Previous Article | Next Article 
Infection and Immunity, November 1998, p. 5208-5214, Vol. 66, No. 11
0019-9567/98/$04.00+0
Copyright © 1998, American Society for Microbiology. All rights reserved.
Activation of Natural Killer Cells in Arthritis-Susceptible but
Not Arthritis-Resistant Mouse Strains following Borrelia
burgdorferi Infection
Charles R.
Brown, and
Steven L.
Reiner*
Department of Medicine and Gwen Knapp Center
for Lupus and Immunology Research, Committee on Immunology,
University of Chicago, Chicago, Illinois 60637
Received 4 March 1998/Returned for modification 5 May 1998/Accepted 3 August 1998
 |
ABSTRACT |
Infection of susceptible mouse strains with Borrelia
burgdorferi, the agent of Lyme disease, results in the
development of arthritis. Components of the innate immune
system may be important mediators of this pathology. To investigate the
potential role of NK cells in development of experimental Lyme
arthritis, we examined their activation in vivo in both resistant and
susceptible mouse strains. Following inoculation of B. burgdorferi into the footpad, lymph node NK cells from
susceptible C3H/HeJ (C3H) mice produced more gamma interferon than NK
cells from resistant DBA/2J mice. Lymph node cells from susceptible C3H
and AKR mice also had increased ability to lyse YAC-1 target cells 2 days following infection. Antibody depletion of NK cells from
susceptible mice, however, did not alter the development of arthritis
following B. burgdorferi challenge. In addition, NK cell
depletion had little effect on spirochete burden. Thus, there is a
marked activation of NK cells in susceptible mouse
strains following infection. Although NK cells are not absolutely
required for arthritis, events occurring prior to NK cell activation
might be important in mediating pathology in experimental Lyme disease.
 |
INTRODUCTION |
Lyme disease is caused by infection
with the spirochete Borrelia burgdorferi. In the murine
model of Lyme disease, host genetics play an important role in
determining the extent of arthritic pathology which develops following
infection (10, 56). Challenge of susceptible inbred mouse
strains leads to a transient arthritis which peaks at 2 to 3 weeks and
then resolves over the next few months (11). Resistant mouse
strains develop little pathology and harbor significantly fewer
spirochetes in their tissues following intradermal infection
(61). This may be due to a more effective early immune
response in resistant strains which is capable of limiting bacterial
growth and/or persistence (55). Even following footpad
injection, when resistant animals have high levels of spirochetes in
their ankles, they remain resistant to pathology (16, 32).
This observation suggests that pathogenesis is linked to an
inappropriate or overexuberant immune response in addition to bacterial
load. Mice with the scid mutation are susceptible to
development of arthritis, implying that cells of the innate immune
system play a role in tissue damage (12, 45, 46). Resistance
to arthritis and its resolution, however, appear to require
components of the adaptive immune response, i.e., B (14, 48)
and/or T (26, 34) cells. In experimentally infected hamsters, macrophages appear to play a direct effector role in the
development of B. burgdorferi-induced arthritis
(20). The mechanism(s) of immunopathology in humans and
mice, however, is still incompletely understood.
NK cells are critical components of the innate immune system
(8). In conjunction with macrophages and neutrophils, NK
cells make up the first line of cellular defense against viruses,
fungi, bacteria, and parasites (57). NK cells play a dual
role in early immune responses. They provide direct effector cell
function by killing pathogen-infected cells (8) and also
indirectly influence the development of the inflammatory and adaptive
immune response through the production of gamma interferon (IFN-
)
(51). Both of these roles are important in protection
against a wide variety of infectious agents. NK cells can directly lyse
Cryptococcus neoformans (29, 39) and human
monocytes infected with Mycobacterium tuberculosis
(18). Production of IFN-
by NK cells may also influence
the adaptive immune response because it occurs at a critical time
during development of T helper type 1 (Th1) and Th2 cells
(1, 24, 37). High levels of IFN-
are
capable of suppressing production of interleukin-4 (IL-4) and
promoting a Th1-mediated response (33, 53).
Little is known about the role of NK cells during B. burgdorferi infection. Patients with active Lyme disease have
suppression of NK cell cytotoxic activity, whereas patients with
chronic but nonactive disease show no evidence of NK cell suppression
(18). Bone marrow macrophages from both resistant BALB/c and
susceptible C3H mice produce nitric oxide (NO) in response to borrelial
antigens, and this response can be augmented by the addition of IFN-
(30). Bone marrow macrophages and IL-2-elicited NK cells
from either normal or SCID spleens are able to produce low levels of NO
and IFN-
, respectively, in response to B. burgdorferi antigens when cultured individually but much higher
levels when cultured together (31). These results suggest
that innate immunity may play an early, critical role after infection
with B. burgdorferi. A recent report demonstrated that
genetically resistant C57BL/6 (B6) mice depleted of NK cells did not
develop arthritis following B. burgdorferi infection,
suggesting that NK cells were not required for disease resistance
(13). The role of NK cells in mediating Lyme arthritis development or pathology in susceptible animals, however, has not been
clearly defined.
To further investigate the role of NK cells during infection with
B. burgdorferi, we studied the responses of resistant
and susceptible mouse strains in vitro and in vivo. Following
challenge, susceptible mouse strains had early activation of NK cells,
as assessed by both cytolytic activity and IFN-
production, whereas resistant mouse strains showed little NK cell activation. Antibody depletion studies, however, indicated that activation of NK cells and
early production of IFN-
were not absolutely required for development of Lyme arthritis. In addition, depletion of NK cells had
no effect on dissemination patterns or spirochetal loads in tissues.
Therefore, the differential activation of NK cells does not cause but
may be a response to the initial events underlying the genetic
control of arthritis development.
 |
MATERIALS AND METHODS |
Mice.
All mice were females between 4 and 6 weeks of age.
C3H/HeJ (C3H), DBA/2J (DBA), B6, BALB/c, AKR, and B6C3F1 mice were
purchased from The Jackson Laboratory (Bar Harbor, Maine). Mice
congenic for the NK1.1 locus (C3H.NK mice) were bred in our facility by crossing B6C3F1 to C3H mice and screening progeny for the expression of
NK1.1. NK1.1+ mice were further bred to C3H for four
generations and then intercrossed to produce the homozygous C3H.NK mice
used in these experiments.
Bacteria and infections.
B. burgdorferi N40 was
kindly provided by Steven Barthold (Yale University, New Haven, Conn.).
Spirochetes were reisolated from SCID mice, passaged twice in
Barbour-Stoenner-Kelly II (BSK) medium (Sigma Chemical Co., St. Louis,
Mo.), and frozen in aliquots at
80°C. For infections, an aliquot
was thawed, placed in 7 ml of medium, and grown for 5 days at 32°C.
Mice were inoculated in both hind footpads with 5 × 105 B. burgdorferi in 50 µl of BSK
medium. Tibiotarsal joints were measured weekly, using a metric caliper
(Ralmike's Tool-A-Rama, South Plainfield, N.J.), through the thickest
anteroposterior diameter of the ankle. Mice were sacrificed on
designated days following infection. In some experiments, ankles,
hearts, and skin (ear punches) were frozen for PCR analysis. Blood,
heart, spleen, urinary bladder, skin, and ankles were aseptically
collected and cultured at 32°C for 14 days in BSK medium. Cultures
were read by placing 10 µl of supernatant on a microscope slide under a 22- by 22-mm coverslip and examining 20 high-power fields by dark-field microscopy.
In all experiments, one ankle from each mouse was formalin fixed,
embedded in paraffin, stained with hematoxylin and eosin, and blindly
evaluated for arthritis severity on a scale of 0 to 3 (12).
Grade 0 represents no inflammation, grades 1 and 2 represent mild to
moderate inflammation, and grade 3 represents severe inflammation.
Assay for IFN-
production.
Popliteal lymph node cells
were removed from control or infected animals and assayed as pooled
groups of two or more animals; 3 × 105 to 5 × 105 cells were cultured in Iscove's medium containing 10%
fetal calf serum and antibiotics, with or without B. burgdorferi sonicate antigen (Bb Ag). All cultures were treated
with 10 µg of polymyxin B per ml. Supernatants were harvested 24 h later and assayed for IFN-
by using monoclonal antibody
(MAb) pairs (PharMingen, San Diego, Calif.) in a standard
sandwich enzyme-linked immunosorbent assay (ELISA) according to the
manufacturer's instructions.
NK cell cytotoxicity assay.
YAC-1 lymphoma target cells were
incubated for 1 h with 500 µCi of
Na51CrO4 (Amersham, Arlington Heights, Ill.)
and then washed three times in Hanks balanced salt solution. Effector
cells were obtained from pooled popliteal lymph nodes from naive mice
or mice infected 2 days earlier with B. burgdorferi.
Spleen cells were removed from mice treated with 100 µg of poly(I-C)
(Sigma); 104 target cells were cultured with effectors at
effector/target cell (E:T) ratios of 100:1, 50:1, 25:1, and 12.5:1 in a
total volume of 200 µl. Plates were incubated for 4 h at 37°C
in a CO2 chamber. Chromium release into supernatants was
measured in Luma plates (Packard Instrument Co., Meridian, Conn.) with
a Packard beta counter. Specific 51Cr release was
determined as [(experimental release
spontaneous release)/(maximal release
spontaneous release)] × 100. Maximum release and spontaneous release were determined from wells
containing 100 µl of 2% Triton X-100 (Sigma) and medium alone,
respectively, in the place of effector cells.
Depletion of NK cells in vivo.
Mice were injected
intravenously with 1.85 mg of anti-asialo-GM1 antibody (Waco Chemicals
USA, Inc., Richmond, Va.) or 1.85 mg of heat-inactivated normal rabbit
serum (Accurate Chemical Co., Westbury, N.Y.) or intraperitoneally with
0.2 mg of anti-NK1.1 (PK136; a generous gift from B. Daniels, VA
Medical Center, San Francisco, Calif.) or control rat immunoglobulin G
(IgG) (Sigma) on days
7,
3, or 0 of B. burgdorferi
infection and weekly thereafter. The success of NK cell depletion in
vivo was assessed by subjecting spleen cells to flow cytometry and
fluorescence-activated cell sorting (FACS) analysis using
phycoerythrin-conjugated anti-NK1.1 and fluorescein
isothiocyanate-conjugated anti-CD3 (PharMingen) or for production of
IFN-
in response to Bb Ag. NK cells were routinely depleted to less
than 1%.
PCR analysis.
To extract DNA from heart or skin, samples
were placed in 0.5 ml of sodium dodecyl sulfate (SDS)-Tris lysis buffer
(0.1 mg of proteinase K per ml in 200 mM NaCl-20 mM Tris-HCl [pH
8.0]-50 mM EDTA-0.2% SDS) and incubated overnight at 55°C.
Following incubation, debris was pelleted and the supernatants were
transferred to tubes containing 0.8 ml of isopropanol. Sample DNA was
precipitated on ice for 60 min. DNA was pelleted at 4°C, air dried,
and resuspended in 200 µl of Tris-EDTA buffer. To extract DNA from
ankles, samples were first incubated in 0.5 ml of 1% collagenase for
6 h at 37°C; 0.25 ml of 3× SDS-Tris lysis buffer was added, and
samples were incubated at 55°C overnight. DNA was then precipitated
as described above. PCR amplification was performed with 10 µl of DNA
diluted 1:100 (hearts and ankles) or 1:10 (ear punches) in Tris-EDTA
buffer. DNA from uninfected mice served as negative controls. The
presence of B. burgdorferi ospA in sample DNA was
detected with 5' primer TCTTGAAGGAACTTTAACTGCTG and 3'
primer CAAGTTTTGTAATTTCAACTGCTGA. PCRs were performed as
follows: denaturation for 60 s at 94°C, followed by 35 cycles of
denaturation at 94°C for 60 s, annealing at 60°C for 60 s, and extension at 72°C for 90 s. Amplified products were
visualized on a 2.5% agarose gel.
Statistics.
Data were analyzed by the Student t
test for single comparisons or Tukey test for multiple comparisons.
Critical values for statistical significance were set at
= 0.05.
 |
RESULTS |
Kinetics of NK cell activation in vivo.
NK cells from
arthritis-resistant and -susceptible mouse strains become activated in
vitro to produce IFN-
in response to whole borrelial antigen or
purified OspA or OspB (31). To determine if there were
differences in activation of NK cells in vivo, we infected resistant
and susceptible mice in the hind footpads with B. burgdorferi. Footpad injections were used to provide a site of
early, localized focus of the immune response which does not occur
following intradermal injection. Injection of media alone into the
footpads does not cause histopathological changes in the ankles of mice
(15a). Some mouse strains, such as BALB/c, considered
resistant by the intradermal route will be intermediate or susceptible
when the footpad route of inoculation is used (15a, 25). Consequently, footpad injection was used throughout
this study for consistency and to avoid differences in immune responses when various routes of infection were used. FACS analysis revealed similar numbers of NK cells in popliteal lymph nodes of naive arthritis-resistant B6 and -susceptible B6C3F1 mice. By day 1 of
infection, the numbers of NK cells were increased 1.9- and 2.3-fold,
respectively. To determine if this NK cell expansion also resulted
in NK cell activation, we infected DBA and C3H mice and studied their
NK cells over time. On days 1, 2, and 4 following infection, draining
popliteal lymph nodes were removed and the cells were restimulated in
vitro with Bb Ag. Supernatants were collected 24 h later, and
production of IFN-
was measured by ELISA. Lymph node cells from
resistant DBA mice produced little IFN-
during the first 4 days
following B. burgdorferi infection. In contrast,
lymph node cells from susceptible C3H mice had a rapid response,
producing significantly higher levels of IFN-
on day 1 following
infection (Fig. 1A; P < 0.01). Similar levels of IFN-
were produced by C3H SCID mice
(data not shown). The production of IFN-
by C3H mice declined
by day 2 but was still higher than in DBA mice, where it peaked at day
2. By day 4 of infection, the production of IFN-
by DBA lymph node
cells had returned to baseline levels whereas levels in C3H lymph node
cells were still slightly elevated. These results demonstrate more
rapid and greater production of IFN-
in the draining lymph nodes of susceptible mice than in those of resistant mice. Although this IFN-
production was elicited with borrelial extracts, it
is unlikely that it was derived from B. burgdorferi-reactive T cells at such an early time point
(49). To determine if this increased IFN-
was produced by
NK cells, C3H mice were treated with anti-asialo-GM1 antiserum or control serum and then infected with B. burgdorferi. On day 1 postinfection, draining lymph nodes were
tested for the production of IFN-
. Treatment of mice with
anti-asialo-GM1 antiserum completely abolished the production of
IFN-
in response to Bb Ag (Fig. 1B). This result implicates NK cells
as the most likely source of IFN-
in the earliest phase of
infection.

View larger version (16K):
[in this window]
[in a new window]
|
FIG. 1.
(A) Kinetics of NK cell activation during early
B. burgdorferi infection. Draining popliteal lymph node
cells were harvested from C3H and DBA mice infected with B. burgdorferi 1, 2, or 4 days earlier. (B) Depletion of C3H NK cells
by anti-asialo-GM1 antibody treatment abolishes production of IFN-
on day 1 of infection. Results are shown for two control and two
anti-asialo-GM1-treated animals. Cultures were assayed in triplicate.
Levels of IFN- were measured in 24-h supernatants by ELISA as
described in Materials and Methods. Sensitivity of the ELISA was 4 U/ml. Results are representative of one of three separate
experiments.
|
|
NK cell cytotoxicity in resistant and susceptible mouse
strains.
To further assess the activation of NK cells during
B. burgdorferi infection, we tested the ability of
draining lymph node cells to lyse the YAC-1 tumor cell line. Popliteal
lymph nodes were harvested from mice 2 days after infection and tested
for lytic capability in a 4-h chromium release assay. Of the three strains tested (Fig. 2A), only cells from
infected C3H mice were able to significantly lyse the YAC-1 target
cells at an E:T ratio of 100:1 (P < 0.05). Cells from
infected resistant BALB/c and B6 mice had minimal lytic capability. To
further investigate the correlation between NK cell activation and
arthritis resistance or susceptibility, we tested NK cells from
resistant DBA and susceptible AKR (47) animals for the
ability to lyse YAC-1 cells. Susceptible C3H and AKR mice had
significant NK cell cytotoxic activity following infection, while
resistant DBA mice did not (Fig. 2B; E:T ratio of 100:1,
P < 0.05). The levels of cytotoxicity of NK cells
cells from susceptible animals, while low, were reproducible in three separate experiments and most likely reflect the low numbers of NK
cells present in the lymph nodes. Others have reported similar low but
significant levels of killing by NK cells in other systems (5, 38,
40, 41, 49, 50, 59). Poly(I-C) treatment led to low but
significant YAC-1 lysis (49) from all strains tested (Fig.
2C; P < 0.05) and indicated that the failure of
resistant strains to lyse YAC-1 cells was not due to a global defect in their ability to activate NK cells. NK cells from susceptible mouse
strains were not preactivated for lysis since cells from uninfected
mice had no lytic activity in these assays (Fig. 2D).

View larger version (26K):
[in this window]
[in a new window]
|
FIG. 2.
NK cell cytotoxicity in resistant and susceptible mouse
strains. Popliteal lymph nodes were pooled from six animals per group
from 2-day-infected (A and B) and uninfected (D) mouse strains.
Splenocytes from poly(I-C) treated mice were used as positive controls
(C). Effector cells were assayed for cytolytic activity against YAC-1
target cells in a 4-h Cr release assay. Similar results were obtained
in three other experiments. Values are means of triplicate wells, and
standard deviation were less than 10% in all samples.
|
|
NK cell depletion studies.
To determine if NK cells were
absolutely required for arthritis development in susceptible
mice, we depleted infected animals of NK cells. We bred C3H.NK
mice or tested arthritis-susceptible B6C3F1 mice in order to use an
anti-NK1.1 MAb (PK136) for NK cell depletion (21). NK1.1 is
expressed on all NK cells in the mouse (62). MAb antibody
staining and flow cytometry were performed weekly to ensure that
NK1.1-bearing cells were depleted for the entire experimental period.
FACS analysis of splenocytes showed 2 to 3% NK cells in control mice
but a reduction of NK cells in antibody-treated mice to less than 1%
for the duration of infection. We also stimulated splenocytes with
IL-12 and Bb Ag and measured production of IFN-
after 24 h.
IFN-
production by spleen cells from anti-NK1.1-treated mice was
below the limit of detection, while those from IgG-treated control mice
produced 19.2 U of IFN-
per ml, further confirming the efficiency of
antibody depletion. This observation is consistent with published
studies examining lytic function after a similar protocol of antibody
depletion (52). Figure 3 shows
that infection of C3H.NK mice resulted in arthritis development even
though the NK1.1 locus originated from a genetically resistant B6
mouse. Depletion of NK cells in C3H.NK mice by using anti-NK1.1
antibody had little effect on arthritis development. Beginning 1 week
postinfection, ankles of control and anti-NK1.1-treated mice were
significantly larger than control DBA ankles (P < 0.001). Similar results were obtained when anti-asialo-GM1 antibody was
used to deplete NK cells in C3H mice (data not shown). Thus, using two
independent systems of NK cell depletion, we detected no difference in
the development of arthritis between control and NK cell-depleted mice.
We also found no difference in arthritis development between infected C3H and C3H beige mice (data not shown), confirming the
previous work of Barthold and de Souza (13).
Spirochete DNA was detected in all tissues examined at day 28 of infection between DBA, C3H.NK, and NK cell-depleted
C3H.NK mice as determined by PCR (Table
1). Analysis of histological sections of
ankles stained with hematoxylin and eosin revealed no differences
between NK cell-depleted and control animals (data not shown).
Arthritis severity scores were significantly higher in the susceptible
C3H.NK mice than in the resistant DBA mice (Table 1), but there was no
difference between the anti-NK1.1-treated and untreated C3H.NK congenic
mice. To determine if NK cells might play a role in limiting
spirochetal load or dissemination in tissues, B6C3F1 mice were
sacrificed on days 5, 10, 15, 20, and 25 postinfection, a time period
that spans the peak of arthritis development (14 to 21 days) and
spirochete dissemination. The time course of arthritis development
after NK cell depletion was unaffected, with little difference in
arthritis severity scores at each time point tested (Table
2). Blood, heart, spleen, bladder, skin
(ear punches), and ankles were aseptically removed and cultured for 14 days. Spirochete dissemination patterns, as measured by positive
cultures, were similar between NK cell-depleted and control mice.

View larger version (16K):
[in this window]
[in a new window]
|
FIG. 3.
Depletion of NK cells in C3H.NK congenic mice does not
attenuate development of Lyme arthritis. Groups of C3H.NK (squares) and
DBA (circles) mice were treated with phosphate-buffered saline (open
symbols) or anti-NK1.1 MAb (closed symbols) and infected with
B. burgdorferi as described in Materials and Methods.
Ankle diameters were recorded weekly, with measurements pooled
from three mice per group. Results are representative of three separate
experiments.
|
|
View this table:
[in this window]
[in a new window]
|
TABLE 1.
PCR detection of the presence of B. burgdorferi DNA in selected tissues and arthritis development in
ankles of control (IgG-treated) and anti-NK1.1
MAb-treated micea
|
|
View this table:
[in this window]
[in a new window]
|
TABLE 2.
Isolation of B. burgdorferi from selected
tissues and arthritis development in ankles of control and
anti-NK1.1 MAb-treated B6C3F1 micea
|
|
 |
DISCUSSION |
We have demonstrated that infection of mice with B. burgdorferi leads to greater activation of NK cells in susceptible
strains than in resistant strains. This activation is characterized by both enhanced cytotoxicity against tumor cell targets and
increased production of IFN-
. Increased NK cell activity,
however, is not absolutely required for the development of Lyme
arthritis since depletion of NK cells in susceptible C3H.NK mice
did not alter development of pathology. NK cell activation is also not
required for limiting spirochete persistence or dissemination in
susceptible animals. Arthritis severity scores and levels of spirochete
loads in various tissues, as assessed by PCR or culture, were similar in NK cell-depleted and control mice.
The in vivo contribution of NK cells to the development of experimental
Lyme arthritis has been reported in one other study to date. Barthold
and de Souza studied the development of arthritis in C3H and B6 mice
with the beige mutation (13). beige
mice and patients with Chediak-Higashi syndrome have defective
vesicular transport to and from the lysosome and late endosome
(9). There is dysregulated fusion of intracellular vesicles
and compartmental missorting of proteins (17, 23). This
results in defective granulocytes, cytotoxic T cells, and NK cells that
are not cytolytic but are capable of IFN-
production
(44). B6 mice are normally resistant to Lyme pathology;
however, B6 beige mice developed severe arthritis similar to
that of C3H control animals (13). These results indicated
that the NK cell or granulocytic function perturbed in beige
mice contributes to resistance to arthritis development. Few
differences in immune responses were detected between control and
beige mutant C3H mice, although the authors speculated this
was because C3H mice already had severe arthritis which could not be
exacerbated. Depletion of NK cells, granulocytes, or macrophages in
vivo in this study failed to identify the cell type responsible for
resistance to arthritis in B6 animals. Granulocyte depletion, which had
the greatest effect, increased the incidence but not the severity of
arthritis development in these mice. The authors concluded that NK
cells had no role in resistance to Lyme arthritis in resistant
mice. The present study lends support to this conclusion by showing
very little activation of NK cells in resistant animals.
Production of IFN-
by NK cells is important in many infectious
disease models (7). Much of our understanding of the role of
NK cells in innate immunity has come from the study of infections of
mice with Listeria monocytogenes (58).
Listeria-infected macrophages release tumor necrosis
factor alpha (TNF-
) and IL-12, which activate NK cells to
secrete IFN-
in an antigen-independent manner. The IFN-
activates macrophages to produce NO and become bactericidal
(6). This cytokine-inducible pathway of macrophage activation is not unique to Listeria but operates during
infections with other viral (15), bacterial (4,
40), and protozoan (22, 49) pathogens and has recently
been shown to occur in response to bacterial DNA (5). This
same cytokine-inducible pathway is activated following stimulation of
C3H or BALB/c spleen cells in vitro with Bb Ag or with OspA or OspB
(31). Thus, in the present study, the early activation and
production of IFN-
by NK cells in the susceptible C3H mice could
cause the activation of macrophages and release of NO. Production of NO
is detrimental in other models of arthritis (36), and its
inhibition by NG-monomethyl-L-arginine (NMMA)
decreases development of arthritis (35, 60). In contrast,
treatment of B. burgdorferi-infected mice with NMMA had
no effect on development of arthritis or on bacterial burdens in either
resistant or susceptible mouse strains (54).
NK cell-mediated production of IFN-
could also contribute to
pathology by influencing the development of Th cell subsets. Resistance
or susceptibility to Lyme arthritis correlates with the development of
a Th2 or Th1 phenotype, respectively (27, 34). T cells can
be activated in vitro by either whole Bb Ag or OspA (28).
Further evidence for the participation of T cells in the pathogenesis
of Lyme disease comes from the association of chronic Lyme disease with
HLA-DR4 (56) or of chronic inflammation in joints and hearts
of certain H-2 haplotypes of inbred mouse strains
(47). T cells from vaccinated inbred hamsters were capable of conferring the ability to develop severe destructive arthritis in
naive recipients upon challenge with nonpathogenic levels of B. burgdorferi (30). In contrast, a Th2
clone was able to confer protection to naive mice against challenge
with B. burgdorferi (43). Cytokine
production by Th cells may be of importance in mediating pathology.
Treatment of arthritis-resistant mice with anti-IL-4 antibody increased
disease severity, while treatment of susceptible mice with
anti-IFN-
antibody attenuated arthritis development (27,
34). Thus, the early activation of NK cells in susceptible
mice could favor development of a Th1 phenotype and result in an
enhanced inflammatory response and disease. In contrast, studies with
immunodeficient mice suggest that T-cell responses do not determine
disease outcome (12). In the present study, the in vivo
depletion of NK cells resulted in the loss of early IFN-
production.
After footpad inoculation of C3H and BALB/c mice with B. burgdorferi, both strains develop a complex pattern of early
cytokine production (25). This finding suggests that the
regulation of inflammation is more complex than the simple balance
between IL-4 and IFN-
levels. Indeed, treatment of C3H/HeN mice with
antibody to IL-12 also resulted in a decrease in IFN-
production and
Th1 responses (2). Anti-IL-12 treatment, however, in
contrast to the results of the present study, produced a reduction in
peak arthritis severity and an increase in the number of spirochetes in
ear tissue. Thus, the overall levels of IFN-
may not be the most
critical factor in determining resistance or susceptibility to Lyme
borreliosis.
Our inability to alter the development of arthritis in susceptible mice
through the depletion of NK cells has several possible explanations.
First, the ligand for the antibody treatments used, anti-NK1.1, is not
expressed exclusively on NK cells and thus may have unexpected effects
(21). It is also possible that due to the redundancy found
in the immune system, the critical role played by early NK cell
production of IFN-
in inducing arthritis development might be
circumvented in NK cell-deficient mice. Indeed, Orange and Biron
(41) recently demonstrated that in murine
cytomegalovirus-infected mice, IFN-
, TNF, and IL-12 could all be
produced in an NK- and T cell-independent fashion. Also, each of these
cytokines had antiviral activities which were independent of NK or
T-cell activity. It was recently shown that ablation of IL-12
exacerbated Lyme arthritis development in SCID mice (3), in
contrast to a reduction in arthritis severity following IL-12 depletion
in normal mice (2). These studies suggest that
downregulation of innate immune responses, at least in some cases, can
be compensated for through the activity of T and/or B cells. Thus, in
the present study, spirochetal products could activate macrophages in
NK-deficient mice to produce high levels of IL-12 and drive the
development of Th1 cells. Susceptible mouse strains favor a Th1
phenotype (27, 34). Production of IFN-
from these T cells
could replace that lost from NK cell depletion and drive the further
activation of macrophages, effectively bypassing the need for NK cell
activation. Since T-cell activation precedes spirochetal
dissemination and arthritis development, these processes could proceed
normally even though an integral component of the inflammatory
pathway, NK cells, was missing. This scenario, however, places the
critical events responsible for the genetic differences between
resistant and susceptible mouse strains earlier in the inflammatory
pathway. It is possible that differential activation of macrophages or granulocytes by borrelial antigens or even differences in their recruitment into the sites of infection underlies resistance or susceptibility to pathology. Studies are under way to explore these
possibilities.
 |
ACKNOWLEDGMENTS |
This work was supported by NIH grant AR 44042 and by the
Burroughs Wellcome Fund.
We thank Dan Brown, Kevin Swier, and Helena Shiels for critical reading
of the manuscript and Jennifer Bird for excellent technical assistance.
 |
FOOTNOTES |
*
Corresponding author. Mailing address: Gwen Knapp
Center for Lupus and Immunology Research, University of Chicago, 924 E. 57th St., Chicago, IL 60637. Phone: (773) 702-4730. Fax: (773) 702-1576. E-mail: sreiner{at}midway.uchicago.edu.
Editor:
J. M. Mansfield
 |
REFERENCES |
| 1.
|
Afonso, L. C. C.,
T. M. Scharton,
L. Q. Vieira,
M. Wysucka,
G. Trinchieri, and P. Scott.
1994.
The adjuvant effect of interleukin-12 in a vaccine against Leishmania major.
Science
263:235-237[Abstract/Free Full Text].
|
| 2.
|
Anguita, J.,
D. H. Persing,
M. Rincon,
S. W. Barthold, and E. Fikrig.
1996.
Effect of anti-interleukin-12 treatment on murine Lyme borreliosis.
J. Clin. Investig.
97:1028-1034[Medline].
|
| 3.
|
Anguita, J.,
S. Samanta,
S. W. Barthold, and E. Fikrig.
1997.
Ablation of interleukin-12 exacerbates Lyme arthritis in SCID mice.
Infect. Immun.
65:4334-4336[Abstract].
|
| 4.
|
Appelberg, R.,
A. G. Castro,
J. Pedrosa,
R. A. Silva,
I. M. Orme, and P. Minoprio.
1994.
Role of gamma interferon and tumor necrosis factor alpha during T-cell-independent and T-cell-dependent phases of Mycobacterium avium infection.
Infect. Immun.
62:3962-3971[Abstract/Free Full Text].
|
| 5.
|
Ballas, Z. K.,
W. L. Rasmussen, and A. M. Krieg.
1996.
Induction of NK activity in murine and human cells by CpG motifs in oligodeoxynucleotides and bacterial DNA.
J. Immunol.
157:1840-1845[Abstract].
|
| 6.
|
Bancroft, G. J.,
K. C. F. Sheehan,
R. D. Schreiber, and E. R. Unanue.
1989.
Tumor necrosis factor is involved in the T cell-independent pathway of macrophage activation in scid mice.
J. Immunol.
143:127-130[Abstract].
|
| 7.
|
Bancroft, G. J.,
R. D. Schreiber, and E. R. Unanue.
1991.
Natural immunity: a T-cell-independent pathway of macrophage activation, defined in the scid mouse.
Immunol. Rev.
124:5-24[Medline].
|
| 8.
|
Bancroft, G. J.
1993.
The role of natural killer cells in innate resistance to infection.
Curr. Opin. Immunol.
5:503-510[Medline].
|
| 9.
|
Barbosa, M. D. F. S.,
Q. A. Nguyen,
V. T. Tchernev,
J. A. Ashley,
J. C. Detter,
S. M. Blaydes,
S. J. Brandt,
D. Chotai,
C. Hodgman,
R. C. E. Solari,
M. Lovett, and S. F. Kingsmore.
1996.
Identification of the homologous beige and Chediak-Higashi syndrome genes.
Nature
382:262-265[Medline].
|
| 10.
|
Barthold, S. W.,
D. S. Beck,
G. M. Hansen,
G. A. Terwilliger, and K. O. Moody.
1990.
Lyme borreliosis in selected strains and ages of laboratory mice.
J. Infect. Dis.
162:133-138[Medline].
|
| 11.
|
Barthold, S. W.,
D. H. Persing,
A. L. Armstrong, and R. A. Peeples.
1991.
Kinetics of Borrelia burgdorferi dissemination and evolution of disease after intradermal inoculation of mice.
Am. J. Pathol.
139:263-273[Abstract].
|
| 12.
|
Barthold, S. W.,
C. L. Sidman, and A. L. Smith.
1992.
Lyme borreliosis in genetically resistant and susceptible mice with severe combined immunodeficiency.
Am. J. Trop. Med. Hyg.
47:605-613.
|
| 13.
|
Barthold, S. W., and M. de Souza.
1995.
Exacerbation of Lyme arthritis in beige mice.
J. Infect. Dis.
172:778-784[Medline].
|
| 14.
|
Barthold, S. W.,
S. Feng,
L. K. Bockenstedt,
E. Fikrig, and K. Feen.
1997.
Protective and arthritis-resolving activity in serum of mice actively infected with Borrelia burgdorferi.
Clin. Infect. Dis.
25:S9-S17.
|
| 15.
|
Biron, C. A.
1994.
Cytokines in the generation of immune responses to, and resolution of, virus infection.
Curr. Opin. Immunol.
6:530-538[Medline].
|
| 15a.
| Brown, C. Unpublished data.
|
| 16.
| Brown, C. R., and S. L. Reiner. Clearance
of Borrelia burgdorferi may not be required for resistance
to experimental Lyme arthritis. Infect. Immun.
66:2065-2071.
|
| 17.
|
Burkhardt, J. K.,
F. A. Wiebel,
S. Hester, and Y. Argon.
1993.
The giant organelles in beige and Chediak-Higashi fibroblasts are derived from late endosomes and mature lysosomes.
J. Exp. Med.
176:1845-1856.
|
| 18.
|
Dattwyler, R. J.,
J. A. Thomas,
J. L. Benach, and M. G. Golightly.
1986.
Cellular immune response in Lyme disease: the response to mitogens, live Borrelia burgdorferi, NK cell function and lymphocyte subsets.
Zentralbl. Bakteriol. Hyg. A
263:151-159.
|
| 19.
|
Denis, M.
1994.
Interleukin-12 (IL-12) augments cytolytic activity of natural killer cells toward Mycobacterium tuberculosis-infected human monocytes.
Cell. Immunol.
156:529-536[Medline].
|
| 20.
|
Du Chateau, B. K.,
D. M. England,
S. M. Callister,
L. C. Lim,
S. D. Lovrich, and R. F. Schell.
1996.
Macrophages exposed to Borrelia burgdorferi induce Lyme arthritis in hamsters.
Infect. Immun.
64:2540-2547[Abstract].
|
| 21.
|
Ehl, S.,
R. Nuesch,
T. Tanaka,
M. Myasaka,
H. Hengartner, and R. Zinkernagel.
1996.
A comparison of efficacy and specificity of three NK depleting antibodies.
J. Immunol. Methods
199:149-153[Medline].
|
| 22.
|
Gazzinelli, R. T.,
S. Hieny,
T. Wynn,
S. Wolf, and A. Sher.
1993.
IL-12 is required for the T-cell independent induction of IFN- by an intracellular parasite and induces resistance in T-cell-deficient hosts.
Proc. Natl. Acad. Sci. USA
90:6115-6119[Abstract/Free Full Text].
|
| 23.
|
Holcombe, R. F.,
K. L. Jones, and R. M. Stewart.
1994.
Lysosomal enzyme activities in Chediak-Higashi syndrome: evaluation of lymphoblastoid cell lines and review of the literature.
Immunodeficiency
5:131-140[Medline].
|
| 24.
|
Hsieh, C.,
S. E. Macatonia,
C. S. Tripp,
S. F. Wolf,
A. O'Garra, and K. M. Murphy.
1993.
Listeria-induced Th1 development in  -TCR transgenic CD4+ T cells occurs through macrophage production of IL-12.
Science
260:547-549[Abstract/Free Full Text].
|
| 25.
|
Kang, I.,
S. W. Barthold,
D. H. Persing, and L. K. Bockenstedt.
1997.
T-helper-cell cytokines in the early evolution of murine Lyme arthritis.
Infect. Immun.
65:3107-3111[Abstract].
|
| 26.
|
Keane-Myers, A., and S. P. Nickell.
1995.
T cell subset-dependent modulation of immunity to Borrelia burgdorferi in mice.
J. Immunol.
154:1770-1776[Abstract].
|
| 27.
|
Keane-Myers, A., and S. P. Nickell.
1995.
Role of IL-4 and IFN- in modulation of immunity to Borrelia burgdorferi in mice.
J. Immunol.
155:2020-2028[Abstract].
|
| 28.
|
Lahesmaa, R.,
M.-C. Shannafelt,
A. Allsup,
C. Soderberg,
J. Anzola,
V. Freitas,
C. Turek,
L. Steinman, and G. Peltz.
1993.
Preferential usage of T cell antigen receptor V region gene segment V 5.1 by Borrelia burgdorferi antigen-reactive T cell clones isolated from a patient with Lyme disease.
J. Immunol.
150:4125-4135[Abstract].
|
| 29.
|
Levitz, S. M.,
M. P. Dupont, and E. H. Smail.
1994.
Direct activity of human T lymphocytes and natural killer cells against Cryptococcus neoformans.
Infect. Immun.
62:194-202[Abstract/Free Full Text].
|
| 30.
|
Lim, L. C. L.,
D. M. England,
B. K. Chateau,
N. G. Glowacki, and R. F. Schell.
1995.
Borrelia burgdorferi-specific T lymphocytes induce severe destructive Lyme arthritis.
Infect. Immun.
63:1400-1408[Abstract].
|
| 31.
|
Ma, Y.,
K. P. Seiler,
K. F. Tai,
L. Yang,
M. Woods, and J. J. Weis.
1994.
Outer surface lipoproteins of Borrelia burgdorferi stimulate nitric oxide production by the cytokine-inducible pathway.
Infect. Immun.
62:3663-3671[Abstract/Free Full Text].
|
| 32.
|
Ma, Y.,
K. P. Seiler,
E. J. Eichwald,
J. H. Weis,
C. Teuscher, and J. J. Weis.
1998.
Distinct characteristics of resistance to Borrelia burgdorferi-induced arthritis in C57BL/6N mice.
Infect. Immun.
66:161-168[Abstract/Free Full Text].
|
| 33.
|
Manetti, R.,
P. Parronchi,
M. G. Giudizi,
M.-P. Piccinni,
E. Maggi,
G. Trinchieri, and S. Romagnani.
1993.
Natural killer cell stimulatory factor (NKSF/IL-12) induces Th1-type specific immune responses and inhibits the development of IL-4 producing Th cells.
J. Exp. Med.
177:1199-1204[Abstract/Free Full Text].
|
| 34.
|
Matyniak, J., and S. L. Reiner.
1995.
T helper phenotype and genetic susceptibility in experimental Lyme disease.
J. Exp. Med.
181:1251-1254[Abstract/Free Full Text].
|
| 35.
|
McCartney-Francis, N.,
J. B. Allen,
D. E. Mizel,
Q.-W. Xie,
C. F. Nathan, and S. M. Wahl.
1993.
Suppression of arthritis by an inhibitor of nitric oxide synthase.
J. Exp. Med.
178:749-754[Abstract/Free Full Text].
|
| 36.
|
McInnes, I. B.,
B. P. Leung,
M. Field,
X. Q. Wei,
F.-P. Huang,
R. D. Sturrock,
A. Kinninmonth,
J. Weidner,
R. Mumford, and F. Y. Liew.
1996.
Production of nitric oxide in the synovial membrane of rheumatoid and osteoarthritis patients.
J. Exp. Med.
184:1519-1524[Abstract/Free Full Text].
|
| 37.
|
McKnight, A. J.,
G. J. Zimmer,
I. Fogelman,
S. F. Wolf, and A. K. Abbas.
1994.
Effects of IL-12 on helper T cell-dependent immune responses in vivo.
J. Immunol.
152:2172-2179[Abstract].
|
| 38.
|
Miyazaki, T.,
A. Dierich,
C. Benoist, and D. Mathis.
1996.
Independent modes of natural killing distinguished in mice lacking Lag3.
Science
272:405-408[Abstract].
|
| 39.
|
Murphy, J. W.,
M. R. Hidore, and S. C. Wong.
1993.
Direct interactions of human lymphocytes with the yeast-like organism, Cryptococcus neoformans.
J. Clin. Investig.
91:1553-1566.
|
| 40.
|
Orange, J. S.,
B. Wang,
C. Terhorst, and C. A. Biron.
1995.
Requirement for natural killer cell-produced interferon in defense against murine cytomegalovirus infection and enhancement of this defense pathway by interleukin 12 administration.
J. Exp. Med.
182:1045-1056[Abstract/Free Full Text].
|
| 41.
|
Orange, J. S., and C. A. Biron.
1996.
Characterization of early IL-12, IFN- , and TNF effects on antiviral state and NK responses during murine cytomegalovirus infection.
J. Immunol.
156:4746-4756[Abstract].
|
| 42.
|
Rao, T. D.,
A. Fischer, and A. B. Frey.
1994.
CD4+ Th2 cells elicited by immunization confer protective immunity to experimental Borrelia burgdorferi infection.
Ann N.Y. Acad. Sci.
730:364-366[Medline].
|
| 43.
|
Rao, T. D., and A. B. Frey.
1995.
Protective resistance to experimental Borrelia burgdorferi infection of mice by adoptive transfer of a CD4+ T cell clone.
Cell. Immunol.
162:225-234[Medline].
|
| 44.
|
Saunders, B. M., and C. Cheers.
1996.
Intranasal infection of beige mice with Mycobacterium avium complex: role of neutrophils and natural killer cells.
Infect. Immun.
64:4236-4241[Abstract].
|
| 45.
|
Schaible, U. E.,
M. D. Kramer,
C. Museteanu,
G. Zimmer,
H. Mossmann, and M. M. Simon.
1989.
The severe combined immunodeficiency (scid) mouse: a laboratory model for analysis of Lyme arthritis and carditis.
J. Exp. Med.
170:1427-1432[Abstract/Free Full Text].
|
| 46.
|
Schaible, U. E.,
S. Gay,
C. Museteanu,
M. D. Kramer,
G. Zimmer,
K. Eichmann,
U. Museteanu, and M. M. Simon.
1990.
Lyme borreliosis in the severe combined immunodeficiency (scid) mouse manifests predominantly in the joint, heart, and liver.
Am. J. Pathol.
137:811-820[Abstract].
|
| 47.
|
Schaible, U. E.,
M. D. Kramer,
R. Wallich,
T. Tran, and M. M. Simon.
1991.
Experimental Borrelia burgdorferi infection in inbred mouse strains: antibody response and association of H-2 genes with resistance and susceptibility to development of arthritis.
Eur. J. Immunol.
21:2397-2405[Medline].
|
| 48.
|
Schaible, U. E.,
R. Wallich,
M. D. Kramer,
G. Nerz,
T. Stehle,
C. Museteanu, and M. M. Simon.
1994.
Protection against Borrelia burgdorferi infection in scid mice is conferred by presensitized spleen cells and partially by B but not T cells alone.
Int. Immunol.
6:671-681[Abstract/Free Full Text].
|
| 49.
|
Scharton, T. M., and P. Scott.
1993.
Natural killer cells are a source of interferon that drives differentiation of CD4+ T cell subsets and induces early resistance to Leishmania major in mice.
J. Exp. Med.
178:567-577[Abstract/Free Full Text].
|
| 50.
|
Scharton-Kersten, T.,
L. C. C. Afonso,
M. Wysocka,
G. Trinchieri, and P. Scott.
1995.
IL-12 is required for natural killer cell activation and subsequent T helper 1 cell development in experimental leishmaniasis.
J. Immunol.
154:5320-5330[Abstract].
|
| 51.
|
Scott, P., and G. Trinchieri.
1995.
The role of natural killer cells in host-parasite interactions.
Curr. Opin. Immunol.
7:34-40[Medline].
|
| 52.
|
Seaman, W.,
M. Sleisenger,
E. Erikson, and G. Koo.
1987.
Depletion of natural killer cells in mice by monoclonal antibody to NK 1.1.
J. Immunol.
138:4539-4544[Abstract].
|
| 53.
|
Seder, R. A.,
R. Gazzinelli,
A. Sher, and W. E. Paul.
1993.
IL-12 acts directly on CD4+ T cells to enhance priming for IFN- production and diminishes IL-4 inhibition of such priming.
Proc. Natl. Acad. Sci. USA
90:10188-10192[Abstract/Free Full Text].
|
| 54.
|
Seiler, K. P.,
Z. Vavrin,
E. Eichwald,
J. B. Hibbs, Jr., and J. J. Weis.
1995.
Nitric oxide production during murine Lyme disease: lack of involvement in host resistance or pathology.
Infect. Immun.
63:3886-3895[Abstract].
|
| 55.
|
Shih, C.-M.,
S. R. Telford III,
R. J. Pollack, and A. Spielman.
1993.
Rapid dissemination by the agent of Lyme disease in hosts that permit fulminating infection.
Infect. Immun.
61:2396-2399[Abstract/Free Full Text].
|
| 56.
|
Steere, A. C.
1989.
Lyme disease.
N. Engl. J. Med.
321:586-596[Abstract].
|
| 57.
|
Trinchieri, G.
1989.
Biology of natural killer cells.
Adv. Immunol.
47:187-376[Medline].
|
| 58.
|
Tripp, C. S.,
S. F. Wolf, and E. R. Unanue.
1993.
Interleukin 12 and tumor necrosis factor alpha are costimulators of interferon gamma production by natural killer cells in severe combined immunodeficiency mice with listeriosis, and interleukin 10 is a physiologic antagonist.
Proc. Natl. Acad. Sci. USA
90:3725-3729[Abstract/Free Full Text].
|
| 59.
|
Wang, B.,
C. Biron,
J. She,
K. Higgins,
M.-J. Sunshine,
E. Lacy,
N. Lonberg, and C. Terhorst.
1994.
A block in both early T lymphocyte and natural killer cell development in transgenic mice with high-copy numbers of the human CD3E gene.
Proc. Natl. Acad. Sci. USA
91:9402-9406[Abstract/Free Full Text].
|
| 60.
|
Weinberg, J. B.,
D. L. Granger,
D. S. Pisetsky,
M. F. Seldin,
M. A. Misukonis,
S. N. Mason,
A. M. Pippen,
P. Ruiz,
E. R. Wood, and G. S. Gilkeson.
1994.
The role of nitric oxide in the pathogenesis of spontaneous murine autoimmune disease: increased nitric oxide production and nitric oxide synthase expression in MRl-lpr/lpr mice, and reduction of spontaneous glomerulonephritis and arthritis by orally administered NG-monomethyl-L-arginine.
J. Exp. Med.
179:651-660[Abstract/Free Full Text].
|
| 61.
|
Yang, L.,
J. H. Weis,
E. Eichwald,
C. P. Kolbert,
D. H. Persing, and J. J. Weis.
1994.
Heritable susceptibility to severe Borrelia burgdorferi-induced arthritis is dominant and is associated with persistence of large numbers of spirochetes in tissues.
Infect. Immun.
62:492-500[Abstract/Free Full Text].
|
| 62.
|
Yokahama, W. M., and W. E. Seaman.
1993.
The Ly-49 and NKR-P1 gene families encoding lectin-like receptors on natural killer cells: the NK gene complex.
Annu. Rev. Immunol.
11:613-635[Medline].
|
Infection and Immunity, November 1998, p. 5208-5214, Vol. 66, No. 11
0019-9567/98/$04.00+0
Copyright © 1998, American Society for Microbiology. All rights reserved.
This article has been cited by other articles:
-
Miller, J. C., Ma, Y., Bian, J., Sheehan, K. C. F., Zachary, J. F., Weis, J. H., Schreiber, R. D., Weis, J. J.
(2008). A Critical Role for Type I IFN in Arthritis Development following Borrelia burgdorferi Infection of Mice. J. Immunol.
181: 8492-8503
[Abstract]
[Full Text]
-
Nardelli, D. T., Callister, S. M., Schell, R. F.
(2008). Lyme Arthritis: Current Concepts and a Change in Paradigm. CVI
15: 21-34
[Full Text]
-
Brown, C. R., Reiner, S. L.
(2000). Bone-Marrow Chimeras Reveal Hemopoietic and Nonhemopoietic Control of Resistance to Experimental Lyme Arthritis. J. Immunol.
165: 1446-1452
[Abstract]
[Full Text]
-
Brown, C. R., Reiner, S. L.
(1999). Experimental Lyme Arthritis in the Absence of Interleukin-4 or Gamma Interferon. Infect. Immun.
67: 3329-3333
[Abstract]
[Full Text]