expressed by 90-226, M1 appears to account for the majority of the strain's Fn-binding activity, since the emm1::Km mutation reduces binding by 88%. Additionally, purified M1 protein is capable of binding Fn. These results are consistent with the proposal that Fn functions as a bridging molecule between M1 and integrin alpha 5beta 1. Although we are unaware of any previous reports of Fn binding by M1, M3 protein and protein H, an M-like protein, are known to bind Fn (15, 46).

Strains 90-226 and AP1 bind Fn less efficiently than do strains (e.g., JRS4) expressing the high-affinity Fn-binding protein, protein F. As shown here, however, the invasion properties of the former organism can be markedly affected by exposure to Fn. Inclusion of 10 µg of Fn per ml in in vitro assays can increase bacterial internalization by a factor of 70, and Fn can stimulate bacterial uptake when present at much lower concentrations. The concentration of Fn in bodily fluids such as serum (300 µg/ml [44]) or saliva (<= 3 µg/ml [29]) seems sufficiently high to accommodate Fn acquisition by organisms possessing only low-affinity Fn receptors.

While M1 expression is necessary for invasion, one question not fully addressed is whether M1 expression is sufficient for high-efficiency invasion. Recent results in our laboratory suggest that this may be the case, since M1-coated polystyrene latex beads can be internalized by human epithelial cells (10a). It is difficult, however, to quantitatively compare these results with those obtained from antibiotic protection assays. Moreover, other studies suggest that M1 expression may not be sufficient for high-level invasion. For example, several recent studies demonstrate that serotype M1 strains vary considerably in their abilities to invade cultured cells (7, 24, 30). These differences could be due to sequence divergence in M1 proteins (32), different levels of emm1 expression (7), or expression of novel genes by highly invasive isolates.

Another factor with the potential to influence the efficiency of intracellular invasion by S. pyogenes is the concentration of invasion agonists present in in vitro assays. As reported here, we have found that the ability of Fn to mediate invasion varies considerably, depending on the source of the preparation. This may not be surprising since the activity of Fn in other types of assays can be markedly affected by the procedure used for protein isolation. Even the concentration of Fn in serum can be greatly influenced by the method used for serum preparation (44). It is possible that the concentration or quality of soluble invasion agonists partially accounts for the different invasion efficiencies reported by different laboratories. For example, Jadoun et al. (24) found that AP1 is inefficiently internalized by HEp-2 cells. Recent results in our laboratory indicate that AP1 can be internalized with a reasonable efficiency but that internalization is highly Fn dependent. Obviously, additional work is required to understand what variables account for the different intracellular invasion efficiencies by M1 strains.

Several researchers (18, 37, 48, 50) have reported that there is no observable growth of intracellular streptococci, and infected cell lines are eventually cleared of bacteria. This led Schrager et al. (48) to propose that intracellular invasion by streptococci may not represent a virulence mechanism but rather may actually contribute to host containment of infections. Österlund and Engstrand (37), however, reported that S. pyogenes can remain viable within HEp2 cells for up to 7 days. Also, we have found that M1+ bacteria can be recovered from infected A549 cells after several days of exposure to antibiotics. These results suggest that invasion of host cells may promote bacterial persistence in infected patients who receive antibiotic therapy. This proposal is supported by the finding of Österlund et al. (36) that streptococci can be localized in pharyngeal epithelial cells in 93% of patients with recurrent pharyngotonsillitis. While it is yet undetermined to what extent intracellular invasion affects the severity or frequency of streptococcal disease, it is clear that S. pyogenes has evolved a number of mechanisms for invasion of human cells, suggesting that intracellular invasion is an important aspect of streptococcal pathogenesis.

    ACKNOWLEDGMENTS

We thank Tim Leonard, University of Minnesota, for help in figure preparation.

This study was financed by PHS grant AI34503. D.C. was supported by PHS training grant AI07421. P.E.D. was supported by PHS training grant T32-HD-07381.

    FOOTNOTES

* Corresponding author. Mailing address: Box 196 UMHC, Department of Microbiology, University of Minnesota, Minneapolis, MN 55455. Phone: (612) 624-3932. Fax: (612) 626-0623. E-mail: Cleary{at}lenti.med.umn.edu.

Editor:   P. E. Orndorff

    REFERENCES
Top
Abstract
Introduction
Materials & Methods
Results
Discussion
References

1. Akesson, P., A. G. Sjoholm, and L. Björck. 1996. Protein SIC---a novel extracellular protein of Streptococcus pyogenes interfering with complement function. J. Biol. Chem. 271:1081-1088[Abstract/Free Full Text].
2. Akesson, P., K.-H. Schmidt, J. Cooney, and L. Björck. 1994. M1 protein and protein H: IgGFc- and albumin-binding streptococcal surface proteins encoded by adjacent genes. Biochem. J. 300:877-886.
3. Bayles, K. W., C. A. Wesson, L. E. Liou, L. K. Fox, G. A. Bohach, and W. R. Trumble. 1998. Intracellular Staphylococcus aureus escapes the endosome and induces apotosis in epithelial cells. Infect. Immun. 66:336-342[Abstract/Free Full Text].
4. Bradford, M. M. 1976. A rapid and sensitive method for the quantitation of microgram quantities of protein utilizing the principle of protein-dye binding. Anal. Biochem. 72:248-254[Medline].
5. Caixia, S., S. Stewart, E. Wayner, W. Carter, and J. Wilkins. 1991. Antibodies to different members of the beta 1 (CD29) integrins induce homotypic and heterotypic cellular aggregation. Cell. Immunol. 138:216-228[Medline].
6. Caparon, M. G., D. S. Stephens, A. Olsen, and J. R. Scott. 1991. Role of M protein in adherence of group A streptococci. Infect. Immun. 59:1811-1817[Abstract/Free Full Text].
7. Cleary, P. P., L. McLandsborough, L. Ikeda, D. Cue, J. Krawczak, and H. Lam. 1998. High frequency intracellular infection and erythrogenic toxin A expression undergo phase variation in M1 group A streptococci. Mol. Microbiol. 28:157-167[Medline].
8. Cleary, P. P., E. L. Kaplan, J. P. Handley, A. Wlazlo, M. H. Kim, A. R. Hauser, and P. M. Schlievert. 1992. Clonal basis for resurgence of serious Streptococcus pyogenes disease in the 1980s. Lancet 339:518-521[Medline].
9. Courtney, H. S., Y. Li, J. B. Dale, and D. L. Hasty. 1994. Cloning, sequencing, and expression of a fibronectin/fibrinogen-binding protein from group A streptococci. Infect. Immun. 62:3937-3946[Abstract/Free Full Text].
10. Cue, D. R., and P. P. Cleary. 1997. High-frequency invasion of epithelial cells by Streptococcus pyogenes can be activated by fibrinogen and peptides containing the sequence RGD. Infect. Immun. 65:2759-2764[Abstract]. (Retraction, 66:4577, 1998.)
10a. Dombek, P. E., and P. P. Cleary. Unpublished data.
11. Duensing, T. D., and J. P. M. van Putten. 1997. Vitronectin mediates internalization of Neisseria gonorrhoeae by Chinese hamster ovary cells. Infect. Immun. 65:964-970[Abstract].
12. Falkow, S., R. R. Isberg, and D. A. Portnoy. 1992. The interaction of bacteria with mammalian cells. Annu. Rev. Cell Biol. 8:333-363.
13. Finlay, B. B., and S. Falkow. 1997. Common themes in microbial pathogenicity revisited. Microbiol. Mol. Biol. Rev. 61:136-169[Abstract].
14. Fischetti, V. A. 1989. Streptococcal M protein: molecular design and biological behavior. Clin. Microbiol. Rev. 2:285-314[Abstract/Free Full Text].
15. Frick, I.-M., K. L. Crossin, G. M. Edelman, and L. Björck. 1995. Protein H---a bacterial surface protein with affinity for both immunoglobulin and fibronectin type III domains. EMBO J. 14:1674-1679[Medline].
16. Gerber, M. A. 1994. Treatment failures and carriers: perception or problems? Pediatr. Infect. Dis. J. 13:576-579[Medline].
17. Gomez-Duarte, O. G., M. Dehio, C. A. Guzman, G. S. Chhatwal, C. Dehio, and T. F. Meyer. 1997. Binding of vitronectin to Opa-expressing Neisseria gonorrhoeae mediates invasion of HeLa cells. Infect. Immun. 65:3857-3866[Abstract].
18. Greco, R., L. De Martino, G. Donnarumma, M. P. Conte, L. Seganti, and P. Valenti. 1995. Invasion of cultured human cells by Streptococcus pyogenes. Res. Microbiol. 146:551-560[Medline].
19. Hanski, E., P. A. Horwitz, and M. G. Caparon. 1992. Expression of protein F, the fibronectin-binding protein of Streptococcus pyogenes JRS4, in heterologous streptococcal and enterococcal strains promotes their adherence to respiratory epithelial cells. Infect. Immun. 60:5119-5125[Abstract/Free Full Text].
20. Hanski, E., and M. Caparon. 1992. Protein F, a fibronectin-binding protein, is an adhesin of the group A streptococcus Streptococcus pyogenes. Proc. Natl. Acad. Sci. USA 89:6172-6176[Abstract/Free Full Text].
21. Harbaugh, M. P., A. Podbielski, S. Hugl, and P. P. Cleary. 1993. Nucleotide substitutions and small-scale insertion produce size and antigenic variation in group A streptococcal M1 protein. Mol. Microbiol. 8:981-991[Medline].
22. Hynes, R. O. 1992. Integrins: versatility, modulation, and signaling in cell adhesion. Cell 69:11-25[Medline].
23. Isberg, R. R., and J. M. Leong. 1990. Multiple beta 1 chain integrins are receptors for invasin, a protein that promotes bacterial penetration into mammalian cells. Cell 60:861-871[Medline].
24. Jadoun, J., E. Burstein, E. Hanski, and S. Sela. 1997. Proteins M6 and F1 are required for efficient invasion of group A streptococci into cultured epithelial cells, p. 511-515. In T. Horaud, et al. (ed.), Streptococcus and the host. Plenum Press, New York, N.Y.
25. Jaffe, J., S. Natanson-Yaron, M. G. Caparon, and E. Hanski. 1996. Protein F2, a novel fibronectin-binding protein from Streptococcus pyogenes, possesses two binding domains. Mol. Microbiol. 21:373-384[Medline].
26. Kuroda, K., E. J. Brown, W. B. Telle, D. G. Russell, and T. L. Ratliff. 1993. Characterization of the internalization of bacillus Calmette-Guerin by human bladder tumor cells. J. Clin. Investig. 91:69-76.
27. Laemmli, U. K. 1970. Cleavage of structural proteins during the assembly of the head of bacteriophage T4. Nature 227:680-685[Medline].
28. Lafrenie, R. M., T. J. Podor, M. R. Buchanan, and F. W. Orr. 1992. Up-regulated biosynthesis and expression of endothelial cell vitronectin receptor enhances cancer cell adhesion. Cancer Res. 52:2202-2208[Abstract/Free Full Text].
29. Lamberts, B. L., E. D. Pederson, J. J. Bial, and P. K. Tombasco. 1989. Fibronectin levels of unstimulated saliva from naval recruits with and without chronic inflammatory periodontal disease. J. Clin. Periodontol. 16:342-346[Medline].
30. LaPenta, D., C. Rubens, E. Chi, and P. P. Cleary. 1994. Group A streptococci efficiently invade human respiratory epithelial cells. Proc. Natl. Acad. Sci. USA 91:12115-12119[Abstract/Free Full Text].
31. Molinari, G., S. R. Talay, P. Valentin-Weigand, M. Rohde, and G. S. Chhatwal. 1997. The fibronectin-binding protein of Streptococcus pyogenes, SfbI, is involved in the internalization of group A streptococci by epithelial cells. Infect. Immun. 65:1357-1363[Abstract].
32. Musser, J. M., V. Kapur, J. Szeto, X. Pan, D. S. Swanson, and D. R. Martin. 1995. Genetic diversity and relationships among Streptococcus pyogenes strains expressing serotype M1 protein: recent intercontinental spread of a subclone causing episodes of invasive disease. Infect. Immun. 63:994-1003[Abstract].
33. Natanson, S., S. Sela, A. E. Moses, J. M. Musser, M. G. Caparon, and E. Hanski. 1995. Distribution of fibronectin-binding proteins among group A streptococci of different M types. J. Infect. Dis. 171:871-878[Medline].
34. New England Biolabs. 1996. IMPACT I: one-step protein purification system, technical manual. New England Biolabs Inc., Beverly, Mass.
35. Okada, N, A. P. Pentland, P. Falk, and M. G. Caparon. 1994. M protein and protein F act as important determinants of cell-specific tropism of Streptococcus pyogenes in skin tissue. J. Clin. Investig. 94:965-977.
36. Österlund, A., R. Popa, T. Nikkila, A. Scheynius, and L. Engstrand. 1997. Intracellular reservoir of Streptococcus pyogenes in vivo: a possible explanation for recurrent pharyngotonsillitis. Laryngoscope 107:640-646[Medline].
37. Österlund, A., and L. Engstrand. 1995. Intracellular penetration and survival of Streptococcus pyogenes in respiratory epithelial cells in vitro. Acta Otolaryngol. (Stockholm) 115:685-688[Medline].
38. Pancholi, V., and V. A. Fischetti. 1992. A major surface protein on group A streptococci is a glyceraldehyde-3-phosphate-dehydrogenase with multiple binding activity. J. Exp. Med. 176:415-426[Abstract/Free Full Text].
39. Patti, J. M., B. L. Allen, M. J. McGavin, and M. Hook. 1994. MSCRAMM-mediated adherence of microorganisms to host tissues. Annu. Rev. Microbiol. 48:585-617[Medline].
40. Podbielski, A., B. Melzer, and R. Lutticken. 1991. Application of the polymerase chain reaction to study the M protein (-like) gene family in beta-hemolytic streptococci. Med. Microbiol. Immunol. 180:213-227[Medline].
41. Potts, J. R., and I. D. Campbell. 1996. Structure and function of fibronectin modules. Matrix Biol. 15:313-320[Medline].
42. Rakonjac, J. V., J. C. Robbins, and V. A. Fischetti. 1995. DNA sequence of the serum opacity factor of group A streptococci: identification of a fibronectin-binding repeat domain. Infect. Immun. 63:622-631[Abstract].
43. Rambukkana, A., J. L. Salzer, P. D. Yurchenco, and E. I. Tuomanen. 1997. Neural targeting of Mycobacterium leprae mediated by the G domain of the laminin-alpha 2 chain. Cell 88:811-821[Medline].
44. Ruoslahti, E., E. G. Hayman, M. Pierschbacher, and E. Engvall. 1982. Fibronectin: purification, immunochemical properties, and biological activities. Methods Enzymol. 82:803-831.
45. Sambrook, J., E. F. Fritsch, and T. Maniatis. 1989. Molecular cloning: a laboratory manual, 2nd ed. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y.
46. Schmidt, K.-H., K. Mann, J. Cooney, and W. Kohler. 1993. Multiple binding of type 3 streptococcal M protein to human fibrinogen, albumin and fibronectin. FEMS Immunol. Med. Microbiol. 7:135-144[Medline].
47. Schorey, J. S., Q. Li, D. W. McCourt, M. Bong-Mastek, J. E. Clark-Curtiss, T. L. Ratliff, and E. J. Brown. 1995. A Mycobacterium leprae gene encoding a fibronectin binding protein is used for efficient invasion of epithelial cells and Schwann cells. Infect. Immun. 63:2652-2657[Abstract].
48. Schrager, H. M., J. G. Rheinwald, and M. R. Wessels. 1996. Hyaluronic acid capsule and the role of streptococcal entry into keratinocytes in invasive skin infection. J. Clin. Investig. 98:1954-1958[Medline].
49. Timpl, R., and J. C. Brown. 1994. The laminins. Matrix Biol. 14:275-281[Medline].
50. Tsai, P. J., C. F. Kuo, K. Y. Lin, Y. S. Lin, H. Y. Lei, F. F. Chen, J. R. Wang, and J. J. Wu. 1998. Effect of group A streptococcal cysteine protease on invasion of epithelial cells. Infect. Immun. 66:1460-1466[Abstract/Free Full Text].
51. Van Nhieu, G. T., and R. R. Isberg. 1991. The Yersinia pseudotuberculosis invasin protein and human fibronectin bind to mutually exclusive sites on the alpha 5beta 1 integrin receptor. J. Biol. Chem. 266:24367-24375[Abstract/Free Full Text].
52. Xu, M.-Q., D. G. Comb, H. Paulus, C. J. Noren, Y. Shao, and F. B. Perler. 1994. Protein splicing: an analysis of the branched intermediate and its resolution by succinimide formation. EMBO J. 13:5517-5522[Medline].


Infection and Immunity, October 1998, p. 4593-4601, Vol. 66, No. 10
0019-9567/98/$04.00+0
Copyright © 1998, American Society for Microbiology. All rights reserved.



This article has been cited by other articles:

  • Bergmann, S., Lang, A., Rohde, M., Agarwal, V., Rennemeier, C., Grashoff, C., Preissner, K. T., Hammerschmidt, S. (2009). Integrin-linked kinase is required for vitronectin-mediated internalization of Streptococcus pneumoniae by host cells. J. Cell Sci. 122: 256-267 [Abstract] [Full Text]  
  • Loof, T. G., Goldmann, O., Medina, E. (2008). Immune Recognition of Streptococcus pyogenes by Dendritic Cells. Infect. Immun. 76: 2785-2792 [Abstract] [Full Text]  
  • Gillen, C. M., Courtney, H. S., Schulze, K., Rohde, M., Wilson, M. R., Timmer, A. M., Guzman, C. A., Nizet, V., Chhatwal, G. S., Walker, M. J. (2008). Opacity Factor Activity and Epithelial Cell Binding by the Serum Opacity Factor Protein of Streptococcus pyogenes Are Functionally Discrete. J. Biol. Chem. 283: 6359-6366 [Abstract] [Full Text]  
  • Liang, X., Yu, C., Sun, J., Liu, H., Landwehr, C., Holmes, D., Ji, Y. (2006). Inactivation of a Two-Component Signal Transduction System, SaeRS, Eliminates Adherence and Attenuates Virulence of Staphylococcus aureus.. Infect. Immun. 74: 4655-4665 [Abstract] [Full Text]  
  • Wang, B., Li, S., Southern, P. J., Cleary, P. P. (2006). Streptococcal modulation of cellular invasion via TGF-beta1 signaling. Proc. Natl. Acad. Sci. USA 103: 2380-2385 [Abstract] [Full Text]  
  • Nitsche, D. P., Johansson, H. M., Frick, I.-M., Morgelin, M. (2006). Streptococcal Protein FOG, a Novel Matrix Adhesin Interacting with Collagen I in Vivo. J. Biol. Chem. 281: 1670-1679 [Abstract] [Full Text]  
  • Lee, S. G., Fischetti, V. A. (2006). Purification and Characterization of LPXTGase from Staphylococcus aureus: the Amino Acid Composition Mirrors That Found in the Peptidoglycan. J. Bacteriol. 188: 389-398 [Abstract] [Full Text]  
  • Wei, L., Pandiripally, V., Gregory, E., Clymer, M., Cue, D. (2005). Impact of the SpeB Protease on Binding of the Complement Regulatory Proteins Factor H and Factor H-Like Protein 1 by Streptococcus pyogenes. Infect. Immun. 73: 2040-2050 [Abstract] [Full Text]  
  • Cameron, C. E., Brown, E. L., Kuroiwa, J. M. Y., Schnapp, L. M., Brouwer, N. L. (2004). Treponema pallidum Fibronectin-Binding Proteins. J. Bacteriol. 186: 7019-7022 [Abstract] [Full Text]  
  • Oehmcke, S., Podbielski, A., Kreikemeyer, B. (2004). Function of the Fibronectin-Binding Serum Opacity Factor of Streptococcus pyogenes in Adherence to Epithelial Cells. Infect. Immun. 72: 4302-4308 [Abstract] [Full Text]  
  • Gutekunst, H., Eikmanns, B. J., Reinscheid, D. J. (2004). The Novel Fibrinogen-Binding Protein FbsB Promotes Streptococcus agalactiae Invasion into Epithelial Cells. Infect. Immun. 72: 3495-3504 [Abstract] [Full Text]  
  • Nyberg, P., Rasmussen, M., von Pawel-Rammingen, U., Bjorck, L. (2004). SpeB modulates fibronectin-dependent internalization of Streptococcus pyogenes by efficient proteolysis of cell-wall-anchored protein F1. Microbiology 150: 1559-1569 [Abstract] [Full Text]  
  • Weineisen, M., Sjobring, U., Fallman, M., Andersson, T. (2004). Streptococcal M5 Protein Prevents Neutrophil Phagocytosis by Interfering with CD11b/CD18 Receptor-Mediated Association and Signaling. J. Immunol. 172: 3798-3807 [Abstract] [Full Text]  
  • Pandiripally, V., Wei, L., Skerka, C., Zipfel, P. F., Cue, D. (2003). Recruitment of Complement Factor H-Like Protein 1 Promotes Intracellular Invasion by Group A Streptococci. Infect. Immun. 71: 7119-7128 [Abstract] [Full Text]  
  • Purushothaman, S. S., Wang, B., Cleary, P. P. (2003). M1 Protein Triggers a Phosphoinositide Cascade for Group A Streptococcus Invasion of Epithelial Cells. Infect. Immun. 71: 5823-5830 [Abstract] [Full Text]  
  • Park, H.-S., Francis, K. P., Yu, J., Cleary, P. P. (2003). Membranous Cells in Nasal-Associated Lymphoid Tissue: A Portal of Entry for the Respiratory Mucosal Pathogen Group A Streptococcus. J. Immunol. 171: 2532-2537 [Abstract] [Full Text]  
  • Haggar, A., Hussain, M., Lonnies, H., Herrmann, M., Norrby-Teglund, A., Flock, J.-I. (2003). Extracellular Adherence Protein from Staphylococcus aureus Enhances Internalization into Eukaryotic Cells. Infect. Immun. 71: 2310-2317 [Abstract] [Full Text]  
  • Lee, S. G., Pancholi, V., Fischetti, V. A. (2002). Characterization of a Unique Glycosylated Anchor Endopeptidase That Cleaves the LPXTG Sequence Motif of Cell Surface Proteins of Gram-positive Bacteria. J. Biol. Chem. 277: 46912-46922 [Abstract] [Full Text]  
  • Pandiripally, V., Gregory, E., Cue, D. (2002). Acquisition of Regulators of Complement Activation by Streptococcus pyogenes Serotype M1. Infect. Immun. 70: 6206-6214 [Abstract] [Full Text]  
  • Elsner, A., Kreikemeyer, B., Braun-Kiewnick, A., Spellerberg, B., Buttaro, B. A., Podbielski, A. (2002). Involvement of Lsp, a Member of the LraI-Lipoprotein Family in Streptococcus pyogenes, in Eukaryotic Cell Adhesion and Internalization. Infect. Immun. 70: 4859-4869 [Abstract] [Full Text]  
  • Jadoun, J., Eyal, O., Sela, S. (2002). Role of CsrR, Hyaluronic Acid, and SpeB in the Internalization of Streptococcus pyogenes M Type 3 Strain by Epithelial Cells. Infect. Immun. 70: 462-469 [Abstract] [Full Text]  
  • Terao, Y., Kawabata, S., Kunitomo, E., Nakagawa, I., Hamada, S. (2002). Novel Laminin-Binding Protein of Streptococcus pyogenes, Lbp, Is Involved in Adhesion to Epithelial Cells. Infect. Immun. 70: 993-997 [Abstract] [Full Text]  
  • DeMaster, E., Schnitzler, N., Cheng, Q., Cleary, P. (2002). M+ Group A Streptococci Are Phagocytized and Killed in Whole Blood by C5a-Activated Polymorphonuclear Leukocytes. Infect. Immun. 70: 350-359 [Abstract] [Full Text]  
  • Ryan, P. A., Pancholi, V., Fischetti, V. A. (2001). Group A Streptococci Bind to Mucin and Human Pharyngeal Cells through Sialic Acid-Containing Receptors. Infect. Immun. 69: 7402-7412 [Abstract] [Full Text]  
  • Lindmark, H., Nilsson, M., Guss, B. (2001). Comparison of the Fibronectin-Binding Protein FNE from Streptococcus equi Subspecies equi with FNZ from S. equi Subspecies zooepidemicus Reveals a Major and Conserved Difference. Infect. Immun. 69: 3159-3163 [Abstract] [Full Text]  
  • Lukomski, S., Nakashima, K., Abdi, I., Cipriano, V. J., Ireland, R. M., Reid, S. D., Adams, G. G., Musser, J. M. (2000). Identification and Characterization of the scl Gene Encoding a Group A Streptococcus Extracellular Protein Virulence Factor with Similarity to Human Collagen. Infect. Immun. 68: 6542-6553 [Abstract] [Full Text]  
  • Sinha, B., Francois, P., Que, Y.-A., Hussain, M., Heilmann, C., Moreillon, P., Lew, D., Krause, K.-H., Peters, G., Herrmann, M. (2000). Heterologously Expressed Staphylococcus aureus Fibronectin-Binding Proteins Are Sufficient for Invasion of Host Cells. Infect. Immun. 68: 6871-6878 [Abstract] [Full Text]  
  • Cunningham, M. W. (2000). Pathogenesis of Group A Streptococcal Infections. Clin. Microbiol. Rev. 13: 470-511 [Abstract] [Full Text]  
  • Chaussee, M. S., Cole, R. L., van Putten, J. P. M. (2000). Streptococcal Erythrogenic Toxin B Abrogates Fibronectin-Dependent Internalization of Streptococcus pyogenes by Cultured Mammalian Cells. Infect. Immun. 68: 3226-3232 [Abstract] [Full Text]  
  • Degnan, B. A., Fontaine, M. C., Doebereiner, A. H., Lee, J. J., Mastroeni, P., Dougan, G., Goodacre, J. A., Kehoe, M. A. (2000). Characterization of an Isogenic Mutant of Streptococcus pyogenes Manfredo Lacking the Ability To Make Streptococcal Acid Glycoprotein. Infect. Immun. 68: 2441-2448 [Abstract] [Full Text]  
  • Vasi, J., Frykberg, L., Carlsson, L. E., Lindberg, M., Guss, B. (2000). M-Like Proteins of Streptococcus dysgalactiae. Infect. Immun. 68: 294-302 [Abstract] [Full Text]  
  • Lindmark, H., Guss, B. (1999). SFS, a Novel Fibronectin-Binding Protein from Streptococcus equi, Inhibits the Binding between Fibronectin and Collagen. Infect. Immun. 67: 2383-2388 [Abstract] [Full Text]  
  • Cleary, P. P., LaPenta, D., Vessela, R., Lam, H., Cue, D. (1998). A Globally Disseminated M1 Subclone of Group A Streptococci Differs from Other Subclones by 70 Kilobases of Prophage DNA and Capacity for High-Frequency Intracellular Invasion. Infect. Immun. 66: 5592-5597 [Abstract] [Full Text]  
  • Tomasini-Johansson, B. R., Kaufman, N. R., Ensenberger, M. G., Ozeri, V., Hanski, E., Mosher, D. F. (2001). A 49-Residue Peptide from Adhesin F1 of Streptococcus pyogenes Inhibits Fibronectin Matrix Assembly. J. Biol. Chem. 276: 23430-23439 [Abstract] [Full Text]  
  • Cue, D., Southern, S. O., Southern, P. J., Prabhakar, J., Lorelli, W., Smallheer, J. M., Mousa, S. A., Cleary, P. P. (2000). A nonpeptide integrin antagonist can inhibit epithelial cell ingestion of Streptococcus pyogenes by blocking formation of integrin alpha 5 beta 1-fibronectin-M1 protein complexes. Proc. Natl. Acad. Sci. USA 97: 2858-2863 [Abstract] [Full Text]  

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowReprints and Permissions
Right arrow Copyright Information
Right arrow Books from ASM Press
Right arrow MicrobeWorld
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Cue, D.
Right arrow Articles by Cleary, P. P.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Cue, D.
Right arrow Articles by Cleary, P. P.