TEXT

Top Abstract Text References

Since 1985, numerous geographically and temporally restricted outbreaks of systemic infections caused by serotype M1 group A streptococci have been reported (1, 5, 16, 23, 24, 26-29, 32, 34, 36, 37). These outbreaks occurred on at least five continents of the world. Based on genomic restriction fragment length polymorphism (RFLP), we suggested that a specific subclone or clonal variant of this serotype, designated M1inv+, emerged in the mid-1980s to become the most-common M1 strain isolated from cases of uncomplicated pharyngitis (5). This same variant was also associated with the increased incidence of toxic shock in North America (5, 28), Scandinavia (24, 26, 34), and New Zealand (23). Other M1 subclones, based on distinctive RFLP, are designated M1inv for ease of discussion. Although outbreaks of toxic shock associated with M1 infection continued to occur in the 1990s, health authorities began to recognize clusters of toxic shock and necrotizing fasciitis associated with other serotypes (2, 7, 8, 10). This observation is puzzling but could be explained by increased awareness of public health authorities, changes in the health status of susceptible populations, or the horizontal dissemination of an unidentified virulence factor for other serotypes.

The acquisition of plasmids, prophages, or transposons could account for differences in RFLP and virulence that distinguish M1 subclones. This streptococcal species seldom harbors plasmids or transposons, but most strains carry one or more prophages (18, 19, 35, 38, 40). To investigate this possibility, phages were isolated from an M1inv+ strain and compared to the bacteriophage T12, a known and well-studied vector of the speA toxin gene (19, 38, 40, 41). Preliminary data suggested that M1inv+ strains invade cultured human epithelial cells at a significantly higher frequency than M1inv strains. This finding was confirmed, and the relationship between intracellular invasion and prophages carried by M1inv+ strains was investigated.

Streptococcal cultures were grown and stored as previously described (6). Fifty-eight group A streptococcal M1 serotype strains that were isolated from different areas of the United States and the world were used in this study. Among them, 27 strains were isolated from individuals with systematic streptococcal disease (toxic shock, sepsis, or necrotizing fasciitis). Thirty-one strains were isolated from the throats of patients with uncomplicated pharyngitis. Most strains were obtained from the World Health Organization Collaborating Center for Reference and Research on Streptococci at the University of Minnesota. Strains 89, 80, 68, and 62 are blood isolates that represent the predominant M1 subclone in Finland and Norway (24, 26, 34). The New Zealand strains, 88-711, 89-385, 85-1532, and 84-221, represent the RFLP Ia subclone and were obtained from D. Martin, Communicable Disease Center, Porirua, New Zealand (23, 28). The T253c strain, which was cured of endogenous plaque-forming bacteriophages (18, 41), was used as the recipient strain for phage propagation and the construction of lysogens. The T253c(phage T12) lysogen served as the donor strain for the preparation of phage T12 DNA. The serotype M12 strain CS24 was used as a noninvasive control in invasion assays (35). Mitomycin-induced phage lysates from M1inv+ strain 90-226 (9) were prepared as previously described (35, 40). Lysogens were obtained by streaking bacteria from turbid plaques onto Todd-Hewitt agar medium.

Chromosomal DNAs, used for Southern blots, were extracted from streptococci as previously described (6). Template chromosomal DNA for PCR was extracted by a rapid, microwave extraction method (3). DNA probes for Southern blots were labelled with digoxigenin. Hybridization conditions and the methods for detection of hybrids are described in the Genius System user's guide (Boehringer Mannheim Biochemicals). Phage particles, extraction, and purification of phage DNA were described previously by Yu and Ferretti (40). The probe used to identify speA sequence was produced by PCR. The speA primers were speaFor (5'TTTAAATCTAGAGGAGA ACCCAGATATAAAATGGAGG3') and speaRev (5'GACGATAAAA TAGTTGCTAAGCTACAAGCTCCTG3') (6). The product from these primers extends beyond the 3' end of the speA gene by 271 nucleotides. A gentamicin-penicillin resistance intracellular invasion assay was used to determine the frequency of internalization of streptococci by cultured A549 cells (22).

The M1inv+ subclone carries a T12-like prophage. Earlier studies showed that the M1inv+ subclone harbored the speA gene (5, 27-29, 36); therefore, M1inv+ cultures were presumed to harbor a T12-like prophage that is not present in the M1inv strains. To explore this possibility, Southern blots of genomic DNA from 58 M1 clinical isolates, with and without the invasive restriction profile (5), were probed with digoxigenin-labelled phage T12 DNA. Figure 1 shows representative results. Multiple HaeIII restriction fragments from 47 strains with the invasive restriction profile, whether isolated from systemic disease or uncomplicated infections, hybridized to the probe (Fig. 1A). Phage T12 DNA was included for comparison. The T12 and T14 bacteriophages are highly related but not identical (Fig. 1A and 2). Estimations of the size of the T14 genome obtained by summing the sizes of hybridizing fragments approached 36 kb. An asterisk marks a fragment of speA. At least two fragments are chromosomal junction fragments, so 36 kb exceeds the actual size of the phage T14 genome. DNAs from M1inv+ strains from Finland and New Zealand also harbored the same prophage. The hybridizing fragments were identical to those from North America, confirming that the M1inv+ subclone associated with serious disease was globally dispersed (data not shown). A recent analysis of Scandinavian strains showed that this strain waxed and waned in dominance and in being the cause of systemic infections between 1988 and 1995 (26). As predicted, DNA from 11 M1inv strains lacked a T12-like prophage (Fig. 1B). Strain T253c DNA was included as a negative control. The phage T12 probe weakly hybridized to DNA fragments in T253c and M1inv DNAs. These weaker signals were due to the fact that T253c, although cured of plaque-forming phage, retains a defective prophage that contaminates all phage lysates prepared in this strain (40). Yu et al. suggested that this or a related defective phage was present in most clinical isolates of group A streptococci (40).

View larger version (96K): [in this window] [in a new window]   FIG. 1.   Southern hybridization of restricted DNAs from M1inv+ and M1inv clinical isolates to dioxigenin-labelled phage DNAs. Strain T253c has been cured of phage T12 and other plaque-forming phages. (A) HaeIII-digested DNAs were probed with digoxigenin-labelled phage T12 DNA. Strains 87-263, 87-442, and L462 are M1inv isolates. The remaining strains are M1inv+. The asterisk marks an speA HaeIII fragment. (B) ClaI-digested DNAs from M1inv+ clinical isolates were probed with labelled phage T13 DNA. Strain T253c(T13) is a T13 lysogen that was purified from a single plaque. (C) ClaI-digested DNA from M1inv strains probed with labelled phage T13 DNA. DNA from the M1inv+ strain 90-226 was included as a positive control. Strain 85-069 was designated M1inv on the basis of RFLP (data not shown) and because it lacks phage T14.

View larger version (82K): [in this window] [in a new window]   FIG. 2.   Southern hybridization of HaeIII-digested DNA purified from T12, T13, and T14 phage () particles to labelled phage DNAs. DNA was probed with digoxigenin-labelled phage T12 DNA (A), labelled phage T14 DNA (B), and phage T13 DNA (C). Arrows mark phage T12-specific (A) and phage T14-specific (B) fragments.

M1inv+ strains contain a second plaque-forming bacteriophage. The prophage carried by two M1inv+ cultures, strains 90-131 and 90-226, were induced by mitomycin and plaqued onto strain T253c. Both large and small turbid plaques were observed, and these plaques were easily distinguished from phage T12 plaques. Individual plaques from a mitomycin-induced culture of strain 90-226 were resuspended and replated onto strain T253c soft agar lawns. The turbid areas of single plaques were streaked onto agar media to obtain T253c lysogens, T253c(T13) from large, highly turbid plaques, and T253c(T14) from small, lightly turbid plaques. These lysogens were used for the production of high-titer lysates and phage DNA. Phage T12, T13, and T14 lysogens exhibited different immunities to superinfection (Table 1). Phage T12 formed plaques on M1inv+ cultures and on T253c(T13) and T253c(T14) lysogens. These phages also have somewhat different temperature optima for plaque formation. Phages T13 and T12 form plaques at 30 and 37°C, whereas phage T14 plaqued more efficiently at 30°C. Yu and coworkers described other T12-related phage with unique immunities and restriction fragment profiles, indicating a high level of genetic diversity among T12-like bacteriophages (40).

Phages T12 and T14 are highly similar and unrelated to phage T13. DNAs extracted from phage particles were probed in order to investigate genomic similarities between T12, T13, and T14 bacteriophages (Fig. 2). As expected, the T12 probe hybridized extensively to HaeIII digests of itself and phage T14 DNA but did not hybridize to phage T13 DNA (Fig. 2A). The T14 probe hybridized extensively to phage T12 DNA and to itself (Fig. 2B) but did not hybridize to phage DNA from 90-226 cultures because the ratio of phage T13 to T14 in induced 90-226 cultures approached 2 × 10⁵:1. The few phage T14 HaeIII fragments that weakly hybridized to phage T13 DNA correspond to the defective-phage DNA that contaminates both DNA preparations. The phage T13 probe hybridized to itself and to a mixture of phage DNAs obtained from a mitomycin-induced culture of 90-226 (Fig. 2C). Phage T12 and T14 DNAs did not hybridize to the T13 DNA probe, indicating that these phages are unrelated to phage T13. Estimations of the genomic sizes of T14 and T13 genomes from hybridizing fragments on agarose gels were 36 and 34.5 kb, respectively.

View larger version (51K): [in this window] [in a new window]   FIG. 3.   Southern hybridization of restricted phage DNAs to a labelled PCR fragment that corresponds to a segment of the speA gene. Enzymes used for restriction digests are indicated at the top. Phage 90-226 (90-226), phage DNA isolated from mitomycin-induced cultures of strain 90-226. Although this strain harbors both T13 and T14 phages, induced lysates contain predominately T13 particles.

The M1inv+ subclone invades epithelial cells more efficiently than other M1 subclones. Group A streptococci have been shown to invade epithelial cells at a high frequency (9, 13, 14, 22, 33). Expression of M protein or a fibronectin binding protein was demonstrated to be sufficient for efficient ingestion of these streptococci (9, 14, 25). Cultured lung epithelial cells were shown to much more efficiently internalize an M1inv+ strain than an M1inv culture (22), suggesting that prophage carried by the former may be responsible for the more-invasive phenotype. The capacities of a variety of M1inv+ and M1inv clinical isolates to invade A549 cells were compared in order to confirm this initial observation (Fig. 4). Although the invasion frequency varied considerably from day to day, M1inv+ cultures invaded these epithelial cells at significantly higher frequencies than did M1inv cultures. This variability prompted us to perform an experiment in which the genotype of the strains was concealed (Fig. 4, open symbols). The variability associated with strain 90-131 is the result of genetic instability in expression of the Vir regulon (6). High- and low-frequency internalization correlated with the genotype of the strain and did not reflect the source of the culture.

View larger version (24K): [in this window] [in a new window]   FIG. 4.   Internalization of M1 clinical isolates by lung epithelial A549 cells. Monolayers were infected with approximately 105 CFU of each culture. Internalized streptococci were determined by viable counts following 2 h of exposure to gentamicin and penicillin (22). Circles indicate M1inv+ strains. Stippled circles, M1inv+ strains isolated from patients with uncomplicated disease; triangles, M1inv strains isolated from patients with uncomplicated pharyngitis. Strain 85-069 is M1inv but harbors phage T13. Open circles and triangles represent strains whose genotypes were unknown to the investigator at the time of the experiment. NA, not available.