Previous Article | Next Article 
Infect Immun, February 1998, p. 406-417, Vol. 66, No. 2
0019-9567/98/$04.00+0
Copyright © 1998, American Society for Microbiology. All rights reserved.
The Fimbria Gene Cluster of Nonencapsulated
Haemophilus influenzae
Forien
Geluk,1
Paul P.
Eijk,1
S. Marieke
van Ham,1,
Henk M.
Jansen,2 and
Loek
van Alphen1,*
Departments of Medical
Microbiology1 and
Pulmonology,2 Academic Medical
Center, Amsterdam, The Netherlands
Received 20 March 1997/Returned for modification 16 June
1997/Accepted 17 November 1997
 |
ABSTRACT |
The occurrence of fimbria gene clusters in nonencapsulated
Haemophilus influenzae strains from chronic bronchitis
patients (n = 58), patients with acute otitis media
(n = 13), and healthy carriers (n = 12) was determined by DNA hybridization and PCR, based on sequences of
fimbriate H. influenzae type b. Although an average of 18%
of all nonencapsulated strains had a fimbria gene cluster consisting of
hifA to hifE inserted in the chromosome between
purE and pepN, differences in the frequency of
fimbria cluster-positive strains were observed, depending on the source of isolates. The compositions of the fimbria gene clusters of seven
strains from chronic bronchitis patients and one strain from an otitis
media patient were analyzed in more detail. After enrichment for
fimbria expression, the promoter of the gene cluster contained 10 TA
repeats (n = 2), leading to optimal positioning between the
10 and
35 promoter regions. The promoter regions of
five fimbria-negative strains were sequenced; four were found to have
nine TA repeats, and one had only four TA repeats. The protein sequence
of three ganglioside GM1-specific HifA adhesins consisted of conserved
regions intermingled with regions of sequence diversity.
hifA appeared to be flanked by intergenic regions that varied between strains and contained both direct and inverted DNA
repeats. Since noncoding DNA between hifA and
purE has not been found in H. influenzae type
b, these DNA sequences are probably not essential for fimbria
expression. An analysis of strains lacking the gene cluster revealed
the presence of similar sequences in 13 of 15 strains from chronic
bronchitis patients, 5 of 5 strains from otitis media patients, and 3 of 5 strains from healthy carriers. The lengths of these intergenic
regions were the same for multiple isolates of strains obtained during
persistent infections. The presence or absence and the composition of
the fimbria gene cluster and other sequences between the flanking genes
purE and pepN suggest that the fimbria gene
cluster was originally contained on a mobile element.
 |
INTRODUCTION |
Haemophilus influenzae
infections, including otitis media, sinusitis, pneumonia, and
persistent infections in chronic bronchitis patients, are preceded by
airway colonization, which is a process facilitated by fimbria (8,
24, 32, 39, 54). Four families of fimbriae have been
distinguished morphologically (5). Only the so-called LKP
fimbriae are associated with the adherence of H. influenzae to human cells (5, 28, 42, 47), and
LKP-positive bacteria agglutinate human erythrocytes that express the
AnWj antigen (29, 30, 40). The binding of fimbriate
H. influenzae to oropharyngeal epithelial cells is
dependent on sialic acid-containing lactosylceramide epithelial cell
receptors with monosialoganglioside-3 (GM3) as the minimal structure
(41). LKP fimbriae also mediate binding to a variety of
cells encountered by H. influenzae during carriage and
disease. These include pseudostratified columnar and ciliated columnar
epithelial cells of the (naso)pharynx, adenoid, and bronchi
(36). Finally, fimbriae facilitate binding to extracellular matrix proteins (52). Mucus interferes with fimbria-mediated adherence (7), although fimbriate bacteria do not bind more readily to mucus than do nonfimbriate bacteria (7, 35, 55). Therefore, fimbriae seem to be multifunctional in the pathogenesis of
H. influenzae infections. It is not known, however,
whether fimbriae are involved in the pathogenesis of persistent
infections and, if so, whether its function is at the onset or during
persistence of infection.
The fimbria gene cluster of H. influenzae type b
containing the genes hifA to hifE has previously
been analyzed and sequenced completely (49). hifA
encodes the fimbria subunit that mediates binding to the ganglioside
receptor (50). Comparing the hifA genes of
various H. influenzae type b and nontypeable
H. influenzae strains revealed the presence of
conserved and variable regions (6, 10, 11, 22, 23, 49, 50).
hifB encodes a protein of the chaperone family (17,
49), hifC encodes a putative assembly platform protein
(49, 53), and hifD and hifE encode two
minor subunits that are highly homologous to hifA (49,
50). The presence of hifD and hifE affects
fimbria expression, but their exact role(s) is not known
(49). The transcription of all fimbria genes is determined
by reversible changes in the number of TA repeats in the bidirectional
promoter region localized between hifA and hifB
in the fimbria gene cluster (48). The gene cluster also
contains multiple inverted and direct repeats (22, 48). These structures may cause hairpins that are involved in the
stabilization of mRNA, and the inverted repeats at the 5' and 3' ends
of the gene cluster may make the cluster a transposon-like element
(49).
Here, we report the compositions of various fimbria gene clusters of
nonencapsulated H. influenzae strains isolated from
chronic bronchitis patients, acute otitis media patients, and healthy carriers and compare them with the composition of H. influenzae type b. We show that all of the fimbria gene clusters
of nonencapsulated H. influenzae strains contain
hifA to hifE. The gene clusters are located at
the same chromosomal position between purE and pepN as that for the LKP-4 fimbria gene cluster of
H. influenzae type b. The promoter region of the gene
cluster was found to contain various numbers of TA repeats when
fimbria-positive and -negative strains were compared. In contrast to
H. influenzae type b, nonencapsulated strains have
sequences that show variation inserted between purE and the
fimbria genes but only a small number of repetitive elements between
hifB and the promoter. The composition of these elements did
not change during persistent infections in chronic bronchitis patients.
The significance of the flanking regions for the excision and insertion
of the gene cluster in the chromosome is discussed.
 |
MATERIALS AND METHODS |
Bacterial strains and plasmids.
Nonencapsulated
H. influenzae strains (n = 58) were isolated
as described before from sputum samples of chronic bronchitis patients
who had been infected for up to 2 years (12). Persistent strains were isolated at least twice from a patient over a period of
longer than 6 months, although the periods in which sputum cultures
were positive for that strain were often intermingled with periods in
which sputum cultures were negative. Acute (nonpersistent) strains were
isolated only once from sequentially taken sputum samples of a patient
collected over a period of more than 6 months and at least not during
the 3 months before or after that isolation date. Persistent
H. influenzae strains were identical in their random
amplified polymorphic DNA (RAPD) patterns obtained by PCR with ERIC
primers but included outer membrane protein P2 and P5 variants
(45). Nonencapsulated H. influenzae strains
were also isolated from middle ear fluid samples of patients with
otitis media (n = 13) and from throat swabs of healthy
adult carriers (n = 12). Fimbria gene cluster-positive
H. influenzae type b strains 770235 (identical to
AM30), A920006, Eagan, A920019, A840049, A860268 and the fimbria
gene-negative H. influenzae type b strain 760705 from
patients with invasive diseases and strain Rd were included for
references (42, 44, 48). All strains were identified as
H. influenzae by their growth dependence on NAD and
hemin. Strains were kept as frozen stocks at
70°C in broth
containing 15% glycerol, usually after less than five passages from
the primary culture plate.
Plasmid pMH140, containing the complete fimbria gene cluster, and
plasmids containing parts of the fimbria gene cluster of H. influenzae 770235 have been described previously
(47-50).
RAPD analysis.
To determine the genetic relationship between
fimbria gene cluster-positive H. influenzae strains,
bacterial strains were analyzed by random PCRs with either primer ERIC2
(45, 51) or HPO1 or HPO2 (1) as previously
described (45). Chromosomal DNA was isolated by the protocol
of Boom et al. (4). The PCR mixture (100 µl) consisted of
1× PCR buffer from a Perkin-Elmer kit, 50 pmol of primer, 0.2 mM
(each) deoxyribonucleotide triphosphates, 50 pmol of chromosomal DNA,
and 0.5 U of Taq DNA polymerase (AmpliTaq; Perkin-Elmer).
PCR consisted of the following steps: denaturation (5 min, 94°C) and
35 cycles of denaturation (1 min, 94°C), annealing (1 min, 25°C),
and extension (4 min, 74°C). Finally, an additional DNA extension
step (10 min at 74°C) was included. PCR was performed with a Biometra
II apparatus (Perkin-Elmer). After agarose gel electrophoresis of PCR
products, the banding patterns on gels obtained for each primer were
analyzed with Gel Compar (Applied Maths, Kortrijk, Belgium) as
previously described (46). CLUSTAL analysis was performed
with the Dice coefficient and UPGMA (unweighted pair group method using
arithmetical averages) clustering.
Enrichment for bacteria expressing fimbriae.
None of the
H. influenzae strains from patients agglutinated human
erythrocytes, as determined before, indicating that they did not
express fimbriae (28-30). Enrichment for bacteria adhering through fimbriae was performed by a hemagglutination enrichment procedure previously described with AnWj-positive human erythrocytes (29, 30, 40, 41). The specificity of hemagglutination for
fimbriae was assessed by showing the absence of hemagglutination of
cord blood erythrocytes (since they are AnWj negative) and inhibition
of hemagglutination by monosialoganglioside-1 (GM1) (40,
41). The functional activity of fimbriae was determined semiquantitatively by the hemagglutination titer. A bacterial suspension of 1010 CFU per ml was diluted stepwise twofold
in phosphate-buffered saline and subsequently incubated for 5 to 15 min
at room temperature on World Health Organization plates as previously
described (48). Hemagglutination was read over a light, and
the maximal dilution of the suspension that caused hemagglutination was
taken as the titer (50). Fimbria expression was also
analyzed by electron microscopy after negative staining, as described
before (42).
General DNA techniques.
Unless stated otherwise, DNA
manipulations were carried out by standard procedures (34).
All enzymes (Boehringer Mannheim and Pharmacia) were used according to
the instructions provided by the manufacturers. Oligonucleotides (Table
1) were available from previous studies
or were ordered from Applied Biosystems and used without further
purification. PCR was performed with DNA isolated by the
phenol-chloroform method (21) or with bacterial lysates
obtained by heating an H. influenzae colony suspended in 1 ml of H2O for 5 min at 100°C and then cooling on
ice. PCR products were purified with Gene Clean II (Bio 101, La Jolla, Calif.) or Qiaex (Qiagen Gmbh, Hilden, Germany), followed by
phenol-chloroform extraction, before they were used for sequence
analysis or DNA hybridization.
Identification of fimbria gene clusters.
A thick suspension
(2 µl) of H. influenzae cells grown on chocolate agar
plates was spotted onto nitrocellulose filters and baked for colony
hybridization, essentially as previously described (34). The
fimbria gene cluster excised from plasmid pMH140 (47) was
used as a probe after being labelled with digoxigenin (Boehringer, Mannheim, Germany). The presence of fimbria gene clusters was also
assessed by PCR with primers derived from the conserved flanking regions of the purE and pepN genes (Table 1) or
two PCRs with a primer set consisting of purE and
hifC primers and a set consisting of hifC and
pepN primers. PCR was performed with thermostable Taq DNA polymerase and Pwo DNA polymerase
(Boehringer) according to the instructions of the manufacturer. The
lengths of reaction products were determined by agarose gel
electrophoresis. PCR products derived from fimbriate H. influenzae type b strain 770235 and fimbria-negative strain 760705 were included as controls.
Identification of the individual genes from hifA to
hifE.
The presence of hifA, hifB,
hifD, and hifE was determined by Southern
blotting with purified DNAs containing the single genes as probes.
Chromosomal DNA was digested mostly by restriction enzymes
EcoRI, XhoI, and BglII, and digested
DNA was separated by agarose gel electrophoresis. The hifA,
hifB, hifD, and hifE gene probes were
prepared by excising the respective genes from plasmids pMH042, pMH212,
pMH046, and pMH156 (49, 50). The probes used for
hybridizations were labelled with digoxigenin. The hifC gene
could not be identified by hybridization with the hifC gene
or a fragment of the hifC gene purified from pMH140 after
EcoRI and EcoRV treatment, since high background
levels were obtained. Therefore, the presence of the hifC
gene was determined by PCR with a primer set complementary to sequences
in hifC. Strains that were negative in this PCR were further
analyzed by PCR with one primer set consisting of a primer specific for
the 5' end of the hifC gene and a primer specific for
purE and another set consisting of a primer complementary to
the same sequence inside the hifC gene and a primer specific
for pepN (Table 1). H. influenzae type b
strains 770235 and 760705 were used as positive and negative controls,
respectively. The conditions used for hybridizations and PCRs are
summarized in Table 1.
Analysis of regions of the fimbria gene cluster containing repeat
sequences.
The presence of long stretches of intergenic DNA
similar to those in the fimbria gene cluster of H. influenzae 770235 was determined by PCR with primers flanking the
repeat regions of H. influenzae type b strain 770235 (Fig. 1; Table 1). PCR products were
characterized by agarose gel electrophoresis and partial DNA sequence
analysis.

View larger version (10K):
[in this window]
[in a new window]
|
FIG. 1.
Schematic representation of the fimbria gene cluster of
H. influenzae, in which the primers for PCRs have been
indicated in the 5'-to-3' direction. Relevant restriction enzyme sites
are indicated above the schematic.
|
|
The number of TA repeats in the promoter region was analyzed from the
sequence reaction of a seminested PCR product obtained
for the region
between
hifA and
hifB (Fig.
1; Table
1).
Sequence analysis of hifA.
Fragments of the fimbria
gene cluster were obtained by PCR with appropriate primers. These
fragments were used directly as templates for automated double-stranded
DNA sequencing (model 370A; Applied Biosystems) with a Taq
dye-terminator cycle sequencing kit (Applied Biosystems),
fluorescent-dye-labelled dideoxynucleotides, and the same primers.
Fragments were sequenced in both directions. Sequences were analyzed by
using computer programs included in the program package PC/GENE
(IntelliGenetics, Inc.). DNA sequences were aligned with the program
CLUSTAL by the methods of Higgins and Sharp (16).
Nucleotide sequence accession numbers.
The hifA
nucleotide sequences of strains 602, 4564, and 6173 have been deposited
in the EMBL, GenBank, and DDBJ nucleotide sequence databases under
accession no. U91944, U91945, and U91946, respectively.
 |
RESULTS |
Occurrence of fimbria gene clusters in nonencapsulated
H. influenzae strains.
Persistent strains
(n = 27), acute strains (n = 8), and
strains not clearly identifiable as acute or persistent
(n = 23) were isolated from infected chronic bronchitis
patients. Furthermore, strains from patients with otitis media
(n = 13) and healthy carriers (n = 12)
were obtained. All these strains were screened for the presence of
fimbria genes by colony blot hybridization with the gene cluster of
H. influenzae type b strain 770235 as the probe. The
results of this screening are summarized in Table
2. The proportion of strains positive by
hybridization varied considerably for persistent and acute strains from
chronic bronchitis and otitis media patients and healthy carriers,
although the differences were not significant (x2 [Yates'
correction], 4 df, P = 0.15). The percentage of
positive strains from acute chronic bronchitis patients was the
highest. The lack of significance may be due to the small number of
fimbria-positive strains in the total sample of bacterial isolates.
DNA hybridizations with restriction enzyme-digested chromosomal DNAs of
the 12 strains from chronic bronchitis patients, 2
strains from otitis
media patients, and 1 strain from a healthy
carrier that were positive
for fimbria genes were performed with
the gene cluster excised from
plasmid pMH140 as the probe to confirm
the presence of fimbria genes. A
strain-specific banding pattern
was observed (Fig.
2), indicating fimbria genes on more than
one
fragment. This diversity is likely a consequence of the genetic
diversity of nonencapsulated strains, as previously shown by a
variety
of techniques, including multilocus enzyme electrophoresis,
outer
membrane protein analysis, and RAPD (
26,
31,
43,
45).
The
presence of the fimbria gene cluster was also determined by
PCR with
primers derived from the flanking
purE and
pepN
genes
(Table
1). By using DNA of the fimbria-positive control strain
770235 as the template, a product with a length of 7.3 kb was
obtained,
in accordance with the determined length of the fimbria
gene cluster of
H. influenzae type b (
49). Fimbria-negative
strains 760705 and Rd revealed a product of 0.26 kb, which is
identical
to the length predicted from the genome sequence of
strain Rd
(
9). Sequence analysis of the PCR product of strain
760705 showed that the PCR product had a sequence almost identical
to the
published sequence of strain Rd (
9) (data not shown).
Of the
15 strains positive by hybridization with the fimbria gene
cluster, 12 gave a PCR product with the
purE and
pepN primers
of the expected length of 7.3 kb. The three strains positive by
hybridization but negative by PCR with
purE and
pepN primers were
subsequently analyzed by PCR with the two
primer sets
pepN-fgHifC1
and
purE-fgHifC1Comp1.
PCR with primers specific for the 3' end
of the gene cluster revealed a
product of 4.7 kb. The product
of the 5' end of the cluster of two
strains consisted of a 2.8-kb
fragment, and a 3.6-kb band was obtained
for the third strain.
These results indicate that the last strain
(A920037) had a longer
fimbria cluster (8.3 kb) than those of the other
fimbria-positive
nonencapsulated strains. With
purE-pepN
primers, PCRs of
H. influenzae strains negative by
colony blot hybridization with the fimbria
gene cluster probe revealed
products that varied in length between
0.26 and 1.17 kb (see below).
These results suggested that nonencapsulated
H. influenzae strains contained either complete fimbria gene clusters
or none of the genes at all.

View larger version (51K):
[in this window]
[in a new window]
|
FIG. 2.
Hybridization of DNAs of 12 nonencapsulated
H. influenzae strains from chronic bronchitis patients
(lanes 1 through 12) with the complete gene cluster of strain 770235 from plasmid pMH140 as the probe. The controls were DNA of fimbriate
H. influenzae type b strain 770235 (origin of the
probe) (lane 14) and DNA of fimbria-negative strain 760705 (lane 13).
Chromosomal DNAs of bacteria were cut with restriction enzymes
EcoRI, XhoI, BglII, and
AccI before electrophoresis and Southern hybridization. ME,
meningitis isolate; CB, chronic bronchitis isolate; P, persistent
isolate; A, acute isolate; ?, acute or persistent isolate.
|
|
hifA to hifE in nonencapsulated
H. influenzae strains.
The presence of each gene
from hifA to hifE was determined for the 15 strains positive for the fimbria gene cluster. DNA hybridization with
the hifA probe revealed positive reactions with DNAs of all 15 strains and the reference H. influenzae type b
strain 770235 and no reaction with the negative control strains 760705 and Rd. The PCR products obtained with hifA-specific primers
were about 800 bp long, which is similar to those of reference strain
770235 (Fig. 3). These products were
longer than the hifA gene (650 bp), since primer fgHifA1
annealed outside the hifA gene (Fig. 1; Table 1)
(49). Minor variations in the lengths of the products
obtained for other strains were observed, possibly as a consequence of DNA sequence variation (see below). hifB, hifD,
and hifE were also identified by DNA hybridization, showing
genetic diversity similar to that observed with the total gene cluster
as the probe. The number of bands per sample that hybridized with the
hifB probe was lower than the number of bands seen after
hybridization with the total gene cluster, as can be expected when
fimbria genes other than hifB are located on separate
fragments. The reactions were specific for the tested hif
genes, since the hifA, hifB, hifD, and
hifE probes did not cross-react with other hif
probes by hybridization. The results obtained for hifB (Fig.
4) are an example. The hifC
probe, however, showed background reactivities with other fimbria
genes. The problem of cross-hybridization was circumvented by using a
PCR with two primers that involve hifC sequences (fgHifC1
and fgHifC2) (Table 1). For 8 of 15 strains, a product of the expected
length was obtained. For the other seven strains, a product was
obtained by PCR with one primer derived from a hifC sequence
(primer fgHifC1 or complementary primer fgHifC1Comp1) and another
derived from sequences upstream or downstream of this gene
(purE or pepN [Fig. 1; Table 1]).
Fimbria-negative strain 760705 was negative in these reactions.
Nonencapsulated H. influenzae strains were either
positive for all the fimbria genes, hifA through hifE, or negative for all of these genes.

View larger version (79K):
[in this window]
[in a new window]
|
FIG. 3.
PCR for hifA of H. influenzae
type b strains from meningitis patients (ME) (lanes 1 through 4), two
nonencapsulated H. influenzae strains from otitis media
patients (OM) (lanes 5 and 6), strains from chronic bronchitis patients
(CB) (lanes 7 through 14), and positive control strain 770235 from a
meningitis patient (lane 1). Lane C, negative control strain 760705;
lane M, 100-bp ladder. The hifA primers were fgHifA1 and
fgHifA2. P, persistent isolate; A, acute isolate; ?, acute or
persistent isolate.
|
|

View larger version (53K):
[in this window]
[in a new window]
|
FIG. 4.
Hybridization of 10 representatives of fimbria gene
cluster-positive nonencapsulated H. influenzae strains
(lanes 1 through 10) with the hifB gene of strain 770235 from plasmid pMH212 as the probe. Chromosomal DNAs of bacteria were cut
with restriction enzymes EcoRI, XhoI, and
BglII before electrophoresis and Southern hybridization. The
controls were fimbria-negative strain 760705 (lane 11) and
H. influenzae type b strain 770235 (origin of the
probe) (lane 12). Abbreviations are identified in the legend to Fig.
3.
|
|
Sequence analysis of hifA.
Since HifA of H. influenzae type b had previously been shown to be an adhesin for
the ganglioside GM3 receptor, we analyzed the hifA gene in
detail after sequencing the PCR products obtained with chromosomal DNA
as the template. The DNA and derived protein sequences of three strains
were compared. Open reading frames coding for proteins of 208, 214, and
216 amino acids were obtained for the three strains. Such lengths are
similar to those of the hifA genes of H. influenzae type b strains (10, 22, 49) and the
published sequence of hifA from a nonencapsulated strain (6). The lengths of hifA genes varied by at most
24 bases (4%). An alignment of the derived protein sequences and the
sequences published before (Fig. 5)
revealed the presence of conserved regions, interchanged with variable
regions, in agreement with earlier reports (6, 10, 49).
According to the analysis of Hopp and Woods (18), the
protein regions encoded by variable regions appeared to be hydrophilic
and to contain potentially antigenic sites.

View larger version (55K):
[in this window]
[in a new window]
|
FIG. 5.
Alignment of the amino acid (AA) sequences derived from
DNA sequences of hifA genes from strains 602, 4564, and 6173 (this study) and those from strains 770235, MinnA, and (M)37 (6,
10, 22, 47). Amino acids are indicated by one-letter codes. Amino
acids that are identical in all of the proteins listed are indicated by
asterisks. Similar amino acids are indicated by dots. Dashes indicate
gaps. Three hydrophilic domains are also shown.
|
|
Expression of fimbriae.
None of the 15 clinical strains that
hybridized with the fimbria gene cluster agglutinated human
erythrocytes significantly. Of these strains, five were randomly chosen
for hemagglutination enrichment in order to obtain fimbria-expressing
bacteria. The nonhemagglutinating variant of H. influenzae 770235 was included as a positive control for
enrichment. The results are summarized in Table
3. After three enrichment cycles, the
positive control strain agglutinated AnWj-positive erythrocytes. After
five cycles, strain A930105 from a healthy carrier and strain 6 from a
chronic bronchitis patient were positive for hemagglutination. After 9 to 12 enrichment cycles, three strains from chronic bronchitis patients
were still nonhemagglutinating, as was control strain 760705, which
lacks fimbria genes. Since the hemagglutinating strains did not
agglutinate AnWj-negative erythrocytes and hemagglutination was
inhibited by GM1, we concluded that LKP-4 fimbriae were responsible for
hemagglutination (41). Subsequently, the levels of fimbria expression of nonencapsulated H. influenzae strains 6 and A930105 and H. influenzae type b strain 770235 were
semiquantified by determining hemagglutination titers. A 1:1,024
diluted bacterial suspension of 1010 CFU of strain 6 per ml
was the highest dilution that caused hemagglutination. For strains
A930105 and 770235, 1:64 and 1:512 dilutions, respectively, were
the lowest concentrations to cause hemagglutination. Electron microscopy showed that fimbriae were abundantly present on the cell surfaces of strain 770235 after enrichment (positive control) but
that <1 and 10 fimbriae per 20 cells were present on the cell surfaces
of strain A930105 and strain 6 (Fig. 6),
respectively, indicating that these nonencapsulated bacterial strains
express fewer fimbriae than does H. influenzae type b.
View this table:
[in this window]
[in a new window]
|
TABLE 3.
Fimbria expression and number of TA repeats in the
promoter region of the fimbria gene cluster of positive nonencapsulated
H. influenzae strains and H. influenzae type
b strain 770235
|
|

View larger version (75K):
[in this window]
[in a new window]
|
FIG. 6.
Electron microscopy of fimbriae of nonencapsulated
H. influenzae strain 6 from a chronic bronchitis
patient (A), strain A930105 from the throat of a healthy individual
(B), and H. influenzae type b strain 770235 (C). Bar
(all panels), 0.5 µm.
|
|
TA repeats in the promoter and fimbria expression.
By using
primers HifARep2 and fgBrep1, PCR products were obtained for five
patient strains not expressing fimbriae and two hemagglutinating
variants of these strains. Sequencing of the products starting from the
primer fgBrep1 sequence revealed that the promoter region, containing
two overlapping
10 and
35 sequences, was similar to that of
H. influenzae type b strain 770235 (48), and
contained TA repeats. The number of TA repeats has previousy been shown
to be important for transcription (48). The numbers of TA
repeats in the strains examined are summarized in Table 3. Four
fimbria-negative strains had nine TA repeats, and one (strain 6173) had
surprisingly only four repeats. In H. influenzae type
b, nine TA repeats reduces promoter strength and thereby fimbria
expression (48). Hemagglutinating variants of strains 6 and
A930105 had 10 TA repeats, the optimal number for fimbria expression
(48).
Long direct repeats between hifA and hifB
are not required for fimbria expression.
In H. influenzae type b, the region between the promoter and
hifB contains 10 long direct repeats (49). By
using primers HifARep2 and MH006, products that varied considerably in
length were obtained (Fig. 7). Of the
fimbria gene cluster-positive strains from chronic bronchitis patients,
six gave PCR products of 550 bp, two gave PCR products of 650 bp, two
gave PCR products of 700 bp, and one gave a PCR product of 750 bp. The
lengths of these products were much shorter than those for products
from H. influenzae type b strains 770235 (49) and A920006 (1,011 bp) but were similar to those for
products from H. influenzae type b strains Eagan (600 bp), A920019 (650 bp), and A840049 (680 bp). The PCR products of two
strains from otitis media patients were 850 and 1,250 bp in length.
Short PCR products were obtained from strains A930105 (700 bp) (data
not shown) and 6 (650 bp). Starting from the promoter in the direction
of hifB, the DNA sequence was conserved for the four
nonencapsulated strains analyzed and for H. influenzae
type b strain 770235 until the first 6 bp of the long repeats (70 bp). Downstream from that point, the DNA sequences of the four
nonencapsulated strains and H. influenzae type b strain
770235 showed only limited homologies, except for the 30 bp in front of
hifB. The composition of the region between the promoter and
hifB is schematically represented in Fig.
8. Since we found diversity in the
promoter-hifB region, we analyzed whether this region was
unstable during persistent infections in chronic bronchitis patients.
By PCR with primers HifARep2 and MH006, the length of the region
between the promoter and hifB was determined for 21 H. influenzae strains, including 4 antigenic variants
isolated sequentially from four chronic bronchitis patients during
infections that persisted after 4, 11, 13, and 30 months. No
differences in the lengths of PCR products were observed for any of the
sequential strains.

View larger version (93K):
[in this window]
[in a new window]
|
FIG. 7.
Electrophoresis of PCR products of the intergenic
regions between hifB and the promoter of the gene cluster
obtained with primers MH006 and HifARep2. Lane M, 100-bp ladder; lanes
1 and 2, nonencapsulated H. influenzae from otitis media
patients; lanes 3 through 8, H. influenzae type b
strains from meningitis patients; lanes 9 through 20, nonencapsulated
H. influenzae strains from chronic bronchitis patients.
Abbreviations are identified in the legend to Fig. 3. Dash, disease not
known.
|
|

View larger version (45K):
[in this window]
[in a new window]
|
FIG. 8.
Schematic representation of the fimbria gene clusters of
nonencapsulated H. influenzae strains. H. influenzae type b strain 770235 is included for comparison.
Intergenic sequences are drawn to scale, except for
hifB-hifE regions, which are indicated as inserts, since
they are identical in size. Homologous DNAs are marked identically. For
the sizes of genes, see Fig. 1 and reference 49.
Abbreviations are identified in the legend to Fig. 3, with the sources
of strains indicated parenthetically.
|
|
Composition of the regions flanking the gene cluster.
Since
the PCR results with primers specific for purE and
pepN showed that the fimbria gene clusters of all the
strains tested appeared to be localized between purE and
pepN in the H. influenzae chromosome, the 5'
region of the gene cluster of nonencapsulated H. influenzae was analyzed by PCR with primers based on sequences of
purE and hifA and the 3' region was analyzed by
PCR with primers derived from hifC and pepN
(Table 1). The results are presented schematically in Fig. 8. At the
downstream end of the gene cluster (hifC to
pepN), the PCR product of each of the nonencapsulated H. influenzae strains tested (seven from patients with
chronic bronchitis and one from a patient with otitis media) had a
length similar to that of the corresponding part (4,659 bp) of the
fimbria gene cluster of H. influenzae 770235. Sequence
analysis, starting from pepN, revealed that each of these
nonencapsulated H. influenzae strains had a
pur box in front of pepN; this box is normally
found in front of purE. Such pur box duplication
has also previously been found for H. influenzae type b
strain 770235 (49). Each strain, except for one (248), had a
duplication of 37 nucleotides at the 5' end of the pur box
as well. Upstream of these pur sequences, 144-bp spaced
short inverted repeats (GTAGGGTGGGCGTAAGCCCAC) were found in
H. influenzae strain A930105. Similar repeats, but
adjacent to each other, have previously been observed in the fimbria
gene cluster of H. influenzae type b (49).
Strains 6, 190, 602, 4564, and 4949 had one repeat, and strains 37 and
248 lacked both. A gene search of the H. influenzae Rd
genome (9) revealed that this repeat occurs with 95%
homology in four places of the genome outside the fimbria operon.
At the upstream site of the cluster (
purE to
hifA), differences in the composition of fimbria gene
clusters were also observed.
The lengths of the PCR products obtained
for the eight strains
tested with primers derived from the sequences of
purE and
hifA were roughly 1.6 kb (Fig.
8).
Sequence analysis of
purE-hifA regions
revealed that in all
of the fimbria gene cluster-positive nonencapsulated
H. influenzae strains tested, a noncoding-DNA insert between the
pur box at the 5' site of the cluster adjacent to
purE and the
short direct repeat adjacent to
hifA
was found. This insert was
absent in
H. influenzae type
b strain 770235 (
49). In two nonencapsulated
H. influenzae strains, the length of the insert was 570 bp, and
in
the other six strains examined, the length of the insert was
720 bp.
The 720-bp insert included the 570-bp sequence almost
perfectly. No
homology was observed between the insert and the
long repeated sequence
between
hifA and
hifB of
H. influenzae type b strain 770235 (
49).
Analysis of the region between purE and
pepN of strains negative for fimbria genes.
As
described above, the chromosomes of the H. influenzae
strains examined contained either all of the fimbria genes from
hifA to hifE or none of these fimbria genes. To
determine whether the sequences found between purE and the
5' end of the fimbria gene cluster and between pepN and the
3' end of the cluster of a nonencapsulated H. influenzae strain were part of the gene cluster, the length and
composition of DNA between purE and pepN were
determined for fimbria-negative strains. By PCR with primers specific
for purE and pepN, products of variable size
longer than those in strains 760705 (H. influenzae type
b) and Rd were obtained for 13 of 15 strains from chronic bronchitis
patients, 5 of 5 strains from otitis media patients, and 3 of 5 strains
from carriers (all strains lacked the fimbria gene cluster). The DNAs
of PCR products obtained from seven fimbria-negative
nonencapsulated strains were sequenced, and the sequences were
compared with those of the nonfimbriate strains Rd and 760705. With primers specific for the flanking genes purE and
pepN, PCR products were obtained for all strains. The
compositions of some of the products are schematically represented in
Fig. 8. The length of the insert varied from 256 to 1,098 bp. PCR
products of 256 bp were found for four of nine strains, including strain Rd and H. influenzae type b strain 760705. This
short product comprised the pur box and noncoding DNA. This
short stretch of DNA adjacent to pepN is indicated in Fig.
8. At the purE side, the sequence was highly conserved for
all strains until after the pur box. pur box
duplication, which was common for fimbria gene cluster-positive
strains, was also observed for two of the seven fimbria-negative
nonencapsulated strains tested. The sequence between the two
pur boxes consisted of an inverted repeat (strain 9814c) or
a direct repeat (strain 724) with a sequence similar to that of the
short repeats described above for the fimbria-positive strains. At the
pepN site, sequence conservation started just before
pepN. Noncoding DNA was found between pepN and
the pur box in five of nine strains. These inserts had
sequences similar to those of the inserts between purE and
hifA in strains with the fimbria gene cluster. In strain 27, an extra stretch of DNA flanked by direct repeated DNA was inserted in
the middle. None of these sequences aligned with the genome of strain
Rd significantly.
Fimbria cluster diversity is independent of genomic diversity.
To determine whether fimbria gene clusters occur in a subset
of genetically clustered H. influenzae strains,
H. influenzae strains were analyzed by RAPD based on
random PCRs. Separate amplifications with primers ERIC2, HPO1, and HPO2
resulted in three banding patterns that were sufficient for clonal
analysis. The results of the three PCR products are combined in Fig.
9 for all 18 of the strains included in
Fig. 8 (fimbriate and nonfimbriate). CLUSTAL analysis of the banding
patterns revealed the dendrogram depicted in Fig. 9. Fimbria gene
cluster-positive strains and strains with distinct compositions of the
region between purE and pepN were not clustered.

View larger version (24K):
[in this window]
[in a new window]
|
FIG. 9.
Dendrogram of the strains represented in Fig. 8 from a
combination of the RAPD results obtained by using primers ERIC2, HPO1,
and HPO2. Strain designations are indicated on the right. +,
fimbria-positive strains; , fimbria-negative strains with inserts
between purE and hifA. Abbreviations are
identified in the legend to Fig. 3.
|
|
 |
DISCUSSION |
Presence of fimbria genes.
LKP-4 fimbriae that recognize
sialoganglioside receptors occur in H. influenzae type
b and nonencapsulated H. influenzae strains (2, 5,
28-30, 40-42, 47) (this study). Here, we have shown that
fimbria gene cluster-positive strains contain all known fimbria genes
(hifA to hifE), since the DNAs of these strains
hybridized with probes for the individual genes and gene-specific PCR
products were obtained. PCRs of DNAs from positive strains with primers based on sequences of the genes flanking the gene cluster
(purE and pepN) revealed products that were large
enough to contain complete gene clusters in this region of the
H. influenzae chromosome (Fig. 8). Obviously,
truncation of any of the fimbria genes of the gene cluster is not very
likely to occur. In addition, this result shows that a fimbria gene
cluster is localized between purE and pepN in the
chromosome of each of the strains positive for fimbria genes. We cannot
exclude gene duplication of the fimbria gene cluster at another site in
the chromosome, as was observed for H. influenzae
biogroup aegyptius (33). However, this is unlikely, since
the sums of the lengths of the fragments hybridizing with the fimbria
gene cluster were rather similar for all strains and the hybridization
patterns were rather simple (Fig. 2).
hifA is the major subunit of the LKP-4 fimbriae of
H. influenzae that can mediate adherence to the
GM1-like receptor (
41,
50). The
hifA sequences of
three
H. influenzae strains from
chronic bronchitis
patients showed sequence divergence similar
to that previously
described for
H. influenzae type b and a
nonencapsulated
strain from an otitis media patient (
6,
10,
49). This sequence
divergence is probably responsible for the
antigenic differences
among LKP-4 fimbriae (
19,
23).
Previously, we and others have analyzed HifA sequences for the presence
of hydrophilic parts which may be involved in binding
to the
ganglioside GM1 receptor structure (
6,
10,
22,
49).
Three
hydrophilic domains were detected. These have been designated
I through
III and are shown in Fig.
5. The first domain is strongly
conserved.
Domains I and III can be excluded as binding domains
since the
conserved amino acids were also found in HifD, which
is not an adhesin
(
50). When we analyzed HifA sequences (Fig.
5) (
6,
10,
22,
47), some amino acids in the second and
third domains
appeared to be conserved. In domain II, five consecutive
amino acids
(Tyr-Phe-Tyr-Ser-Trp) were conserved. Since these
amino acids were
partly missing in HifD, which does not bind to
the receptor, these
amino acids may be part of the binding site.
However, these amino acids
are rather hydrophobic and the stretch
is rather short for a binding
domain. Interestingly,
H. influenzae biogroup aegyptius
fimbriae, which also bind to the ganglioside
receptor, have the same
conserved amino acids in domain II of
the major subunit
(
37).
Fimbriae as virulence factors for H. influenzae.
Independent of the clinical source, 18% of the nonencapsulated
H. influenzae strains examined had fimbria genes (Table
2). Bakaletz et al. (2) found that almost all of their
clinical isolates were fimbriate. Since the fimbriae on isolates varied in morphology, they may represent different types, as previously described (5). Combining their results with ours, we
conclude that LKP-4 fimbriae represent only one class of fimbriae on
nonencapsulated H. influenzae strains and that LKP-4
fimbriae are not disease-specific virulence factors. They may
contribute to the establishment of bacteria at the mucosal site of the
nasopharynx, but this may also be mediated by other adhesins, such as
other fimbriae (5), high-molecular-weight proteins
(3), and the Hap protein (38), which have
previously been implicated in the adherence of nonencapsulated H. influenzae strains to epithelial cells.
Expression of fimbriae and promoter composition.
None of the
clinical isolates tested expressed fimbriae, as determined by
hemagglutination. Since these strains were usually analyzed within five
subcultures from the primary plates of patient materials, it is
suggested that fimbriae are not expressed at the time the cultures were
taken. Since Farley et al. found a lower proportion of fimbriate
bacteria after mixed infection of nasopharyngeal organ cultures with
fimbriate and nonfimbriate bacteria (8), H. influenzae may lose its ability to express fimbriae after it
enters tissues. One of the characteristic features of infections in
chronic bronchitis patients is the penetration of bacteria into tissues
and establishment in subepithelial layers (14). In tissue,
the expression of fimbriae likely results in the binding of bacteria to
cells, thereby contributing to the clearance of bacteria (8,
54).
Fimbria-expressing bacteria were obtained from nonfimbriate cultures
(Fig.
6; Table
3), as has been previously observed for
H. influenzae type b (
29,
48). Expression of the fimbriae
of
H. influenzae type b was shown to occur when 10 to
12 TA repeats
were present in the bidirectional promoter of the gene
cluster,
located between
hifA and
hifB, and no
fimbriae were expressed
in the presence of 9 TA repeats
(
48). In the promoter regions
of nonencapsulated strains, an
increase from 9 to 10 TA repeats
coincided with fimbria expression.
Remarkably, one of five nonfimbriate
strains had only 4 TA repeats,
suggesting that this promoter was
seriously disturbed.
The numbers of fimbriae per cell for nonencapsulated strains were
smaller than those for the reference
H. influenzae type
b strain (Fig.
6; Table
3) and other
H. influenzae type
b strains
(
48). These results indicate that not only is the
number of
TA repeats in the promoter important for fimbria expression,
but
other DNA sequences either inside or outside the fimbria gene
cluster or other regulatory systems are involved.
Noncoding intergenic regions inside the gene cluster.
The
length of the region between the promoter and hifB varied
considerably among nonencapsulated H. influenzae
strains (Fig. 8). The diversity in length of these DNA stretches was
accompanied by strong sequence divergence (data not shown), most likely
indicating that this part of the gene cluster has been exchanged
between strains. In H. influenzae type b strain 770235, this part of the fimbria gene cluster is composed of multiple copies of
repetitive extragenic palindromic sequences organized head to tail. In
H. influenzae type b strain 770235, these structures
are fimbria gene cluster specific and have previously been suggested to
be important for the stabilization of mRNA by forming stem-loop
structures (15, 49). In nonencapsulated strains, we found
that the sequences of these regions diverged in most cases abruptly
where the palindromes started in H. influenzae type b
strain 770235, although they contained fragments of the corresponding
sequences of H. influenzae type b strain 770235. The
sequences seem to be specific for the fimbria gene cluster since no
continuous homology was found with any other region of the
H. influenzae genome (9) or any
sequence in the GenBank, EMBL, DDBJ, and PDB databases. The
extragenic sequences in nonencapsulated strains may influence the
expression levels of fimbriae, since the expression levels in
nonencapsulated H. influenzae strains appeared to be
lower than that in H. influenzae type b (Fig. 6; Table
3).
Sequences flanking the gene cluster.
Several regions flanking
the gene cluster are reminiscent of recombinational events. (i) The
duplication of the pur box and the adjacent 37 nucleotides
that are always observed at the 3' end of the fimbria gene cluster is
an indication that the fimbria gene cluster was inserted at this place
in the chromosome by recombination through the pur box. This
pur box duplication was observed for both H. influenzae type b and nonencapsulated strains. Since the G+C
content of the fimbria gene cluster (39%) is similar to that of the
H. influenzae genome (9, 20), the fimbria
gene cluster probably has a Haemophilus origin. (ii) Short
inverted repeats were observed adjacent to hifA and at the
5' ends of the fimbria gene clusters of nonencapsulated and
H. influenzae type b strains. These repeats may form
stem-loop structures, likely creating hairpins, which may be sites for
recombination, possibly contributing to the strong diversity observed
in hifA genes (Fig. 5). This type of exchange was not
observed among persistent strains from chronic bronchitis patients but
may have occurred in evolution by horizontal transfer.
The rather homologous noncoding regions between
hifA and
purE found in nonencapsulated
H. influenzae
strains have not been
observed in
H. influenzae type b
strain 770235 (
44). Since
H. influenzae type
b expresses fimbriae, this result indicates that
these sequences are
not essential for fimbria expression. The
flanking sequences were also
found in strains that lack the fimbria
genes. The function of this
stretch of DNA, which is full of stop
codons, is not clear. It may be
the remnants of a bacteriophage,
a transposase involved in the transfer
of genes, or even the fimbria
gene cluster. However, no homology was
found with any gene sequence
in the GenBank database. Unfortunately,
only one
H. influenzae bacteriophage sequence (HP1c)
has been published (
27).
Taken together, the data presented here suggest that the region between
purE and
pepN of the
H. influenzae chromosome is undergoing
insertion or deletion of the
fimbria gene cluster. The
pur box
region and the short
repeats adjacent to
hifA and at the
pepN site of
the cluster may be sites for recombination. Virulence
genes of
pathogenic bacteria, including those encoding adhesins,
have previously
been found on transmissible genetic elements,
such as transposons or
bacteriophages, or may be part of a pathogenicity
island
(
13,
25). Insertion elements, transposase sequences
that are characteristic of transposon-like elements, and bacteriophage
sequences have not been identified. Pathogenicity islands usually
comprise large DNA regions (often carrying more than one virulence
gene), have a G+C content different from that of the chromosome,
and
are often inserted in the chromosome adjacent to tRNA loci
(
13). Since the fimbria gene cluster of
H. influenzae does not
fulfill these criteria, it is unclear whether
the fimbria gene
cluster is on a transmissible element. However, the
absence of
clonal distribution of the fimbria gene cluster among
nonencapsulated
H. influenzae strains and the
concomitant presence or absence
of all fimbria genes point to a
mechanism that is responsible
for the transfer of the complete fimbria
gene cluster.
In conclusion, all of the fimbria genes of nonencapsulated
H. influenzae strains are either present or absent. The
organization
of the coding regions of the fimbria gene cluster is well
preserved.
The fimbria gene cluster is most likely contained on a
mobile
element. Noncoding regions are found between
purE and
hifA independently
of the presence of fimbria genes in
nonencapsulated
H. influenzae strains and are absent in
H. influenzae type b. The compositions
and sequences of
intergenic regions and the regions flanking the
gene cluster show
strong diversity. No changes in the lengths
of these regions are
observed during the persistence of
H. influenzae infection in patients.
 |
ACKNOWLEDGMENTS |
We thank Wiel Hoekstra, Peter van Ulsen, and Jörg Hacker
for comments and stimulating discussions; L. Spanjaard for help with
statistical analysis; Ilse Schuurman and B. Duim for technical assistance; and Wim van Est for artwork. The electron microscopy performed by Jacob van Marle was much appreciated.
F. Geluk was supported by Netherlands Asthma Foundation grant NAF
32.94.50.
 |
FOOTNOTES |
*
Corresponding author. Present address: Laboratory for
Vaccine Development and Mechanisms of Immunity, National Institute for Public Health and the Environment, P.O. Box 1, NL-3720 BA
Bilthoven, The Netherlands. Phone: 31-30-2742701. Fax:
31-30-2744429. E-mail: Loek.van.ALPHEN{at}RIVM.NL.
Present address: Netherlands Cancer Institute, Amsterdam, The
Netherlands.
Editor: J. G. Cannon
 |
REFERENCES |
| 1.
|
Akopyanz, N.,
N. O. Bukanov,
T. U. Westblom,
S. Kresovich, and D. E. Berg.
1992.
DNA diversity among clinical isolates of Helicobacter pylori detected by PCR based RAPD fingerprinting.
Nucleic Acids Res.
20:5137-5142[Abstract/Free Full Text].
|
| 2.
|
Bakaletz, L. O.,
B. M. Tallan,
T. Hoepf,
T. F. DeMaria,
H. G. Birck, and D. J. Lim.
1988.
Frequency of fimbriation of nontypeable Haemophilus influenzae and its ability to adhere to chinchilla and human respiratory epithelium.
Infect. Immun.
56:331-335[Abstract/Free Full Text].
|
| 3.
|
Barenkamp, S. J., and E. Leininger.
1992.
Cloning, expression, and DNA sequence analysis of genes encoding nontypeable Haemophilus influenzae high-molecular-weight surface-exposed proteins related to filamentous hemagglutinin of Bordetella pertussis.
Infect. Immun.
60:1302-1313[Abstract/Free Full Text].
|
| 4.
|
Boom, R.,
C. J. A. Sol,
M. M. M. Salimans,
C. L. Jansen,
P. M. E. Wertheim-van Dillen, and J. van der Noordaa.
1990.
Rapid and simple method for purification of nucleic acids.
J. Clin. Microbiol.
28:495-503[Abstract/Free Full Text].
|
| 5.
|
Brinton, C. C., Jr.,
M. J. Carter,
D. B. Derber,
S. Kar,
J. A. Kramarik,
A. C.-C. To,
S. C.-M. To, and S. W. Wood.
1989.
Design and development of pilus vaccines for Haemophilus influenzae diseases.
Pediatr. Infect. Dis. J.
8:S54-S61[Medline].
|
| 6.
|
Coleman, T.,
S. Grass, and R. Munson, Jr.
1991.
Molecular cloning, expression, and sequence of the pilin gene from nontypeable Haemophilus influenzae M37.
Infect. Immun.
59:1716-1722[Abstract/Free Full Text].
|
| 7.
|
Davies, J.,
I. Carlstedt,
A.-K. Nilsson,
A. Hakansson,
H. Sabharwal,
L. van Alphen,
M. van Ham, and C. Svanborg.
1995.
Binding of Haemophilus influenzae to purified mucins from the human respiratory tract.
Infect. Immun.
63:2485-2492[Abstract].
|
| 8.
|
Farley, M. M.,
D. S. Stephens,
S. L. Kaplan, and E. O. Mason, Jr.
1990.
Pilus- and non-pilus-mediated interactions of Haemophilus influenzae type b with human erythrocytes and human nasopharyngeal mucosa.
J. Infect. Dis.
161:274-280[Medline].
|
| 9.
|
Fleischmann, R. D.,
M. D. Adams,
O. White,
R. A. Clayton,
E. F. Krikness,
A. R. Kerlavage,
C. J. Bult,
J.-F. Tomb,
B. A. Bougherty,
J. M. Merrick,
K. McKenney,
G. Sutton,
W. Fitzhugh,
C. Fields,
J. D. Cocayne,
J. Scott,
R. Shirley,
L.-I. Lui,
A. Glodek,
J. M. Kelley,
J. F. Weidman,
C. A. Philips,
T. Spriggs,
E. Hedblom,
M. D. Cotton,
T. R. Utterback,
M. C. Hanna,
D. T. Nguyen,
D. M. Saudek,
R. C. Brandon,
L. D. Fine,
J. L. Frischman,
J. L. Fuhrmann,
N. S. M. Geoghagen,
C. L. Gnehm,
L. A. McDonald,
K. M. Small,
M. Fraser,
H. O. Smith, and J. C. Venter.
1995.
Whole-genome random sequencing and assembly of Haemophilus influenzae Rd.
Science
269:538-540[Abstract/Free Full Text].
|
| 10.
|
Forney, L. J.,
C. F. Marrs,
S. L. Bektesh, and J. R. Gilsdorf.
1991.
Comparison and analysis of the nucleotide sequences of pilin genes from Haemophilus influenzae type b strains Eagan and M43.
Infect. Immun.
59:1991-1996[Abstract/Free Full Text].
|
| 11.
|
Gilsdorf, J. R.,
K. McCrea, and L. Forney.
1990.
Conserved and nonconserved epitopes among Haemophilus influenzae type b pili.
Infect. Immun.
58:2252-2257[Abstract/Free Full Text].
|
| 12.
|
Groeneveld, K.,
L. van Alphen,
P. P. Eijk,
G. Visschers,
H. M. Jansen, and H. C. Zanen.
1990.
Endogenous and exogenous reinfections by Haemophilus influenzae in patients with chronic obstructive pulmonary disease; the effect of antibiotic treatment upon persistence.
J. Infect. Dis.
161:512-517[Medline].
|
| 13.
|
Hacker, J.,
G. Blum-Oehler,
I. Mühldorfer, and H. Tschäpe.
1997.
Pathogenicity islands of virulent bacteria: structure, function and impact on microbial evolution.
Mol. Microbiol.
23:1089-1097[Medline].
|
| 14.
|
Hers, J. F. P., and J. Mulder.
1953.
The mucosal epithelium of the respiratory tract in mucopurulent sputum caused by Haemophilus influenzae.
J. Pathol. Bacteriol.
66:103-108[Medline].
|
| 15.
|
Higgins, C. F.,
R. S. McLaren, and S. F. Newbury.
1988.
Repetitive, extragenic, palindromic sequences, mRNA stability and gene expression: evolution by gene conversion? a review.
Gene
72:3-14[Medline].
|
| 16.
|
Higgins, D. G., and P. M. Sharp.
1988.
CLUSTAL: a package for performing multiple sequence alignment on a microcomputer.
Gene
73:237-244[Medline].
|
| 17.
|
Holmgren, A.,
M. J. Kuehn,
C.-I. Brändén, and S. J. Hultgren.
1992.
Conserved immunoglobulin-like features in a family of periplasmic pilus chaperones in bacteria.
EMBO J.
11:1617-1622[Medline].
|
| 18.
|
Hopp, D., and K. R. Woods.
1981.
Prediction of protein antigenic determinants from amino acid sequences.
Proc. Natl. Acad. Sci. USA
78:3824-3828[Abstract/Free Full Text].
|
| 19.
|
Karasic, R. B.,
D. J. Beste,
S. C.-C. To,
W. J. Doyle,
S. W. Wood,
M. J. Carter,
A. C.-C. To,
K. Tanpowpong,
C. D. Bluestone, and C. C. Brinton.
1989.
Evaluation of pilus vaccines for prevention of experimental otitis media caused by nontypeable Haemophilus influenzae.
Pediatr. Infect. Dis. J.
8:S62-S65[Medline].
|
| 20.
|
Kilian, M., and E. L. Biberstein.
1984.
Haemophilus, p. 558-569. In
N. R. Krieg, and J. G. Holt (ed.), Bergey's manual of systematic bacteriology, vol. 1.
Williams and Wilkins Co., Baltimore, Md.
|
| 21.
|
Langenberg, W.,
E. A. J. Rauws,
A. Widjojokosumo,
G. N. J. Tytgat, and H. C. Zanen.
1986.
Identification of Campylobacter pyloridis isolates by restriction endonuclease DNA analysis.
J. Clin. Microbiol.
24:414-417[Abstract/Free Full Text].
|
| 22.
|
Langermann, S., and A. Wright.
1990.
Molecular analysis of the Haemophilus influenzae type b pilin gene.
Mol. Microbiol.
4:221-230[Medline].
|
| 23.
|
LiPuma, J. J., and J. R. Gilsdorf.
1988.
Structural and serological relatedness of Haemophilus influenzae type b pili.
Infect. Immun.
56:1051-1056[Abstract/Free Full Text].
|
| 24.
|
Loeb, M. R.,
E. Connor, and D. A. Penney.
1988.
A comparison of the adherence of fimbriated and nonfimbriated Haemophilus influenzae type b to human adenoids in organ culture.
Infect. Immun.
56:484-489[Abstract/Free Full Text].
|
| 25.
|
Morschhäuser, J.,
V. Vetter,
L. Emödy, and J. Hacker.
1994.
Adhesin regulatory genes within large, unstable DNA regions of pathogenic Escherichia coli: cross-talk between different adhesin gene clusters.
Mol. Microbiol.
11:555-566[Medline].
|
| 26.
|
Musser, J. M.,
S. J. Barenkamp,
D. M. Granoff, and R. K. Selander.
1986.
Genetic relationships of serologically nontypeable and serotype b strains of Haemophilus influenzae.
Infect. Immun.
52:183-191[Abstract/Free Full Text].
|
| 27.
|
Muthivhi, T. N.,
R. C. Gromkova,
P. E. Sharp, and H. J. Koornhof.
1991.
Lysogeny in encapsulated and nontypeable strains of Haemophilus influenzae.
Curr. Microbiol.
22:173-179.
|
| 28.
|
Pichichero, M. E.
1994.
Adherence of Haemophilus influenzae to human buccal and pharyngeal epithelial cells: relationship to piliation.
J. Med. Microbiol.
18:107-116[Abstract/Free Full Text].
|
| 29.
|
Pichichero, M. E.,
P. Anderson,
M. Loeb, and D. H. Smith.
1982.
Do pili play a role in pathogenicity of Haemophilus influenzae type b?
Lancet
ii:960-962.
|
| 30.
|
Poole, J., and L. van Alphen.
1988.
Haemophilus influenzae receptor and the AnWj antigen.
Transfusion
28:289[Medline].
|
| 31.
|
Porras, O.,
D. A. Caugant,
B. Gray,
T. Lagergard,
B. R. Levin, and C. Svanborg-Eden.
1986.
Difference in structure between type b and nontypeable Haemophilus influenzae populations.
Infect. Immun.
53:79-89[Abstract/Free Full Text].
|
| 32.
|
Read, R. C.,
A. A. Rutman,
P. K. Jeffery,
V. J. Lund,
A. P. Brain,
E. R. Moxon,
P. J. Cole, and R. Wilson.
1992.
Interaction of capsulate Haemophilus influenzae with human airway mucosa in vitro.
Infect. Immun.
60:3244-3252[Abstract/Free Full Text].
|
| 33.
|
Read, T. D.,
M. Dowdell,
S. W. Satola, and M. M. Farley.
1996.
Duplication of pilus gene complexes of Haemophilus influenzae biogroup aegyptius.
J. Bacteriol.
178:6564-6570[Abstract/Free Full Text].
|
| 34.
|
Sambrook, J.,
E. F. Fritsch, and T. Maniatis.
1989.
.
Molecular cloning: a laboratory manual, 2nd ed.
Cold Spring Harbor Laboratory, Cold Spring Harbor, N.Y.
|
| 35.
|
Stephens, D. S., and M. M. Farley.
1991.
Pathogenic events during infection of the human nasopharynx with Neisseria meningitidis and Haemophilus influenzae.
Rev. Infect. Dis.
13:22-33[Medline].
|
| 36.
|
Sterk, L. M. T.,
L. van Alphen,
L. Geelen-van den Broek, and H. J. Houthoff.
1991.
Differential binding of Haemophilus influenzae to human tissues by fimbriae.
J. Med. Microbiol.
35:129-138[Abstract/Free Full Text].
|
| 37.
|
St. Geme, J. W., III, and S. Falkow.
1993.
Isolation, expression, and nucleotide sequencing of the pilin structural gene of the Brazilian purpuric fever clone of Haemophilus influenzae biogroup aegyptius.
Infect. Immun.
61:2233-2237[Abstract/Free Full Text].
|
| 38.
|
St. Geme, J. W., III,
M. L. de la Morena, and S. Falkow.
1994.
A Haemophilus influenzae IgA-like protein promotes intimate interaction with human epithelial cells.
Mol. Microbiol.
14:217-233[Medline].
|
| 39.
|
van Alphen, L., and S. M. van Ham.
1994.
Adherence and invasion of Haemophilus influenzae.
Rev. Med. Microbiol.
5:245-255.
|
| 40.
|
van Alphen, L.,
J. Poole, and M. Overbeeke.
1986.
The Anton blood group antigen is the erythrocyte receptor for Haemophilus influenzae.
FEMS Microbiol. Lett.
37:69-71.
|
| 41.
|
van Alphen, L.,
L. Geelen-van den Broek,
L. Blaas,
M. van Ham, and J. Dankert.
1991.
Blocking of fimbria-mediated adherence of Haemophilus influenzae by sialyl gangliosides.
Infect. Immun.
59:4473-4477[Abstract/Free Full Text].
|
| 42.
|
van Alphen, L.,
N. van den Berghe, and L. Geelen-van den Broek.
1988.
Interaction of Haemophilus influenzae with human erythrocytes and oropharyngeal epithelial cells is mediated by a common fimbria epitope.
Infect. Immun.
56:1800-1806[Abstract/Free Full Text].
|
| 43.
|
van Alphen, L.,
D. Caugant,
B. Duim,
A. Regelink, and L. Bowler.
1997.
Differences in the genetic diversity of nonencapsulated Haemophilus influenzae from various diseases.
Microbiology (Reading)
143:1423-1431.
[Abstract/Free Full Text] |
| 44.
|
van Alphen, L.,
T. Riemens,
J. Poolman,
C. Hopman, and H. C. Zanen.
1983.
Homogeneity of cell envelope protein subtypes, lipopolysaccharide serotypes, and biotypes among Haemophilus influenzae from patients with meningitis in The Netherlands.
J. Infect. Dis.
148:75-80[Medline].
|
| 45.
|
van Belkum, A.,
B. Duim,
A. Regelink,
L. Möller,
W. Quint, and L. van Alphen.
1994.
Genomic DNA fingerprinting of clinical Haemophilus influenzae isolates by polymerase chain reaction (PCR) amplification: comparison to major outer membrane protein (MOMP) profiling and restriction fragment length polymorphism (RFLP) analysis.
J. Med. Microbiol.
41:63-68[Abstract/Free Full Text].
|
| 46.
|
van der Ende, A.,
E. A. J. Rauws,
M. Feller,
C. J. J. Mulder,
G. N. J. Tytgat, and J. Dankert.
1996.
Heterogeneous Helicobacter pylori strains from members of a family with a history of peptic ulcer disease.
Gastroenterology
111:638-647[Medline].
|
| 47.
|
van Ham, S. M.,
F. R. Mooi,
M. G. Sindhunata,
W. R. Maris, and L. van Alphen.
1989.
Cloning and expression in Escherichia coli of Haemophilus influenzae fimbria genes establishes adherence to oropharyngeal epithelial cells.
EMBO J.
11:3535-3540.
|
| 48.
|
van Ham, S. M.,
L. van Alphen,
F. R. Mooi, and J. P. M. van Putten.
1993.
Fimbria phase variation in Haemophilus influenzae is transcriptionally regulated by changes in the HifA promoter region.
Cell
73:1187-1196[Medline].
|
| 49.
|
van Ham, S. M.,
L. van Alphen,
F. R. Mooi, and J. P. M. van Putten.
1994.
The fimbria gene cluster of Haemophilus influenzae.
Mol. Microbiol.
13:673-684[Medline].
|
| 50.
|
van Ham, S. M.,
L. van Alphen,
F. R. Mooi, and J. P. M. van Putten.
1995.
Contribution of the major and minor subunits to fimbria-mediated adherence of Haemophilus influenzae to human epithelial cells and erythrocytes.
Infect. Immun.
63:4883-4889[Abstract].
|
| 51.
|
Versalovic, J.,
T. Koeuth, and J. R. Lupsky.
1991.
Distribution of repetitive DNA sequences in eubacteria and application to fingerprinting of bacterial genomes.
Nucleic Acids Res.
19:6823-6831[Abstract/Free Full Text].
|
| 52.
|
Virkola, R.,
K. Lähteenmäki,
T. Eberhard,
P. Kuusela,
L. van Alphen,
M. Ullberg, and T. Korhonen.
1996.
Interaction of Haemophilus influenzae with the mammalian extracellular matrix.
J. Infect. Dis.
173:1137-1147[Medline].
|
| 53.
|
Watson, W. J.,
J. R. Gilsdorf,
M. A. Tucci,
K. W. McCrea,
L. J. Forney, and C. F. Marrs.
1994.
Identification of a gene essential for piliation in Haemophilus influenzae type b with homology to the pilus assembly platform genes of gram-negative bacteria.
Infect. Immun.
62:468-475[Abstract/Free Full Text].
|
| 54.
|
Weber, A.,
K. Harris,
S. Lohrke,
L. Forney, and A. L. Smith.
1991.
Inability to express fimbriae results in impaired ability of Haemophilus influenzae b to colonize the nasopharynx.
Infect. Immun.
59:4724-4728[Abstract/Free Full Text].
|
| 55.
|
Wilson, R.,
R. Read, and P. Cole.
1992.
Interaction of Haemophilus influenzae with mucus, cilia, and respiratory epithelium.
J. Infect. Dis.
165:S100-S102.
|
Infect Immun, February 1998, p. 406-417, Vol. 66, No. 2
0019-9567/98/$04.00+0
Copyright © 1998, American Society for Microbiology. All rights reserved.
This article has been cited by other articles:
-
Erwin, A. L., Sandstedt, S. A., Bonthuis, P. J., Geelhood, J. L., Nelson, K. L., Unrath, W. C. T., Diggle, M. A., Theodore, M. J., Pleatman, C. R., Mothershed, E. A., Sacchi, C. T., Mayer, L. W., Gilsdorf, J. R., Smith, A. L.
(2008). Analysis of Genetic Relatedness of Haemophilus influenzae Isolates by Multilocus Sequence Typing. J. Bacteriol.
190: 1473-1483
[Abstract]
[Full Text]
-
Juliao, P. C., Marrs, C. F., Xie, J., Gilsdorf, J. R.
(2007). Histidine Auxotrophy in Commensal and Disease-Causing Nontypeable Haemophilus influenzae. J. Bacteriol.
189: 4994-5001
[Abstract]
[Full Text]
-
Ruer, S., Stender, S., Filloux, A., de Bentzmann, S.
(2007). Assembly of Fimbrial Structures in Pseudomonas aeruginosa: Functionality and Specificity of Chaperone-Usher Machineries. J. Bacteriol.
189: 3547-3555
[Abstract]
[Full Text]
-
Erwin, A. L., Nelson, K. L., Mhlanga-Mutangadura, T., Bonthuis, P. J., Geelhood, J. L., Morlin, G., Unrath, W. C. T., Campos, J., Crook, D. W., Farley, M. M., Henderson, F. W., Jacobs, R. F., Muhlemann, K., Satola, S. W., van Alphen, L., Golomb, M., Smith, A. L.
(2005). Characterization of Genetic and Phenotypic Diversity of Invasive Nontypeable Haemophilus influenzae. Infect. Immun.
73: 5853-5863
[Abstract]
[Full Text]
-
Ecevit, I. Z., McCrea, K. W., Pettigrew, M. M., Sen, A., Marrs, C. F., Gilsdorf, J. R.
(2004). Prevalence of the hifBC, hmw1A, hmw2A, hmwC, and hia Genes in Haemophilus influenzae Isolates. J. Clin. Microbiol.
42: 3065-3072
[Abstract]
[Full Text]
-
Gilsdorf, J. R., Marrs, C. F., Foxman, B.
(2004). Haemophilus influenzae: Genetic Variability and Natural Selection To Identify Virulence Factors. Infect. Immun.
72: 2457-2461
[Full Text]
-
Bruant, G., Watt, S., Quentin, R., Rosenau, A.
(2003). Typing of Nonencapsulated Haemophilus Strains by Repetitive-Element Sequence-Based PCR Using Intergenic Dyad Sequences. J. Clin. Microbiol.
41: 3473-3480
[Abstract]
[Full Text]
-
Bruant, G., Gousset, N., Quentin, R., Rosenau, A.
(2002). Fimbrial ghf Gene Cluster of Genital Strains of Haemophilus spp.. Infect. Immun.
70: 5438-5445
[Abstract]
[Full Text]
-
Clemans, D. L., Marrs, C. F., Bauer, R. J., Patel, M., Gilsdorf, J. R.
(2001). Analysis of Pilus Adhesins from Haemophilus influenzae Biotype IV Strains. Infect. Immun.
69: 7010-7019
[Abstract]
[Full Text]
-
Davis, J., Smith, A. L., Hughes, W. R., Golomb, M.
(2001). Evolution of an Autotransporter: Domain Shuffling and Lateral Transfer from Pathogenic Haemophilus to Neisseria. J. Bacteriol.
183: 4626-4635
[Abstract]
[Full Text]
-
Read, T. D., Satola, S. W., Farley, M. M.
(2000). Nucleotide Sequence Analysis of Hypervariable Junctions of Haemophilus influenzae Pilus Gene Clusters. Infect. Immun.
68: 6896-6902
[Abstract]
[Full Text]
-
Cerquetti, M., Ciofi degli Atti, M. L., Renna, G., Tozzi, A. E., Garlaschi, M. L., Mastrantonio, P., The Hi Study Group,
(2000). Characterization of Non-Type B Haemophilus influenzae Strains Isolated from Patients with Invasive Disease. J. Clin. Microbiol.
38: 4649-4652
[Abstract]
[Full Text]
-
van Schilfgaarde, M., van Ulsen, P., Eijk, P., Brand, M., Stam, M., Kouame, J., van Alphen, L., Dankert, J.
(2000). Characterization of Adherence of Nontypeable Haemophilus influenzae to Human Epithelial Cells. Infect. Immun.
68: 4658-4665
[Abstract]
[Full Text]
-
Dawid, S., Barenkamp, S. J., St. Geme, J. W. III
(1999). Variation in expression of the Haemophilus influenzae HMW adhesins: A prokaryotic system reminiscent of eukaryotes. Proc. Natl. Acad. Sci. USA
96: 1077-1082
[Abstract]
[Full Text]
-
Gousset, N., Rosenau, A., Sizaret, P.-Y., Quentin, R.
(1999). Nucleotide Sequences of Genes Coding for Fimbrial Proteins in a Cryptic Genospecies of Haemophilus spp. Isolated from Neonatal and Genital Tract Infections. Infect. Immun.
67: 8-15
[Abstract]
[Full Text]
-
Krasan, G. P., Cutter, D., Block, S. L., St. Geme, J. W. III
(1999). Adhesin Expression in Matched Nasopharyngeal and Middle Ear Isolates of Nontypeable Haemophilus influenzae from Children with Acute Otitis Media. Infect. Immun.
67: 449-454
[Abstract]
[Full Text]
-
McCrea, K. W., St. Sauver, J. L., Marrs, C. F., Clemans, D., Gilsdorf, J. R.
(1998). Immunologic and Structural Relationships of the Minor Pilus Subunits among Haemophilus influenzae Isolates. Infect. Immun.
66: 4788-4796
[Abstract]
[Full Text]
-
Mhlanga-Mutangadura, T., Morlin, G., Smith, A. L., Eisenstark, A., Golomb, M.
(1998). Evolution of the Major Pilus Gene Cluster of Haemophilus influenzae. J. Bacteriol.
180: 4693-4703
[Abstract]
[Full Text]