Previous Article | Next Article 
Infection and Immunity, October 1998, p. 4762-4766, Vol. 66, No. 10
0019-9567/98/$04.00+0
Copyright © 1998, American Society for Microbiology. All rights reserved.
Identification of the Cilium Binding Epitope of the
Mycoplasma hyopneumoniae P97 Adhesin
Tsungda
Hsu, and
F. Chris
Minion*
Department of Microbiology, Immunology and
Preventive Medicine, Veterinary Medical Research Institute, Iowa
State University, Ames, Iowa 50011
Received 28 May 1998/Returned for modification 24 June
1998/Accepted 8 July 1998
 |
ABSTRACT |
Mycoplasma hyopneumoniae colonizes the swine
respiratory tract at the level of ciliated cells by attaching
specifically to the cilium membrane. This interaction involves an
adhesin called P97; the cilium binding activity of this protein was
localized to the carboxy terminus, which included two repeat regions,
R1 and R2 (T. Hsu, S. Artiushin, and F. C. Minion, J. Bacteriol. 179:1317-1323, 1997). To further delineate the molecular mechanisms of
M. hyopneumoniae interactions with ciliated epithelium, we used a bank of transposon inserts in the cloned P97 gene to identify the site for cilium binding by testing the truncated gene products in
an in vitro microtiter plate adherence assay. These studies showed that
the cilium binding site was located in the AAKPV(E) repeat sequence of
P97, referred to as the R1 repeat. For functional binding, at least
seven AAKPV(E) repeats were required. The adherence-blocking monoclonal
antibody F1B6 also recognized this region but required fewer AAKPV(E)
repeats for recognition. We then constructed R1 region-lacZ
gene fusions and used the resulting R1 repeat-
-galactosidase fusion
proteins in an in vitro assay to confirm the role of R1 in cilium
binding. A comparison of the R1 regions of M. hyopneumoniae strains displaying variation in cilium adherence failed to identify changes that could account for the differences in adherence shown by
the strains. Thus, we concluded that other proteins, in addition to
P97, must be involved in cilium adherence, possibly in combination with
P97.
 |
INTRODUCTION |
Mycoplasma hyopneumoniae
constitutes a significant threat to swine health and is responsible for
estimated losses to the swine industry of more than $200 million per
year. Alone it causes a prevalent and persistent disease of swine
called enzootic pneumonia. In combination with other respiratory
pathogens, i.e., porcine reproductive and respiratory syndrome virus or
swine influenza virus, it produces pneumonia significantly more severe
than that after infection with either agent alone (12).
Vaccination against M. hyopneumoniae alone does not prevent
colonization or protect sufficiently against disease, nor does it
obviate the enhancing role of M. hyopneumoniae in dual
infection with other infectious pathogens. In the absence of more
effective intervention strategies to reduce disease, vaccines must be
improved if we are to reduce economic losses due to enzootic pneumonia.
This is only possible if we have a full understanding of the mechanisms
employed by M. hyopneumoniae to cause disease so that
effective therapeutic approaches to circumvent those strategies can be
developed. Therefore, it is essential that the virulence mechanisms of
M. hyopneumoniae be addressed.
The initial event in M. hyopneumoniae colonization of swine
is its adherence to the cilia of the respiratory tract epithelial cells
(8). This is followed by an extensive loss of cilia from the
epithelial cells of the trachea, bronchi, and bronchioles (8). The molecular basis for the cilium binding specificity is unknown, but a 97-kDa protein, designated P97, was shown to be
involved. Recent studies by Zhang et al. (18-20) were
instrumental in establishing a swine cilium-specific adherence assay
and in identifying potential receptors and ligands involved in the
adherence process. A monoclonal antibody (MAb), F1B6, was identified as being able to block M. hyopneumoniae adherence to porcine
cilia in the in vitro adherence assay (20). In addition, the
gene coding for the ciliary adhesin has been cloned and sequenced
(6, 7). It codes for a 125-kDa protein which undergoes a
posttranslational cleavage event to produce a final protein product of
approximately 102.3 kDa. The product migrates as a 97-kDa protein by
sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE) (20) and has been designated P97. The study reported here
focused on the identification and analysis of the cilium binding site of P97.
Study of the molecular basis of mycoplasmal adherence has led to the
identification of putative binding sites for the P1 adhesin of M. pneumoniae (2, 3) and the P1-like MgPa adhesin of Mycoplasma genitalium (11), but these studies
lacked a functional assay to test well-defined mutants. Our studies
used the defined adherence assay described by Zhang et al.
(19) with purified swine cilia and MAb F1B6 to detect
binding of P97. By analysis of a series of Tn1000 insertions
in the P97 sequence that resulted in progressive truncation of the
recombinant protein, we were able to demonstrate both the location of
the MAb epitope and the cilium binding site on the P97 protein. Both
activities reside within an AAKPV(E) repeating motif in the carboxy
terminus of the protein. A minimal number of repeats are required for
functional activity for both the antigenic epitope and cilium binding.
The presence of an adequate number of repeats is not sufficient to confer the ability to adhere, however, suggesting that additional factors or proteins are required for adherence of M. hyopneumoniae to swine cilia.
 |
MATERIALS AND METHODS |
Bacteria.
Escherichia coli strains included the
general cloning host LE392 (5), the opal suppressor host
ISM612 (6), and the conjugal F+ donor DPWC
(14). BW26 is a kanamycin-resistant conjugal recipient (Gold
Biotechnology, Inc., St. Louis, Mo.). CSH50 is ara
(lac-pro) strA thi F
. All
E. coli strains except ISM612 were started from stock
cultures maintained at
70°C and were grown in Luria-Bertani (LB)
broth or on LB agar medium. Strain ISM612 was grown in superbroth
medium (32 g of tryptone, 20 g of yeast extract, and 5 g of
NaCl per liter). Antibiotics were used at the following concentrations: ampicillin, 100 µg per ml; kanamycin, 50 µg per ml; and
chloramphenicol, 10 µg per ml.
All M. hyopneumoniae strains were obtained from Richard F. Ross (Iowa State University) and grown in Friis medium as described previously (6). Strain 232A is a virulent, swine
cilium-adherent strain. Individual clonal isolates of 232A with
different cilium binding characteristics were obtained by picking
single colonies and testing for adherence activity; 232A.H (232A 91-3)
had high adherence activity, 232A.M (232A 20-10) had moderate adherence activity (63% of that of strain 232A.H), and 232A.L (232A 61-3) had
low adherence activity (17% of that of strain 232A.H) (17). Strain J (ATCC 25934), the M. hyopneumoniae type strain, is
avirulent and has low swine cilium adherence activity (20).
Strain 144L is a virulent, cilium-adherent field strain
(20).
Tn1000 mutagenesis.
Tn1000
mutagenesis was performed by conjugal mating of DPWC(pISM2159) with
kanamycin-resistant recipient E. coli BW26 (4). Plasmid pISM2159 contained the P97 gene on a 5.1-kb Tsp509I
fragment as described previously (6). The locations of the
Tn1000 inserts were determined by digestion with restriction
enzymes SalI and EcoRV and by DNA sequencing.
DNA sequencing and PCR.
DNA sequencing was performed by the
Iowa State University DNA facility, using cycle sequencing protocols
and an automated DNA sequencer (model 373 or 377; Applied Biosystems,
The Perkin-Elmer Corporation, Norwalk, Conn.). DNA sequence analysis
was performed with MacVector software (Eastman Kodak Company,
Rochester, N.Y.).
All PCR amplifications were performed with a TwinBlock system (model EZ
cycler; Ericomp Inc., San Diego, Calif.). The annealing
temperature was
determined by Oligo primer analysis software (National
Biosciences,
Inc., Plymouth, Minn.). For analysis of mycoplasmal
DNA, the basic PCR
mixture contained 2 mM MgCl
2, 25 pmol of each
primer, 1 to
50 ng of template DNA, and 0.25 U of
Taq DNA polymerase
in
50 µl of 1× manufacturer's reaction buffer. The PCR conditions
were
as follows: denaturation of the DNA at 94°C for 5 min, followed
by 35 cycles (94°C denaturation for 1 min, 55°C annealing for
1.5 min,
and 72°C extension for 1 min) and a final 5-min 72°C
extension
step.
Primer pairs TH120 (AAGGTAAAAGAGAAGAAGTAG)-TH121
(TTGTAAGTGAAAAGCCAGTAT) and TH122
(AGCGAGTATGAAGAACAAGAA)-TH123
(TTTTTACCTAAGTCAGGAAGG)
were used to amplify the two
repeat regions of P97, R1 and R2,
respectively. For most reactions,
chromosomal DNAs were used as
templates. PCR products were analyzed by
agarose electrophoresis
and by DNA sequencing. For construction of
pISM1244, phosphorylated
primers TH120 and TH121 were used with
Pfu polymerase (Stratagene).
The template DNA for that
reaction was pISM2159, a plasmid containing
the P97 sequence on a
5.1-kb fragment (
6). For plasmids pISM1257
and pISM1258,
chromosomal DNAs of
M. hyopneumoniae J and 144L,
respectively, were used as templates.
Plasmid constructions.
Plasmid pMLB1107, obtained from Greg
Phillips (Iowa State University), was originally constructed by Michael
Berman (1). The plasmid is a pBR322 derivative with the
tetracycline resistance marker replaced by the lacI and
lacZ genes; lacZ has the original Plac promoter upstream controlling its
expression. The lacZ gene has the pUC8 polylinker inserted
at its 5' end within the coding sequence, resulting in unique
SmaI, BamHI, SalI, and HindIII cloning sites at that location. Cloning into any
of these sites results in a lacZ gene fusion that can be
induced with 1 mM isopropyl-
-D-thiogalactopyranoside.
After induction, the fusion protein can be studied by using standard
assays (9). pISM1244, pISM1257, and pISM1258 were
constructed by cloning R1 region PCR products from strains 232A, J, and
144L, respectively, into the SmaI site of pMLB1107 and
transforming the ligation mixture into Lac-deficient CSH50. The
orientation and reading frame of each fragment was confirmed by DNA
sequencing using primer TH121 as described above.
Immunoblot analysis.
Immunoblotting was performed as
described by Towbin et al. (15). Proteins resolved by
SDS-PAGE were transferred to nitrocellulose membranes. After
electroblotting, membranes were blocked with TS-Tween buffer (0.01 M
Tris, 0.140 M NaCl, 0.01% [vol/vol] Tween 20) plus 5% powdered milk
for 1 h and washed three times with TS-Tween for 15 min each time.
The blots were developed with MAb F1B6, which recognized P97 on
immunoblots and inhibited binding of intact M. hyopneumoniae
to purified cilia (20). It was also used previously to
identify clones containing the P97 coding sequence (6).
Adherence assay.
To prepare lysates of recombinant E. coli, 30- to 40-ml aliquots of overnight ISM612 superbroth
cultures were induced with 2.5 mM
isopropyl-
-D-thiogalactopyranoside for 5 to 6 h in
order to enhance suppression of opal UGA codons within the P97 gene sequence (10, 13). The E. coli pellets were
resuspended in 5 ml of TES-2 buffer (50 mM Tris-HCl, 10 mM EDTA, 10%
sucrose [pH 8.0]) and centrifuged again. The final E. coli
pellets were suspended in 2 ml of TES-2 buffer. Cells were lysed by
sonication, and lysates were collected after centrifugation at
12,000 × g for 20 min. Protein concentration was
determined by Bio-Rad protein assay (Bio-Rad Laboratories, Richmond,
Calif.), using bovine serum albumin as the protein standard. Swine
cilia were prepared, and the adherence assay was performed with MAb
F1B6 as described in detail elsewhere (19). Negative
controls included wells with negative control antigens or wells with
blocking buffer. All experiments were performed in triplicate with
freshly prepared antigens, and experiments were repeated at least
twice. For experiments with the R1 repeat-
-galactosidase fusion
proteins, the antibodies were omitted, and the plate was developed with
standard
-galactosidase assay reagents in place of alkaline
phosphate substrate (9).
 |
RESULTS AND DISCUSSION |
Mapping of the P97 MAb F1B6 antigenic and ciliary binding
epitopes.
Studies were performed to map both the MAb F1B6 binding
epitope and the cilium binding site on the gene sequence. Both analyses were begun by Tn1000 insertional mutagenesis of plasmid
pISM2159, which contained the P97 gene sequence, followed by analysis
of the resulting recombinant P97 gene product in E. coli.
Mutagenized pISM2159 plasmids were isolated, and the Tn1000
insertions were mapped by restriction digests. The location of the
Tn1000 insertion was also determined by DNA sequencing using
Tn1000 end-specific primers (Fig.
1). Selected plasmids were transformed
into E. coli ISM612, the transformants were induced, and the
lysates were examined for MAb reactivity and for ciliary binding
activity.

View larger version (20K):
[in this window]
[in a new window]
|
FIG. 1.
Locations of Tn1000 insertions used to
identify the MAb F1B6 binding epitope and the cilium binding site of
P97. Shown is the translated amino acid sequence (accession no.
U50901); amino acid positions are indicated by numbers at the right.
Arrows indicate transposon insertion locations. The transposon insert
number is given above each arrow. Insertion 10 is located upstream
between amino acid positions 143 and 144. The solid underline indicates
R1; the broken underline indicates R2.
|
|
MAb reactivity was determined by immunoblotting as shown in Fig.
2. Immunoblot analysis with lysates from
a series of Tn
1000 insertions in pISM2159 showed that
transposon insertions at or
upstream of
pISM2159::Tn
1000.79 (bp 2476 of P97) failed to
express
MAb F1B6-reactive antigens (Fig.
2). Plasmids with
Tn
1000 inserts
at or downstream of
pISM2159::Tn
1000.133 retained the ability
to produce MAb
F1B6-reactive proteins. Inserts 79 and 133 are
separated by 62 bp,
corresponding to amino acids 830 to 850 in
the protein. This portion of
the protein contains the amino acid
R1 repeat sequence AAKPV(E) (Fig.
1). It was concluded that the
MAb epitope requires at least 2.5 repeating units of the R1 repeat.

View larger version (21K):
[in this window]
[in a new window]
|
FIG. 2.
Mapping the P97 F1B6 MAb binding epitope by
immunoblotting using Tn1000 insertions in pISM2159.
Whole-cell antigens were prepared from recombinant E. coli
as described in Materials and Methods. The proteins were resolved on an
SDS-10% polyacrylamide gel (3 µg per lane), and the resulting blot
was developed with MAb F1B6. Each lane number indicates the number of
the Tn1000 insertion (Fig. 1). The molecular mass given on
the left in kilodaltons was determined from molecular weight markers
(Bio-Rad). P97 does not undergo posttranslational cleavage in E. coli and would normally migrate as a 125-kDa protein, but the
Tn1000 insertion results in truncation of the protein at the
point of insertion.
|
|
To locate the P97 ciliary binding epitope, microtiter plate adherence
assays were performed with
E. coli lysates from a series
of
strains carrying Tn
1000 insertions in pISM2159. Lysates
prepared
from pISM2159::Tn
1000.70 and
pISM2159::Tn
1000.133 failed to bind
to cilia, whereas
lysates prepared from pISM2159::Tn
1000.90 and
those downstream of pISM2159::Tn
1000.90 showed
ciliary binding
activity (Fig.
3). The
amount of binding varied, but this variation
could be explained by the
variation in the amount of truncated
P97 product made in
E. coli as illustrated in Fig.
2. A standard
amount of total lysate
protein was analyzed in both the immunoblot
and cilium binding assays,
because it was not possible to accurately
quantitate the amount of the
truncated P97 protein in each preparation.
The strains with the highest
binding, 160 and 145, had substantially
more P97 protein than those
with less binding, 90, 156, 66, 147,
and 111 (Fig.
3). Strain 133 had
no binding, although sufficient
protein was available for binding (Fig.
2). The two inserts pISM2159::Tn
1000.133
(7th
repeat of R1) and pISM2159::Tn
1000.90 (12th repeat
of R1)
are separated by 75 bp. Thus, our data identify R1 as the
probable
binding domain and show that an active cilium binding site
requires
a minimum of seven repeats of the AAKPV(E) sequence (Fig.
1).

View larger version (34K):
[in this window]
[in a new window]
|
FIG. 3.
Microtiter plate adherence assay analysis of
Tn1000 insertions in P97. Lysates were prepared from ISM612
(pISM2159::Tn1000) strains and tested in the
microtiter plate adherence assay as described in Materials and Methods.
The data are presented as mean optical density (OD) ± standard error
of triplicate wells. Numbers refer to positions of Tn1000
insertions in the P97 DNA sequence and correspond to lane numbers in
Fig. 2. The positive control contains nonmutated pISM2159, and the
negative control is lysate from ISM612 containing vector only.
|
|
Analysis of size variation in the P97 repeat regions by PCR.
Since our data are consistent with the idea that the R1 region of P97
is involved in cilium binding, it was of interest to determine if
cilium binding activities of different M. hyopneumoniae strains which vary in adherence could be correlated with changes in
this region of P97. Also, the presence of both R1 and R2 at the
carboxy-terminal end of P97 suggested that there might be a
relationship between the size of these repeat regions in different strains and the size of the P97 product as has been shown for other
mycoplasmal surface proteins (16). To study these two possibilities, we examined the sizes of the R1 and R2 regions of
M. hyopneumoniae strains with different cilium adherence
activities by PCR analysis using the two primer pairs TH120-TH121 for
amplification of R1 and TH122-TH123 for amplification of R2,
respectively. In addition to the virulent strain 232A, strains 144L
(adherent) and J (nonadherent, avirulent) were sequenced. Also,
single-colony isolates of 232A with different adherence activities were
identified and sequenced. Figure 4 shows
the results of the PCR amplification of R1 and R2 from chromosomal DNA
of M. hyopneumoniae 232A, 144L, and J. M. hyopneumoniae 232A gave rise to a product of the R1 region 57 bp
larger than that of strain 144L, which in turn was 21 bp larger than
that of strain J. In contrast, amplification of R2 from strain J
produced a fragment 24 bp larger than that from strain 144L which was 6 bp larger than that from strain 232A (Fig. 4). There was no size
variation in either repeat region among 232A single-colony isolates
even though adherence activity varied (data not shown). Thus, we were
unable to make a direct correlation between the sizes of the two repeat
regions and either the size of P97 or the binding activity of the
strain in which it was found.

View larger version (47K):
[in this window]
[in a new window]
|
FIG. 4.
Analysis of size variation in the P97 repeat regions by
PCR analysis. The bands represent PCR products produced from template
DNA from different M. hyopneumoniae strains. Lane C, no
template DNA control; lane 1, strain 232A (adherent); lane 2, strain J
(nonadherent); lane 3, strain 144L (adherent). R1 and R2 were amplified
with primer sets TH120-TH121 and TH122-TH123, respectively.
|
|
DNA sequence analysis of the P97 repeat sequence R1 in different
strains.
Zhang et al. (20) had previously shown that
M. hyopneumoniae exhibited variable ciliary binding activity
among different strains. Analysis of the P97 sequence for the cilium
binding epitope by transposon mutagenesis indicated that it was located
within the central portion of the R1 region. One hypothesis for the
loss of cilium binding activity in different M. hyopneumoniae strains is a modification of the R1 region of P97.
None of the strains analyzed above by PCR lacked R1, and all of the
strains seemed to have regions large enough to code for the epitope.
Another possibility for loss of binding is that the repeat sequence has been modified to create a missense or loss-of-function mutation. This
possibility was addressed by sequencing PCR-amplified R1 regions of
different strains, using chromosomal DNAs as templates. Primers TH120
(upper primer for R1) and TH123 (lower primer for R2) were used for
these studies. Following gel purification, sequences of the PCR
products were determined by using primer TH120 and then analyzed. The
R1 sequences exhibited a high degree of sequence homology among the six
strains analyzed, two of which (J and 232 A.L) had low cilium binding
activity (data not shown). All six strains retained the AAKPV(E) R1
repeat sequences. There was no sequence variation in the R1 repeat
between the 232A colony isolates, although their binding activity
varied significantly (data not shown). The R1 regions in strains J and
144L had only 10 and 11 repeats, respectively.
Functional analysis of the R1 region.
Our data indicated that
the R1 region encoded the amino acids forming the cilium binding site.
These studies, however, did not rule out the possibility that other
regions of the protein contributed to the binding in some important
way, i.e., as part of a three-dimensional structure forming a binding
cleft or pocket. To study this in more detail, we sought a way to
isolate the repeat region from other P97 sequences and measure its
ability to bind to swine cilia. This was accomplished by using plasmid
pMLB1107 to construct R1 region-lacZ gene fusions and
inducing expression of the
-galactosidase fusion protein in a
Lac-deficient background. By exposing E. coli lysates to
cilia in a microtiter plate adherence assay followed by an assay for
bound
-galactosidase activity, it was possible to measure the
contribution of R1 independent of other P97 sequences. Using this same
approach, we were also able to determine if the R1 regions were
functional in M. hyopneumoniae strains J (nonadherent) and
144L (adherent).
Figure
5 shows the results of this study.
E. coli lysates were normalized with respect to amount of
total protein (20 µg)
added per well. The total amount of

-galactosidase activity added
to each well was not the same in every
case, but the variation
was less than 20% (data not shown). As
expected, wild-type

-galactosidase
(pMLB1107) failed to bind to
swine cilia. All three of the R1
repeat-

-galactosidase fusions
bound equally to cilia, however,
proving that R1 could function
independently as a cilium binding
domain. In addition, each

-galactosidase fusion protein reacted
with MAb F1B6 by
immunoblotting (data not shown).

View larger version (31K):
[in this window]
[in a new window]
|
FIG. 5.
Cilium binding activity of -galactosidase fusion
proteins containing R1 regions from different M. hyopneumoniae strains. The assay was performed as described
previously (6) except that antibodies were omitted and
o-nitrophenyl galactopyranoside was substituted as the
substrate (9). Twenty micrograms of protein containing 28 U
(pISM1244), 23 U (pISM1257), or 26 U (pISM1258) of -galactosidase
activity from E. coli lysates was added to each well, and
the plates were incubated at 37°C for 90 min to allow binding of the
fusion proteins to cilia. The control with pMLB1107 contained 44 U of
activity. The data represent the mean optical density (OD) and standard
deviation of six independent assays.
|
|
Interestingly, the fusion containing the R1 repeat from strain J also
bound to cilia even though strain J has low binding
activity
(
20). It is still not clear why strain J fails to bind
to
swine cilia since P97 is produced and the repeat region is
fully
competent in binding. DNA sequence analysis of low-, medium-,
and
high-adherence colony isolates of strain 232A gave similar
results;
neither the DNA sequence of the R1 region nor P97 expression
seemed to
vary among the strains in spite of the loss of binding
activity. Our
conclusion is that other proteins or factors independent
of P97
contribute to cilium binding in critical ways. While it
is clear from
our studies that P97 alone is fully competent for
cilium binding, these
factors could participate indirectly in
the intact cell by
participating in the posttranslational modification
of P97, its
translocation across the membrane, or its placement
in the mycoplasma
membrane. The protein is positioned at a distance
from the cell
membrane, connected through an electron-translucent
component
(
20). It is also possible that other elements interact
with
P97 to enhance binding in the intact cell, or they may act
independently through mechanisms not yet identified.
 |
ACKNOWLEDGMENTS |
We thank Richard F. Ross and Theresa Young for the M. hyopneumoniae strains. We also thank Qijing Zhang for work in
isolating and characterizing the high-, medium-, and low-adherence
clonal isolates of 232A. We are indebted to Kendall King for Mhp1 (P97) deletion mutants, which provided preliminary information on the importance of the carboxy terminus of P97 in cilium binding.
 |
FOOTNOTES |
*
Corresponding author. Mailing address: Iowa State
University, Veterinary Medical Research Institute, 1802 Elwood Dr.,
Ames, IA 50011. Phone: (515) 294-6347. Fax: (515) 294-1401. E-mail: fcminion{at}iastate.edu.
Editor:
P. E. Orndorff
 |
REFERENCES |
| 1.
| Berman, M. Unpublished data.
|
| 2.
|
Dallo, S. F.,
C. J. Su,
J. R. Horton, and J. B. Baseman.
1988.
Identification of P1 gene domain containing epitope(s) mediating Mycoplasma pneumoniae cytadherence.
J. Exp. Med.
167:718-723[Abstract/Free Full Text].
|
| 3.
|
Gerstenecker, B., and E. Jacobs.
1990.
Topological mapping of the P1-adhesin of Mycoplasma pneumoniae with adherence-inhibiting monoclonal antibodies.
J. Gen. Microbiol.
136:471-476[Abstract/Free Full Text].
|
| 4.
|
Guyer, M. S.
1983.
Uses of transposon  in the analysis of cloned genes.
Methods Enzymol.
101:362-369[Medline].
|
| 5.
|
Hanahan, D.
1983.
Studies on transformation of Escherichia coli with plasmids.
J. Mol. Biol.
166:557-580[Medline].
|
| 6.
|
Hsu, T.,
S. Artiushin, and F. C. Minion.
1997.
Cloning and analysis of P97, a respiratory cilium adhesin gene of Mycoplasma hyopneumoniae.
J. Bacteriol.
179:1317-1323[Abstract/Free Full Text].
|
| 7.
|
King, K. W.,
D. H. Faulds,
E. L. Rosey, and R. J. Yancey.
1996.
Characterization of the gene encoding Mhp1 from Mycoplasma hyopneumoniae and examination of Mhp1's vaccine potential.
Vaccine
15:25-35.
|
| 8.
|
Mebus, C. A., and N. R. Underdahl.
1977.
Scanning electron microscopy of trachea and bronchi from gnotobiotic pigs inoculated with Mycoplasma hyopneumoniae.
Am. J. Vet. Res.
43:1249-1254.
|
| 9.
|
Miller, J. H.
1972.
Experiments in molecular genetics.
Cold Spring Harbor Laboratory, Cold Spring Harbor, N.Y.
|
| 10.
|
Minion, F. C.,
C. VanDyk, and B. K. Smiley.
1995.
Use of an Escherichia coli enhanced opal suppressor strain to screen a Mycoplasma hyopneumoniae library.
FEMS Microbiol. Lett.
131:81-85[Medline].
|
| 11.
|
Opitz, O., and E. Jacobs.
1992.
Adherence epitopes of Mycoplasma genitalium adhesin.
J. Gen. Microbiol.
138:1785-1790[Abstract/Free Full Text].
|
| 12.
|
Ross, R. F.
1992.
Mycoplasmal disease, p. 537-551.
In
A. D. Leman, B. E. Straw, W. L. Mengeling, S. D'Allaire, and D. J. Taylor (ed.), Diseases of swine. Iowa State University Press, Ames, Iowa.
|
| 13.
|
Smiley, B. K., and F. C. Minion.
1993.
Enhanced readthrough of opal (UGA) codons and production of Mycoplasma pneumoniae P1 epitopes in Escherichia coli.
Gene
134:33-40[Medline].
|
| 14.
|
Strathmann, M.,
B. A. Hamilton,
C. A. Mayeda,
M. I. Simon,
E. M. Meyerowitz, and M. J. Palazzolo.
1991.
Transposon-facilitated DNA sequencing.
Proc. Natl. Acad. Sci. USA
88:1247-1250[Abstract/Free Full Text].
|
| 15.
|
Towbin, H.,
T. Staehelin, and J. Gordon.
1979.
Electrophoretic transfer of proteins from polyacrylamide gels to nitrocellulose sheets: procedure and some applications.
Proc. Natl. Acad. Sci. USA
76:4350-4354[Abstract/Free Full Text].
|
| 16.
|
Wise, K. S.,
D. Yogev, and R. Rosengarten.
1992.
Antigenic variation, p. 473-489.
In
J. Maniloff, R. N. McElhaney, L. R. Finch, and J. B. Baseman (ed.), Mycoplasmas: molecular biology and pathogenesis. American Society for Microbiology, Washington, D.C.
|
| 17.
|
Young, T. F.,
Q. Zhang,
B. Z. Erickson, and R. F. Ross.
1994.
Isolation and characterization of high and low adherent clones of Mycoplasma hyopneumoniae, p. 684-685.
In
Abstracts of the 10th International Congress of the International Organization for Mycoplasmology. International Organization for Mycoplasmology, Bordeaux, France.
|
| 18.
|
Zhang, Q.,
T. F. Young, and R. F. Ross.
1994.
Glycolipid receptors for attachment of Mycoplasma hyopneumoniae to porcine respiratory ciliated cells.
Infect. Immun.
62:4367-4373[Abstract/Free Full Text].
|
| 19.
|
Zhang, Q.,
T. F. Young, and R. F. Ross.
1994.
Microtiter plate adherence assay and receptor analogs for Mycoplasma hyopneumoniae.
Infect. Immun.
62:1616-1622[Abstract/Free Full Text].
|
| 20.
|
Zhang, Q.,
T. F. Young, and R. F. Ross.
1995.
Identification and characterization of a Mycoplasma hyopneumoniae adhesin.
Infect. Immun.
63:1013-1019[Abstract].
|
Infection and Immunity, October 1998, p. 4762-4766, Vol. 66, No. 10
0019-9567/98/$04.00+0
Copyright © 1998, American Society for Microbiology. All rights reserved.
This article has been cited by other articles:
-
Balder, R., Krunkosky, T. M., Nguyen, C. Q., Feezel, L., Lafontaine, E. R.
(2009). Hag Mediates Adherence of Moraxella catarrhalis to Ciliated Human Airway Cells. Infect. Immun.
77: 4597-4608
[Abstract]
[Full Text]
-
Strait, E. L., Madsen, M. L., Minion, F. C., Christopher-Hennings, J., Dammen, M., Jones, K. R., Thacker, E. L.
(2008). Real-Time PCR Assays To Address Genetic Diversity among Strains of Mycoplasma hyopneumoniae. J. Clin. Microbiol.
46: 2491-2498
[Abstract]
[Full Text]
-
Madsen, M. L., Oneal, M. J., Gardner, S. W., Strait, E. L., Nettleton, D., Thacker, E. L., Minion, F. C.
(2007). Array-Based Genomic Comparative Hybridization Analysis of Field Strains of Mycoplasma hyopneumoniae. J. Bacteriol.
189: 7977-7982
[Abstract]
[Full Text]
-
Okamba, F. R., Moreau, E., Cheikh Saad Bouh, K., Gagnon, C. A., Massie, B., Arella, M.
(2007). Immune Responses Induced by Replication-Defective Adenovirus Expressing the C-Terminal Portion of the Mycoplasma hyopneumoniae P97 Adhesin. CVI
14: 767-774
[Abstract]
[Full Text]
-
Chen, A. Y., Fry, S. R., Forbes-Faulkner, J., Daggard, G., Mukkur, T. K. S.
(2006). Evaluation of the immunogenicity of the P97R1 adhesin of Mycoplasma hyopneumoniae as a mucosal vaccine in mice.. J Med Microbiol
55: 923-929
[Abstract]
[Full Text]
-
Madsen, M. L., Nettleton, D., Thacker, E. L., Edwards, R., Minion, F. C.
(2006). Transcriptional Profiling of Mycoplasma hyopneumoniae during Heat Shock Using Microarrays. Infect. Immun.
74: 160-166
[Abstract]
[Full Text]
-
Jenkins, C., Wilton, J. L., Minion, F. C., Falconer, L., Walker, M. J., Djordjevic, S. P.
(2006). Two Domains within the Mycoplasma hyopneumoniae Cilium Adhesin Bind Heparin. Infect. Immun.
74: 481-487
[Abstract]
[Full Text]
-
Adams, C., Pitzer, J., Minion, F. C.
(2005). In Vivo Expression Analysis of the P97 and P102 Paralog Families of Mycoplasma hyopneumoniae. Infect. Immun.
73: 7784-7787
[Abstract]
[Full Text]
-
Minion, F. C., Lefkowitz, E. J., Madsen, M. L., Cleary, B. J., Swartzell, S. M., Mahairas, G. G.
(2004). The Genome Sequence of Mycoplasma hyopneumoniae Strain 232, the Agent of Swine Mycoplasmosis. J. Bacteriol.
186: 7123-7133
[Abstract]
[Full Text]
-
Djordjevic, S. P., Cordwell, S. J., Djordjevic, M. A., Wilton, J., Minion, F. C.
(2004). Proteolytic Processing of the Mycoplasma hyopneumoniae Cilium Adhesin. Infect. Immun.
72: 2791-2802
[Abstract]
[Full Text]
-
Leigh, S. A., Wise, K. S.
(2002). Identification and Functional Mapping of the Mycoplasma fermentans P29 Adhesin. Infect. Immun.
70: 4925-4935
[Abstract]
[Full Text]
-
Kwon, D., Choi, C., Chae, C.
(2002). Chronologic Localization of Mycoplasma hyopneumoniae in Experimentally Infected Pigs. Vet Pathol
39: 584-587
[Abstract]
[Full Text]
-
Park, S.-C., Yibchok-Anun, S., Cheng, H., Young, T. F., Thacker, E. L., Minion, F. C., Ross, R. F., Hsu, W. H.
(2002). Mycoplasma hyopneumoniae Increases Intracellular Calcium Release in Porcine Ciliated Tracheal Cells. Infect. Immun.
70: 2502-2506
[Abstract]
[Full Text]
-
Shen, X., Gumulak, J., Yu, H., French, C. T., Zou, N., Dybvig, K.
(2000). Gene Rearrangements in the vsa Locus of Mycoplasma pulmonis. J. Bacteriol.
182: 2900-2908
[Abstract]
[Full Text]
-
Minion, F. C., Adams, C., Hsu, T.
(2000). R1 Region of P97 Mediates Adherence of Mycoplasma hyopneumoniae to Swine Cilia. Infect. Immun.
68: 3056-3060
[Abstract]
[Full Text]