Previous Article | Next Article ![]()
Infect Immun, February 1998, p. 418-423, Vol. 66, No. 2
CEA, Départment d'Ingénierie et
d'Etudes des Protéines, Centre d'Etudes de Saclay, 91191 Gif-sur-Yvette Cedex, France
Received 14 July 1997/Returned for modification 4 September
1997/Accepted 4 November 1997
Two recombinant fragments of diphtheria toxin (DT) were fused to an
engineered tandem repeat of the immunoglobulin (Ig) binding domain of
protein A, called ZZ. These fragments are (i) the receptor binding
domain (DTR), which comprises amino acids 382 to 535 of DT, and (ii) a
linear peptide (DT168-220) which comprises residues 168 to
220 of the loop between fragment A and fragment B of DT. The fusion
proteins were produced in Escherichia coli and purified by
affinity chromatography. In vitro experiments showed that the DTR
domain is responsible for the capacity of ZZ-DTR to bind to Vero cells
and is capable of inhibiting the cytotoxicity of DT for these cells.
These findings suggest that DTR binds to the cell surface receptors of
DT and hence adopts a conformation that is similar to that of the
receptor binding domain of DT. We compared the capacities of ZZ-DTR,
ZZ-DT168-220, and a chemically detoxified form of DT
currently used for vaccination to elicit antibodies in rabbits. The
toxoid was more immunogenic than ZZ-DT168-220, which in
turn was more immunogenic than ZZ-DTR. However,
ZZ-DT168-220 antiserum was poorly efficient at
neutralizing DT cytotoxicity on Vero cells, whereas ZZ-DTR antiserum
was only 15-fold less potent than anti-DT antisera.
With the advent of genetic
manipulations, a number of recombinant proteins have been successfully
designed as appropriate vaccines (21, 27). Various
improvements, including the production of proteins which cannot be
readily purified from natural sources and the development of a small
and selected number of amino acid substitutions to detoxify the
original proteins, have been thus introduced (4, 5, 12).
There are, however, additional advantages which may contribute to
increase the number and quality of recombinant vaccines. In principle,
recombinant technology offers the possibility to generate fragments of
proteins which may be structurally organized as domains and which may
lack any toxicity. Another advantage offered by genetic manipulations
consists of the possibility of fusing an immunogen with a protein
capable of increasing the immunogenicity of the fused partner. The
present work aims at investigating the consequences of combining these two potential advantages in the case of diphtheria toxin (DT).
DT is an Mr-58,342 exotoxin synthesized as a
single polypeptide. After proteolytic cleavage, the amino-terminal
fragment A (Mr, 21,150) and the carboxy-terminal
fragment B (Mr, 37,200) remain linked via a
single disulfide bond (26). The crystallographic structure
of DT (6, 7) reveals the presence of three functional domains. The catalytic domain (C domain) is located in fragment A, the
translocation domain (T domain) is located in the N-terminal part of
fragment B, and the receptor binding domain (R domain) is located in
the carboxy-terminal region of fragment B. The toxin is known to target
cell surface receptors via its R domain; then the toxin is internalized
by receptor-mediated endocytosis and fragment A is translocated into
the cytosol. Once in the cytosol, fragment A blocks protein synthesis
by causing an ADP-ribosylation of elongation factor 2, thus provoking
cell death.
A number of DT regions have been shown to elicit neutralizing anti-DT
antibodies. These include the whole R domain (amino acids [aa] 382 to
535) (8, 14, 28, 29, 37-39) and the smaller loop connecting
the A and B fragments (aa 188 to 201) (2). We therefore
tentatively expressed the DT receptor binding domain, called DTR, and
the fragment from aa 168 to 220 (DT168-220), which
overlaps the loop region, in Escherichia coli. These
fragments were fused individually with the tandem repeat dimer of a
modified immunoglobulin (Ig) binding domain of protein A from
Staphylococcus aureus, called ZZ (24). This
particular fusion moiety was chosen due to the previous observations
that (i) the presence of an Ig binding domain associated with an
expressed protein offers a simple and efficient means to extract and
purify the protein from bacterial media, using IgG affinity
chromatography (22, 23), and (ii) ZZ often increases
immunogenicity of the fused partner (11, 17-19, 22, 35),
presumably by enhancing its presentation to specific T cells
(16).
The aim of this work was to investigate the immunogenic properties of
the ZZ-DTR and ZZ-DT168-220 fusion proteins in rabbits and
to examine the capacity of the elicited antibodies to neutralize DT,
using an in vitro assay (39). The two hybrid proteins were
cloned, produced in the cytoplasm of E. coli, and purified.
Furthermore, the biological activity of ZZ-DTR was examined by
determining its ability to (i) protect Vero cells from cytotoxic effects of DT and (ii) bind to DT receptors on Vero cells by its DTR
moiety.
Genetic construction of ZZ fusion proteins.
Plasmid pK5DT,
coding for DT, was kindly provided by Patrice Boquet (Sophia Antipolis,
France). All DNA manipulations were performed as described by Sambrook
et al. (31). Using PCR, a SalI site and a
BamHI site were created at the 5' end and the 3' end,
respectively, of the nucleotide sequence of the DTR domain. Plasmid
pK5DT was used as the template, and the following single-stranded oligonucleotides were used as primers: SalI site,
5'GGGACTGCAGGTACCGTCGACGCCGGGTCACAAAACGCAA3'; and
BamHI site,
5'GGGACTGCAGGATCCTTATAAGCTTCCGCTTTTGATTTCAAAAAATAG3'. Restriction sites are indicated in boldface; the stop codon is underlined. Oligonucleotides used in PCR were synthesized in an Applied
Biosystems DNA synthesizer.
0019-9567/98/$04.00+0
Copyright © 1998, American Society for Microbiology. All rights reserved.
Towards a Recombinant Vaccine against
Diphtheria Toxin

![]()
ABSTRACT
Top
Abstract
Introduction
Materials & Methods
Results
Discussion
References
![]()
INTRODUCTION
Top
Abstract
Introduction
Materials & Methods
Results
Discussion
References
![]()
MATERIALS AND METHODS
Top
Abstract
Introduction
Materials & Methods
Results
Discussion
References
Production and purification.
E. coli BL21(DE3)LysS was
used as the host for the expression of ZZ-DTR and
ZZ-DT168-220. Freshly transformed cells were grown in 100 ml of tryptic soy broth (Difco, Detroit, Mich.) supplemented with
glucose (5 g/liter), ampicillin (200 µg/ml), and chloramphenicol (30 µg/ml). The cells from a 60-ml overnight culture at 37°C were used
to inoculate a 3-liter fermentor (Chemap; B. Braun Sciencetec, Les
Ulis, France) containing the same medium as in the preculture. Cells
were incubated at 37°C under aeration until the optical density at
600 nm reached 0.5 to 1. Then
isopropyl-
-D-thiogalactopyranoside (IPTG) was added to
0.5 mM (final concentration); after 3 h of induction, the cells
were harvested by centrifugation (5,000 × g for 15 min), resuspended in lysis buffer (30 mM Tris, 5 mM EDTA, 20% sucrose
[pH 8]), and disrupted with an Eaton press. The supernatant containing the fusion protein was purified on an IgG-Sepharose 4B
column (Pharmacia Biotech Inc., Uppsala, Sweden); 10 ml of the crude
extract was incubated overnight at 4°C with 10 ml of IgG-Sepharose
equilibrated in 50 mM Tris-HCl buffer (pH 7.6)-150 mM NaCl-0.05%
Tween 20. After a wash with 10 bed volumes of the equilibration buffer,
2 bed volumes of 5 mM ammonium acetate (NH4Ac; pH 5.0) was
passed through the column. The bound protein was then eluted with 0.5 M
hydrogen acetate (pH 3.4) and immediately neutralized with 1 M Tris-HCl
buffer (pH 8). The ZZ-DTR-containing fraction was concentrated at 4 mg/ml by ultrafiltration on Microsep 30 (Filtron, Northborough, Mass.)
and used for experiments without further purification.
ZZ-DT168-220 eluted from the IgG column was further
purified with a Mono S ion-exchange column (Pharmacia Biotech)
equilibrated with 10 mM NH4Ac (pH 5.1). The hybrid was eluted with a linear gradient ranging from 10 mM to 1.5 M
NH4Ac (pH 5.1). Protein concentration was determined
spectrophotometrically, based on the calculated extinction coefficient
at 275 nm (
M = 12,940 for ZZ-DTR and
M = 11,460 for ZZ-DT168-220).
PAGE and Western blot analysis. The samples were analyzed by polyacrylamide gel electrophoresis (PAGE) in a sodium dodecyl sulfate (SDS)-20% polyacrylamide gel, using the PHAST system (Pharmacia Biotech), and their purity was estimated after Coomassie blue staining of the gel.
For Western blot experiments, ZZ-DTR and ZZ-DT168-220 fractions were subjected to SDS-PAGE on a 15% polyacrylamide gel (8 by 5 cm; Minirad) and transferred onto polyvinylidene difluoride membranes (Millipore, Bedford, Mass.). Membranes were then incubated with a 1/2,000 dilution of horse anti-DT antisera (Pasteur Vaccin, Ville d'Avray, France) for 1 h at room temperature. Binding of the antibodies to the DT moiety was revealed by using F(ab')2 rabbit anti-horse IgG conjugated to horseradish peroxidase (Jackson Immunoresearch, West Grove, Pa.) and diaminobenzidine (Sigma, St. Quentin Fallavier, France) as substrate.ELISA. Microtiter enzyme-linked immunosorbent assay (ELISA) plates were coated overnight at 4°C with either rabbit IgG, DT (Calbiochem, La Jolla, Calif.), or the fusion proteins (each at 1 µg/well) in a 50 mM Tris-HCl buffer (pH 7.4). Plates were subsequently saturated with 0.1 M Tris-HCl (pH 7.4) containing 0.3% casein. Before use, plates were washed five times with 0.01 M Tris-HCl (pH 7.4)-0.05% Tween 20. The fusion proteins and the antibodies were diluted in 0.1 M Tris-HCl (pH 7.4) containing 0.1% casein.
(i) Antigenicity of ZZ-DTR and ZZ-DT168-220. Rabbit IgG-coated wells were incubated overnight at 4°C with 100 µl of either ZZ-DTR, ZZ-DT168-220, or ZZ at a concentration of 2.3 µg/ml and washed as described above; 100 µl of a horse anti-DT antiserum diluted 1/1,000 (Pasteur Vaccin) was added, and the mixture was incubated for 3 h at room temperature (RT). After a washing step, 100 µl of a goat F(ab')2 anti-horse antibody conjugated to alkaline phosphatase (Jackson Immunoresearch) diluted 1/5,000 was added, and the mixture was incubated for 30 min at RT. Finally, 200 µl of substrate-containing buffer (0.1 M Tris-HCl [pH 8.2], 2 M NaCl, 1 mM MgCl2, 0.1 mM ZnCl2, 3 mM triethylamine, 10 mM p-nitrophenylphosphate [Amresco, Solon, Ohio]) was added, and the plates were read after 4 h at RT in a Titertek Multiskan MCC/340 spectrophotometer at 414 nm.
(ii) Determination of anti-DT titer. DT-coated plates were washed, and serial dilutions of the different rabbit antisera were added and incubated overnight at 4°C. The plates were then washed, and goat F(ab')2 anti-rabbit IgG antibody conjugated to alkaline phosphatase was added in a dilution of 1/5,000 for 30 min at RT. After incubation and washing, p-nitrophenylphosphate was added to each well, and the absorbance at 414 nm was read after 60 min. The titer was defined as the highest serum dilution giving an absorbance value of 0.6 at 414 nm after 60 min, above the negative control. As a control, we used nonimmune rabbit sera.
Assay of binding of ZZ-DTR to Vero cells.
Vero cells (kindly
provided by Patrice Boquet) were grown in 250-ml culture flasks
(Falcon) at 37°C in Dulbecco modified Eagle medium (DMEM; Biological
Industries, Rehovot, Israel) supplemented with 10% fetal calf serum
(without
-mercaptoethanol). Cells were passaged at confluency. Vero
cells were detached from the flasks for experimental seeding by
incubation in a 0.02% trypsin-0.05% EDTA solution (Biological
Industries).
Immunization.
The immunogenicity of ZZ-DTR,
ZZ-DT168-220, and the diphtheria toxoid (Dtx; Pasteur
Mérieux, Marcy l'Etoile, France) was tested in Blanc du Bouscat
rabbits (2 kg, male) in two independent immunization schemes. In one
case, 1.5 ml of PBS (Biological Industries) containing 4.65 × 10
5 M ZZ-DTR, ZZ-DT168-220, or Dtx was mixed
with 1.5 ml of complete Freund's adjuvant (Difco) for the first
injection. Incomplete Freund's adjuvant was used for the subsequent
immunizations. In the second immunization scheme, 6.26 × 10
5 M ZZ-DTR or Dtx in 1.25 ml of PBS was mixed with 1.25 ml of aluminum hydroxide (Pierce, Rockford, Ill.). For all three
immunizations, 1 ml with the indicated concentration per rabbit was
injected subcutaneously.
Vero cell neutralization assay.
Sera from rabbits immunized
with ZZ-DTR, ZZ-DT168-220, or Dtx were serially diluted in
DMEM containing 10
10 M DT and incubated overnight at
4°C. Samples were then added to 96-microfilter-well plates (MADV N65;
Millipore) at 50 µl/well in the presence of Vero cells (3 × 104/well). After 3.5 h at 37°C, the cells were
washed to remove unbound protein by using the Millipore multiscreen
assay system, and the incorporation of [14C]Leu was
measured as described for the assessment of the inhibition of DT
cytotoxicity by ZZ-DTR. The neutralizing titer is expressed as the
dilution of antiserum giving 50% inhibition of the cytotoxicity of
10
10 M DT.
| |
RESULTS |
|---|
|
|
|---|
Preparation of recombinant ZZ-DTR and ZZ-DT168-220. Two nonoverlapping regions of DT were selected for this study. One of them, called DTR, corresponds to the region (aa 382 to 535), by which DT binds to cell surface receptors. The recent resolution of the three-dimensional structure of DT indicates that this region is structurally organized as a domain (6, 7) which therefore was anticipated to fold independently in a native-like structure. Several studies showed that numerous neutralizing MAbs raised against DT are directed against the R domain (8, 14, 28, 29, 37-39). Furthermore, a recent work showed that the R domain of DT can be a potential immunogen (13). The second region (aa 168 to 220) overlaps the loop that connects fragments A and B. Audibert et al. (2) have demonstrated that immunization of guinea pigs with peptide 188-201 elicits antibodies that bind to the toxin and neutralize its dermonecrotic effect. In addition, Zucker and Murphy (38) have shown that some of the anti-DT antibodies which recognize the C terminus of fragment A are protective. However, the loop region is described as being poorly antigenic (3). Therefore, we selected a longer sequence (aa 168 to 220) in order to include helix 7 of the C domain and helix 1 of the T domain, which may favor the structural stabilization of the segment.
Using PCR, we cloned the sequences encoding DTR and DT168-220 in the pCP vector (10); the recombinant peptides were thus fused to the C terminus of ZZ, a synthetic repeat of the Ig binding domain of protein A from S. aureus (24). Since ZZ was not preceded by a signal sequence, the induction of the system led to the synthesis of ZZ-DTR or ZZ-DT168-220 fusion proteins in cytoplasm of E. coli. Two major proteins migrating at 32 and 22 kDa were detected by SDS-PAGE in the soluble fractions following inductions (Fig. 1, lanes 2 and 5). They have the expected molecular weights for ZZ-DTR and ZZ- DT168-220, respectively. The fractions were centrifuged and applied to an IgG-Sepharose 4B column. ZZ-DT168-220 was further purified on a Mono S column to eliminate the low-molecular-weight components which can be seen in the IgG-Sepharose-purified fraction. SDS-PAGE of the purified fractions is shown in Fig. 1. Approximately 60 mg of ZZ-DTR and 12 mg of ZZ-DT168-220 were obtained per liter of culture.
|
Immunological characterization of ZZ-DTR and ZZ- DT168-220. We first estimated the antigenicity of the recombinant hybrid proteins by Western blotting using a horse anti-DT antiserum (data not shown). Equine Igs were used since they are 100-fold less efficient than rabbit Igs at binding to protein A (15) and hence to the ZZ moiety of the hybrids. Thus, only the DT part of the hybrid could be revealed with this antiserum. A major protein band located at 32 kDa, which corresponds to the calculated molecular mass of ZZ-DTR, was observed in Western blots. In contrast, in the same conditions, only a faint band corresponding to the calculated molecular weight of ZZ-DT168-220 could be observed.
To further evaluate the antigenicity of the recombinant hybrids, we submitted them to an ELISA in which microtiter plates were coated with rabbit IgG (data not shown). Similar concentrations of ZZ-DTR and ZZ-DT168-220 were added to the wells, and after incubation for 3 h, the plates were washed. The DTR and DT168-220 domains of the two hybrids bound by their ZZ domain to coated rabbit IgGs were detected by using a horse anti-DT serum and a goat anti-horse antibody conjugated to a colorimetric enzyme. A clear coloration was found for ZZ-DTR (743 ± 6 mU of DO), whereas the coloration observed for ZZ-DT168-220 was quite weak and similar to that of ZZ (241 ± 4 and 236 ± 21 mU of DO, respectively). Therefore, only ZZ-DTR cross-reacted with DT antisera.Binding of ZZ-DTR to Vero cells. Previous results have shown that the binding of DT to its cell surface receptor is mediated via the R domain (30). To assess whether ZZ-DTR is also able to bind to the DT receptor, we performed a fluorescence-activated cell sorting analysis. ZZ and ZZ-DTR were complexed with MAb-FITC, and binding of the two complexes to Vero cells was investigated after a 30-min incubation at 4°C. As shown in Fig. 2, a shift in the fluorescence intensity of Vero cells was observed with ZZ-DTR/MAb-FITC, while no change was observed with either MAb-FITC alone or ZZ/MAb-FITC. Though this experiment does not tell us if DTR binds to DT receptors, it demonstrates that binding of ZZ-DTR to Vero cells is uniquely due to the DTR moiety. However, further data (Fig. 3) demonstrate that ZZ-DTR is efficient at inhibiting the cytotoxic capacity of DT. Thus, approximately 10 times more DT is required to kill 50% of the Vero cells when 20 nM ZZ-DTR is present in the wells. A control experiment revealed that the presence of an excess of free ZZ does not affect DT cytotoxicity, indicating that the inhibitory effect of the hybrid is specifically associated with the DTR domain. Furthermore, the inhibitory potency of ZZ-DTR is similar to that obtained with CRM197, a nontoxic mutant of DT which is devoid of any enzymatic activity but retains its binding property (20). In aggregate, therefore, our data suggest that the DTR moiety of ZZ-DTR contains sufficient structural information to specifically and efficiently recognize the DT receptor on Vero cells. As a consequence, the DTR domain is likely to be folded similarly in both the ZZ-DTR hybrid and native DT.
|
|
Immunogenicity of fused DT fragment. We investigated the ability of ZZ-DTR, ZZ-DT168-220 and Dtx (a toxoid of DT that is currently used in anti-DT vaccination) emulsified in Freund's adjuvant, or ZZ-DTR and Dtx emulsified in aluminum hydroxide, to elicit a humoral immune response in rabbits. The rabbits were immunized three times, and blood samples were collected after the last immunization. The antisera were subsequently tested for the capacity to bind to DT coated on microtiter ELISA plates. ZZ-DTR elicited anti-DT titers which varied between either 1/300 and 1/1,500 or 1/400 and 1/3,000, depending on the immunization scheme (Fig. 4). The immunogenicity of ZZ-DT168-220 was substantially higher since in the presence of Freund's adjuvant, titers of 1/4,900 and 1/38,000 were obtained with the two rabbits. Clearly, Dtx displayed the highest titers, which, however, were nearly 30-fold lower when immunization was performed with aluminum hydroxide rather than Freund's adjuvant.
|
Neutralization of cytotoxicity.
The neutralizing potencies of
antisera raised in rabbits against ZZ-DTR, ZZ-DT168-220,
and Dtx were tested in vitro, using toxin-sensitive Vero cells. DT was
incubated at a concentration of 10
10 M in the presence of
various dilutions of the different sera, and the mixtures were added to
the Vero cells. The cells were assayed for [14C]Leu
incorporation into TCA-precipitable material. Neutralization by immune
sera is given as a function of antibody units, which compensates for
the differences between the anti-DT titers for each antiserum. As shown
in Fig. 5, the antibodies raised against ZZ-DT168-220 are poorly neutralizing whereas the
antibodies raised against ZZ-DTR with aluminum hydroxide as adjuvant
exerted a substantial neutralizing activity. A higher neutralizing
potency was observed with antisera raised against Dtx injected with
aluminum hydroxide; the ratio of neutralization was approximately
15-fold higher than that obtained with anti-ZZ-DTR.
|
| |
DISCUSSION |
|---|
|
|
|---|
The production of efficient vaccines corresponding to a fragment of a protein still remains a challenge. Part of the difficulty resides in the necessity of producing the selected protein fragment in a structure that resembles the conformation adopted by the same fragment in the cognate protein (25). In this respect, the genetic approach makes it possible to produce large protein fragments which may be structurally organized as domains. In this work, we described the production of two recombinant fragments of DT fused with a synthetic Ig binding domain of protein A, called ZZ. These fragments show distinct immunological properties.
DT168-220 was chosen since peptide 188-201 was previously described to constitute a potentially interesting synthetic vaccine (2). We found that ZZ-DT168-220 has a poor capacity to bind to horse anti-DT antibodies, in agreement with a previous report concerning the antigenicity of this region (3). Several reasons can explain this behavior, including the possibility that (i) DT168-220 has a few reactive antigenic sites, (ii) this region is poorly immunogenic when DT is used as an immunogen, and/or (iii) the conformation of this region differs in the hybrid and in the native protein. At present, we cannot determine which of these possibilities prevails. However, a rather high immunogenic response was obtained when ZZ-DT168-220 was injected in rabbits, since anti-ZZ-DT168-220 antisera displayed a substantial capacity to bind to coated DT. However, despite their high antibody titer, the antisera poorly neutralize the capacity of DT to kill Vero cells. These results suggest that ZZ-DT168-220 does not constitute a potential vaccine.
The biological and immunological results obtained with ZZ-DTR are more promising. DTR is the domain by which DT recognizes its cell surface receptors (6, 7) and to which numerous neutralizing anti-DT antibodies are directed (38). We have seen that purified ZZ-DTR is well recognized by horse anti-DT antibodies and can bind to Vero cells. Furthermore, competition experiments performed with Vero cells revealed that ZZ-DTR inhibits competitively DT cytotoxicity, and this inhibition is as efficient as that observed with CRM197, a nontoxic mutant of DT which retains its full binding property (20). These observations suggest that the R domain of ZZ-DTR is likely to bind to DT receptors as efficiently as DT and hence to adopt a folding that is similar, if not identical, in the hybrid and native toxins. This hypothesis is further supported by the observation that anti-ZZ-DTR antisera bind to coated DT and neutralize in vitro DT cytotoxicity to Vero cells. Interestingly, a higher titer of anti-ZZ-DTR antiserum was obtained upon immunization in rabbits by using aluminum hydroxide, an adjuvant that is commonly used in human vaccination. Altogether, these results suggest that fusion of an Ig binding region of protein A to the amino-terminal end of the R domain of DT hampers neither its receptor binding activity nor its ability to elicit neutralizing antibodies.
However, one cannot yet conclude that the ZZ-DTR hybrid constitutes an appropriate vaccine against diphtheria. First, it remains to be demonstrated that rabbits immunized with ZZ-DTR are protected against DT. Second, our comparative analysis of antisera revealed that the commercial DTx elicits antisera with higher anti-DT titers and higher neutralizing potency compared to ZZ-DTR. Third, the ZZ moiety can bind to rabbit IgGs, and the immunization with such a fusion protein may potentially elicit an anti-IgG immune response. These issues raised the question of how to control DTR immunogenicity. One way might be to use other fusion proteins (34) or to introduce additional T-cell epitopes to the hybrid (19). A number of hybrid proteins have been recently described in the field of vaccine development. Barbieri et al. (4) have reported a fusion protein consisting of fragment A of DT and the S1 subunit of pertussis toxin. Antisera raised against this hybrid were neutralizing for both toxins. Boucher et al. (9) have added protective epitopes to a fusion protein (p75) comprising the pertussis toxin S1 subunit and the protective fragment C of tetanus toxin. The recombinant protein retained the biological activities of both toxin parts and elicited neutralizing antibody. Another approach may consist of using other adjuvants, like muramyl dipeptide (1). Finally, one may also envision the possibility of producing bacteria displaying heterologous proteins on their surface, such as the gram-positive bacterium Staphylococcus carnosus (32).
| |
ACKNOWLEDGMENTS |
|---|
We gratefully acknowledge Jérome Galon for assistance with FACS analysis. We thank P. Boquet for his gift of plasmid pK5DT.
| |
FOOTNOTES |
|---|
* Corresponding author. Mailing address: CEA, Départment d'Ingénierie et d'Etudes des Protéines, Centre d'Etudes de Saclay, 91191 Gif-sur-Yvette Cedex, France. Phone: 33 01 69 08 26 03. Fax: 33 01 69 08 90 71. E-mail: andre.menez{at}cea.fr.
Present address: Unfereggweg 5, CH-4147 Aesch BL, Switzerland.
Editor: J. T. Barbieri
| |
REFERENCES |
|---|
|
|
|---|
| 1. | Ada, G. L. 1993. Vaccines, p. 1309-1352. In W. E. Paul (ed.), Fundamental immunology. Raven Press Ltd., New York, N.Y. |
| 2. | Audibert, F., M. Jolivet, L. Chedid, J. E. Alouf, P. Boquet, P. Rivaille, and O. Siffert. 1981. Active antitoxic immunization by a diphtheria toxin synthetic oligopeptide. Nature 289:593-594[Medline]. |
| 3. | Autran, B., F. Triebel, M. Viguier, M. Jolivet, P. Falmagne, and P. Debre. 1987. Monoclonal B-cell response to diphtheria toxoid: evidence for cross-reactive epitopes. Immunology 60:531-538[Medline]. |
| 4. |
Barbieri, J. T.,
D. Armellini,
J. Molkentin, and R. Rappuoli.
1992.
Construction of a diphtheria toxin A fragment-C180 peptide fusion protein which elicits a neutralizing antibody response against diphtheria toxin and pertussis toxin.
Infect. Immun.
60:5071-5077 |
| 5. | Beachey, E. H., J. M. Seyer, J. B. Dale, W. A. Simpson, and A. Kang. 1981. Type specific protective immunity evoked by synthetic peptide of Streptococcus pyogenes M protein. Nature 292:457[Medline]. |
| 6. | Bennett, M. J., S. Choe, and D. Eisenberg. 1994. Refined structure of dimeric diphtheria toxin at 2.3 Å resolution. Protein Sci. 3:1444-1463[Medline]. |
| 7. | Bennett, M. J., and D. Eisenberg. 1994. Refined structure of monomeric diphtheria toxin at 2.3 Å resolution. Protein Sci. 3:1464-1475[Medline]. |
| 8. | Bigio, M., R. Rossi, D. Nucci, G. Antoni, R. Rappuoli, and G. Ratti. 1987. Conformational changes in diphtheria toxoids. Analysis with monoclonal antibodies. FEBS Lett. 218:271-276[Medline]. |
| 9. |
Boucher, P.,
H. Sato,
Y. Sato, and C. Locht.
1994.
Neutralizing antibodies and immunoprotection against pertussis and tetanus obtained by use of a recombinant pertussis toxin-tetanus toxin fusion protein.
Infect. Immun.
62:449-456 |
| 10. | Drevet, P., C. Lemaire, S. Gasparini, S. Zinn-Justin, E. Lajeunesse, F. Ducancel, S. Pinkasfeld, M. Courçon, J. C. Boulain, and A. Ménez. 1997. High level production and isotope labelling of snake neurotoxins, disulphide rich proteins. Protein Expression Purif. 10:293-300[Medline]. |
| 11. |
Ducancel, F.,
J. C. Boulain,
O. Tremeau, and A. Ménez.
1989.
Direct expression in Escherichia coli of a functionally active protein A-snake toxin fusion protein.
Protein Eng.
3:139-143 |
| 12. | Fromen-Romano, C., B. Maillère, P. Drevet, E. Lajeunesse, F. Ducancel, J. C. Boulain, and A. Ménez. 1997. Transformation of a non-enzymatic toxin into a toxoid by genetic engineering. Protein Eng. 10:101-108. |
| 13. | Fu, H., W. H. Shen, and R. J. Collier. 1993. Receptor-binding domain of diphtheria toxin as a potential immunogen. Vaccines 93:379-383. |
| 14. |
Hayakawa, S.,
T. Uchida,
E. Mekada,
M. R. Moynihan, and Y. Okada.
1983.
Monoclonal antibody against diphtheria toxin. Effect on toxin binding and entry into cells.
J. Biol. Chem.
258:4311-4317 |
| 15. | Langone, J. J. 1982. Protein A of Staphylococcus aureus and related immunoglobulin receptors produced by streptococci and pneumococci. Adv. Immunol. 32:157-252[Medline]. |
| 16. | Léonetti, M., R. Thaï, J. Cotton, S. Leroy, P. Drevet, F. Ducancel, J.-C. Boulain, and A. Ménez. Increasing immunogenicity of fused antigens by cell surface targeting. Submitted for publication. |
| 17. | Löwenadler, B., B. Jansson, S. Paleus, E. Holmgren, B. Nilsson, T. Moks, G. Palm, S. Josephson, L. Philipson, and M. Uhlén. 1987. A gene fusion system for generating antibodies against short peptides. Gene 58:87-97[Medline]. |
| 18. | Löwenadler, B., B. Nilsson, L. Abrahmsén, T. Moks, L. Ljungquist, E. Holmgren, S. Paleus, S. Josephson, L. Philipson, and M. Uhlén. 1986. Production of specific antibodies against protein A fusion proteins. EMBO J. 5:2393-2398[Medline]. |
| 19. | Lowenadler, B., N. Lycke, C. Svanholm, A.-M. Svennerholm, K. Krook, and M. Gidlund. 1992. T and B cell responses to chimeric proteins containing heterologous T helper epitopes inserted at different positions. Mol. Immunol. 29:1185-1190[Medline]. |
| 20. |
Mekada, E., and T. Uchida.
1985.
Binding properties of diphtheria toxin to cells are altered by mutation in the fragment A domain.
J. Biol. Chem.
260:12148-12153 |
| 21. |
Michel, M.-L.,
P. Pontisso,
E. Sobczak,
Y. Malpièce,
R. E. Streeck, and P. Tiollais.
1984.
Synthesis in animal cells of hepatitis B surface antigen particles carrying a receptor for polymerised human serum albumin.
Proc. Natl. Acad. Sci. USA
81:7708 |
| 22. | Nilsson, B., and L. Abrahmsén. 1990. Fusions to staphyloccocal protein A. Methods Enzymol. 185:144-161[Medline]. |
| 23. | Nilsson, B., G. Forsberg, and M. Hartmanis. 1991. Expression and purification of recombinant insulin-like growth factor, from Escherichia coli. Methods Enzymol. 198:3-16[Medline]. |
| 24. |
Nilsson, B.,
T. Moks,
B. Jansson,
L. Abrahmsén,
A. Elmblad,
E. Holmgren,
C. Henrichson,
T. A. Jones, and M. Uhlén.
1987.
A synthetic IgG-binding domain based on staphylococcal protein A.
Protein Eng.
1:107-113 |
| 25. | Palmenberg, A. 1987. A vaccine for the common cold? Nature 329:668[Medline]. |
| 26. | Pappenheimer, A. M. 1977. Diphtheria toxin. Annu. Rev. Biochem. 46:69-94[Medline]. |
| 27. | Peppoloni, S., M. Pizza, M. T. DeMagistris, A. Bartoloni, and R. Rappuoli. 1995. Acellular pertussis vaccine composed of genetically inactivated pertussis toxin. Physiol. Chem. Phys. Med. NMR 27:355-361[Medline]. |
| 28. |
Rolf, J. M., and L. Eidels.
1993.
Structure-function analyses of diphtheria toxin by use of monoclonal antibodies.
Infect. Immun.
61:994-1003 |
| 29. | Rolf, J. M., and L. Eidels. 1993. Characterization of the diphtheria toxin receptor-binding domain. Mol. Microbiol. 7:585-591[Medline]. |
| 30. |
Rolf, J. M.,
H. M. Gaudin, and L. Eidels.
1990.
Localization of the diphtheria toxin receptor-binding domain to the carboxyl-terminal Mr approximately 6000 region of the toxin.
J. Biol. Chem.
265:7331-7337 |
| 31. | Sambrook, J., E. F. Fritsch, and T. Maniatis. 1989. . Molecular cloning: a laboratory manual, 2nd ed. Cold Spring Harbor Laboratory, Cold Spring Harbor, N.Y. |
| 32. |
Samuelson, P.,
M. Hanson,
N. Ahlborg,
C. Andreoni,
F. Götz,
T. Bachi,
T. N. Nguyen,
H. Binz,
M. Uhlén, and S. Stahl.
1995.
Cell surface display of recombinant proteins on Staphylococcus carnosus.
J. Bacteriol.
177:1470-1476 |
| 33. | Studier, F. W., A. H. Rosenberg, J. J. Dunn, and J. W. Dubendorff. 1990. Use of T7 RNA polymerase to direct expression of cloned genes. Methods Enzymol. 185:60-89[Medline]. |
| 34. | Uhlén, M., G. Forsberg, T. Moks, M. Hartmanis, and B. Nilsson. 1992. Fusion proteins in biotechnology. Curr. Opin. Biotechnol. 3:363-369[Medline]. |
| 35. | Valerie, K., G. Fronko, W. Long, E. E. Henderson, B. Nilsson, M. Uhlén, and J. K. de Riel. 1987. Production and detection of coliphage T4 endonuclease V polyclonal and monoclonal antibodies using staphylococcal protein A hybrid proteins. Gene 58:99-107[Medline]. |
| 36. | Yanisch-Perron, C., J. Vieira, and J. Messing. 1985. Improved M13 phage cloning vectors and host strains: nucleotide sequences of the M13mp18 and pUC19 vectors. Gene 33:103-119[Medline]. |
| 37. | Yoshimori, T., M. Yamada, H. Sugawa, E. Mekada, T. Uchida, and Y. Okada. 1984. Monoclonal antibodies against diphtheria toxin fragment A. Characterization and introduction into living cells. Exp. Cell Res. 151:344-353[Medline]. |
| 38. | Zucker, D. R., and J. R. Murphy. 1984. Monoclonal antibody analysis of diphtheria toxin. I. Localization of epitopes and neutralization of cytotoxicity. Mol. Immunol. 21:785-793[Medline]. |
| 39. | Zucker, D. R., J. R. Murphy, and A. M. Pappenheimer. 1984. Monoclonal antibody analysis of diphtheria toxin. II. Inhibition of ADP-ribosyl-transferase activity. Mol. Immunol. 21:795-800[Medline]. |
This article has been cited by other articles:
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Copyright © 2009 by the American Society for Microbiology. For an alternate route to Journals.ASM.org, visit: http://intl-journals.asm.org | More Info»