Previous Article | Next Article 
Infect Immun, February 1998, p. 567-572, Vol. 66, No. 2
0019-9567/98/$04.00+0
Copyright © 1998, American Society for Microbiology. All rights reserved.
Identification and Characterization of the PutP Proline
Permease That Contributes to In Vivo Survival of
Staphylococcus aureus in Animal Models
William R.
Schwan,1,*
Silvija N.
Coulter,1
Eva Y. W.
Ng,1
Michael H.
Langhorne,1
Heather D.
Ritchie,1
Linnea L.
Brody,1
Shannon
Westbrock-Wadman,1
Arnold S.
Bayer,2
Kim R.
Folger,1 and
C.
Kendall
Stover1
PathoGenesis Corporation, Seattle, Washington
98119,1 and
Division of Infectious
Diseases and the St. John's Cardiovascular Research Center,
Harbor- UCLA Medical Center, Torrance, California
905092
Received 22 September 1997/Returned for modification 30 October
1997/Accepted 18 November 1997
 |
ABSTRACT |
Staphylococcus aureus is an important pathogen of
humans and other animals, causing bacteremia, abscesses, endocarditis,
and other infectious syndromes. A signature-tagged mutagenesis (STM) system was adapted for use in studying the genes required for in vivo
survival of S. aureus. An STM library was ultimately
created in S. aureus RN6390, with Tn917 being
used to create the transposon mutations. Pools of S. aureus
RN6390 mutants were screened in mouse abscess, bacteremia, and wound
infection models for growth attenuation after in vivo passage. One of
the mutants that was identified displayed marked attenuation following
large-pool screening in all three animal models, which was confirmed in
bacteremia and endocarditis models of infection with a smaller pool of
mutants. Sequence analysis of the entire open reading frame showed a
99% identity to the high-affinity proline permease (putP)
gene characterized in another strain of S. aureus. In wound
and murine abscess infection models, the putP mutant was
approximately 10-fold more attenuated than was wild-type strain RN6390.
Another S. aureus strain transduced with the
putP mutation also displayed an attenuated phenotype after
passage in the wound model. A [3H]proline uptake assay
showed that less proline was specifically transported into the
putP mutant than into strain RN6390. The reduced viability
of the bacteria possessing the mutation in the S. aureus
high-affinity proline permease suggests that proline scavenging by the
bacteria is important for in vivo growth and proliferation and that
analogs of proline may serve as potential antistaphylococcal
therapeutic agents.
 |
INTRODUCTION |
Staphylococcus aureus is
one of the leading causes of both community-acquired and
hospital-acquired infections (22, 39), and it is thought to
cause up to one-third of all food-borne illness in the United States
(3). This organism is responsible for a variety of distinct
and divergent diseases, including osteomyelitis, endocarditis,
bacteremia, wound and skin infections, abscess formation, and a host of
other afflictions, in humans and other animals (14). Current
antibiotic therapies against S. aureus are losing their effectiveness as methicillin resistance continues to increase (23,
26), and vancomycin resistance in clinical isolates has emerged
(7, 8). The identification by molecular biological techniques of new anti-staphylococcal drug targets and therapeutics with novel mechanisms of action is a critical goal.
One approach to the identification of genes necessary for in vivo
growth is signature-tagged mutagenesis (STM), originally described by
Hensel et al. (19). In this system, unique oligonucleotide signature tag (OST) sequences are inserted into a transposon between the flanking terminal repeat regions. When the transposon inserts into
the genome of the bacteria, a tagged mutation is created that can be
screened in animal models to identify genes required for growth in the
in vivo environment.
Although this basic STM approach was effective at identifying
attenuated Salmonella mutants (19), a number of
adaptations were necessary to accomplish the same task for the more
genetically intractable S. aureus cells (10). In
this report, we describe the identification and characterization of a
mutant with an OST mutation in the putP gene that
demonstrated marked attenuation in initial in vivo screening and
follow-up analyses. The putP gene encodes a high-affinity
proline permease that scavenges proline for use as a carbon and
nitrogen source (31, 43, 44). We show that disruption of
this proline permease by transposon insertion has a deleterious effect
on proline uptake, which in turn affects the in vivo survival of the
S. aureus cells.
 |
MATERIALS AND METHODS |
Bacterial strains, plasmids, and growth media.
S.
aureus RN4220 is a mutant of strain 8325-4 that accepts foreign
DNA via transformation or transduction (27). Strain RN6390 is a virulent, hemolytic laboratory strain that was used for final genetic transfers (27), and strain RN6911 is an
agr::TetM deletion mutant of RN6390 missing all of
the accessory global regulator (agr) gene plus additional
DNA downstream of RNAIII (32). The strains described above
were provided by B. Kreiswirth and A. Cheung. S. aureus S6C,
a hyperhemolytic variant provided by S. Projan (21), was
used as a recipient strain for transductions of the putP
mutation into a different genetic background. MAX efficiency
Escherichia coli DH10B (Gibco/BRL, Gaithersburg, Md.) cells
were used for marker rescue experiments of the flanking S. aureus DNA, E. coli XL1-Blue MRF' (Stratagene) was
exploited for lambda library expression, and E. coli SOLR
(Stratagene) was used for phagemid excision. The vector developed for
use in S. aureus, pMOD-1, was modified from the
gram-positive shuttle vector pLTV1 (6) (supplied by G. Muller and D. Portnoy), which contains Tn917; its
construction is described elsewhere (10). Phage
80
, given to us by B. Kreiswirth, was used as the transducing phage for
S. aureus strains. S. aureus cells were grown in
brain heart infusion medium (BHI; Gibco/BRL), while Luria-Bertani
medium (Gibco/BRL) was used for growing E. coli. The media
were supplemented with antibiotics (Sigma Chemical Co., St. Louis, Mo.)
at the following concentrations: ampicillin, 100 µg/ml; tetracycline,
12.5 µg/ml; lincomycin, 5 µg/ml; chloramphenicol, 10 µg/ml
(plasmid) or 5 µg/ml (integrated mutants); and erythromycin, 1 µg/ml (construction of ST mutants) or 5 µg/ml (transductions).
Construction of OST mutants.
The construction of the OST
Tn917 mutant library in S. aureus RN6390 is
described in detail elsewhere (10). OSTs were ligated into a
pMOD-1 vector, and the ligated products were transformed into E. coli cells (35) to establish the library. From the
transformed E. coli cells, plasmid isolation of the pMOD-1
vectors containing individual signature tags was performed as specified
by the manufacturer (Qiagen).
Because S. aureus RN6390 cannot be easily transformed
directly with foreign DNA, transformations of the pMOD-1 constructs were initially performed in S. aureus RN4220 by
electroporation (20). Transformants were selected at 30°C
on BHI agar plates containing chloramphenicol. To move the pMOD-1
constructs into the virulent strain RN6390, transductions were
performed with the donor
80
phage by the method of Proctor and
Kloos (30). Transductants were selected on BHI agar plates
containing chloramphenicol and 2 mM sodium citrate. Cells grown at
43°C to cure the plasmid were selected on BHI medium containing
erythromycin followed by screening on BHI agar containing
chloramphenicol or tetracycline. Mutants that were Emr,
Cmr, and Tcs were arrayed into pools of 95 unique OSTs in 96-well microtiter plates. Southern blot hybridizations
were performed as described below to verify single insertions of
Tn917 into the OST mutants.
Screening of OST mutants.
Pools of 95 individual
Tn917 mutants were grown to mid-logarithmetic phase in BHI
broth, washed once with BHI broth, and suspended to a final
concentration of 1.0 × 108 to 4.5 × 108 CFU/ml in BHI broth containing 15% (vol/vol) glycerol
for storage at
80°C. Following in vivo selection, agar plates
containing 1,000 to 5,000 bacterial colonies were flooded with 3 ml of
sterile distilled H2O and the bacteria were suspended to
homogeneity. An aliquot from each sample was lysed with lysostaphin at
37°C for 10 to 15 min. Aliquots of the supernatant were PCR amplified with 50 pmol of the SIG-BGL-2 (5' ATCTTACAACCTCAAGCTT 3')
and SIG-BGL-4 (5' ATCTCATTCTAACCAAGC 3') primers to
generate an 89-bp double-stranded DNA fragment corresponding to the
variable tags. PCR amplifications were set up as follows: initial
denaturation at 95°C for 90 s, followed by 30 cycles of 95°C
for 30 s, 48°C for 60 s, and 72°C for 30 s. The DNA
was digested with HindIII to remove the flanking
invariant arms, and the variable OST region was then treated with HK
phosphatase (Epicentre) as specified by the manufacturer. OST region
DNA probes made by 32P-end labelling with
[
-32P]ATP (DuPont/NEN, Wilmington, Del.)
(35) were denatured, mixed with hybridization buffer (4×
SSPE [1× SSPE is 0.18 M NaCl, 10 mM NaH2PO4,
and 1 mM EDTA; pH 7.7], 10% dextran sulfate, 0.5% sodium dodecyl
sulfate [SDS], 5× Denhardt's solution, 0.1 mg of salmon sperm DNA
[Digene, Beltsville, Md.]), and hybridized overnight at 65°C in a
hybridization oven (37). The filters were washed with 1×
SSC (0.15 M NaCl plus 0.015 M sodium citrate)-0.1% SDS for 15 min at
room temperature, 2× SSC for 20 min at 65°C, and 0.2 × SSC-0.1% SDS for 20 min at 65°C. The hybridization patterns were
visualized with a phosphorimager (Bio-Rad Molecular Imager System model
GS263).
To verify the Tn
917 insertions via Southern blot
hybridization, genomic bacterial DNAs were prepared from overnight
cultures
of OST mutants with the AGTC kit (Advanced Genetic
Technologies
Corp.). The manufacturer's instructions were modified
with the
addition of a lysostaphin (AMBI) treatment (32 µl of 2-mg/ml
lysostaphin
in 800 µl of spheroplast buffer) at 37°C for 30 min to
facilitate
breakdown of the cell wall. Purified genomic DNA was
resuspended
in 10 mM Tris (pH 8.0) and digested with
HindIII (Boehringer Mannheim,
Indianapolis, Ind.), which
cut adjacent to the 3'-terminal genomic
insertion site within
Tn
917. These fragments of DNA were transferred
to Hybond N
(Amersham) membranes (
35) and probed with either
a
random-prime labeled PCR amplified DNA fragment to open reading
frame
(ORF) 5 of Tn
917 (Redi-Prime; Amersham) or a random-primed
labeled PCR product spanning part of the
putP gene. The
600-bp
Tn
917 probe fragment was PCR amplified with primers
(5' TCAGGTGTTTGGAATGAC
3' and 5' CTTCGGGATCTATTTTGAC
3') under the following conditions:
an initial denaturation at
94°C for 90 s followed by 30 cycles
of 94°C for 60 s,
57°C for 30 s, and 72°C for 30 s. A
putP probe
fragment was PCR amplified with
putP-specific primers
(5' TTCTCTAACGATGTCACGAAC
and 5' CGAAAGCGCTTTCTATATTGGT
3') under the following conditions:
an initial denaturation at
94°C for 2 min followed by 30 cycles
of 94°C for 1 min, 56°C for
1 min, and 72°C for 2 min. Hybridizations
were performed as described
above.
For Southern dot and slot blot hybridizations of large-pool (95 mutants) and small-pool (11 mutants) screening of mutants,
individual
OST regions in Tn
917 were PCR amplified from the pMOD-1
constructs to generate a 600-bp fragment from each chosen clone.
Amplifications were performed with 100 pmol of primer SIG-BLOT-F
(5' AGTCATAAGATTAGTCACTGGTAG 3') and primer SIG-BLOT-R
(5' CACGGAAATGTTGAATACTCATAC
3') under the following
conditions: an initial denaturation at
95°C for 90 s followed by
30 cycles of 95°C for 30 s, 56°C for
30 s, and 72°C for
30 s. The PCR products were normalized to 10
ng/ml in 10 mM Tris
(pH 8.0). OST substrate DNAs (10 ng/ml) were
denatured by the addition
of 0.4 N NaOH and spotted onto precut
nylon membranes (Pall Biodyne B)
in a 96-well format with a 96-pin
replicator (Nunc). The DNAs were
triple loaded onto each spot,
and three adjacent spots per clone were
pinned. Small-pool membranes
for Southern blot hybridizations were
prepared with a 24-well
slot blot apparatus (Gibco/BRL). Probes were
prepared by labeling
6 to 25 pmol of the 52-bp
HindIII-digested DNAs, prepared as described
above.
Animal models.
Three murine animal models were used for the
primary screening of the large pools of Tn917 mutants. The
mouse abscess model and the mouse burn model involved Crl:SKH-1-hr BR
(outbred) mice (Charles River, Hollister, Calif.). Beige
(C57BL/6J-bgj+) mice (Jackson Laboratory, Bar Harbor,
Maine) were used for a disseminated systemic model of infection. For
the mouse abscess model, SKH-1 mice (two to four per time point) were
injected subcutaneously (106 to 107 CFU/ml)
(45). At 2 to 4 days postinoculation, the animals were sacrificed by cervical dislocation and the abscesses were collected in
disposable tissue grinders. Abscess suspensions were 10-fold serially
diluted in sterile saline and plated onto BHI agar and blood agar
(Remel). For long-term abscess formation (5 to 7 days), a
mouse-to-mouse bacterial transfer procedure was used. Mouse abscesses
from 2 to 3 days postinoculation were ground up in 2.5 ml of BHI broth
and pelleted by centrifugation at 800 × g for 1 to 2 min to remove large particulate matter. The supernatants were suspended
to a 1-ml volume, and a fresh group of uninfected mice were injected as
noted above. The abscesses were then harvested at 3 to 5 days
postinoculation, and the material was processed as noted above.
The mouse burn wound model was prepared by the method of Vasishta et
al. (
41), using SKH-1 mice and an inoculum of
10
4 CFU of
S. aureus mutants per ml in a large
pool. The analgesic
Torbutrol (Fort Dodge Laboratories, Inc., Fort
Dodge, Iowa) was
adminstered to the mice subcutaneously at a dose of
0.17 mg/kg
before the mice were burned. The animals were euthanized 4 days
postinoculation, and the pooled wound exudates from two to four
mice were processed as noted above for the abscess material. For
the
murine bacteremia model, Beige mice were injected intravenously
with
100 to 200 µl of inoculum at 10
6 to 10
7
CFU/ml (
18). At 1 or 2 days postinoculation, the mice were
sacrificed by cervical dislocation and the spleens and livers
were
extracted from all mice. Each organ culture was homogenized
separately
and processed as described above.
Single-mutant screenings of the 16F-157
putP::Tn
917 mutant, another unrelated
Tn
917 mutant, an
agr mutant (strain RN6911),
and
wild-type RN6390 were performed with the mouse abscess and
mouse burn
wound models characterized above. Eight mice per strain
per model were
inoculated with 10
7 CFU/ml for the abscess model and
10
1 CFU/ml for the wound infection model. This type of
screening
was also performed with the S6C strain and its
putP isogenic mutant,
inoculating six mice per strain
through the wound model. Abscesses
were collected 3 and 7 days
postinoculation, homogenized, and
plated for viable counts on BHI agar
or blood agar. Wound exudates
were collected 1, 4, or 7 days
postinoculation, homogenized, and
plated for viable counts on BHI agar
or mannitol salt agar (Difco).
A rabbit model of experimental endocarditis was also used as previously
detailed (
28). An endocarditis infection was induced
in
catheterized New Zealand White rabbits (Jackson Laboratory)
by the
intravenous (i.v.) injection, 24 h postcatheterization,
of an
S. aureus ST mutant pool of approximately 10
5
total CFU that contained the
putP mutant as well as 10 other
ST mutants. The rabbits were euthanized with a rapid i.v. injection
of
sodium pentobarbitol (Abbott Laboratories, Chicago, Ill.) 24
h
after the i.v. challenge with the mutant pool, and several cardiac
vegetations were removed and snap-frozen directly within
microcentrifuge
tubes as described previously (
28). Tissue
homogenates were
plated onto BHI agar and incubated at 37°C
overnight. DNAs from
staphylococcal cells, harvested from the BHI agar
plates, from
each rabbit and in vitro-grown cultures were fourfold
serially
diluted in distilled H
2O, starting at 10 ng/µl,
and PCR amplified
with either the 123 primer (5'
GATCTTGTGTTGGAGCGCTCTGT 3') or
the 157 primer (5'
CATAGACCTCTCCCGACACAC 3') paired with the SIG-BLOT-R
primer
(5' CACGGAAATGTTGAATACTCATAC 3') under the following
conditions:
an initial denaturation at 95°C for 2 min followed by 32 cycles
of 95°C for 1 min, 60°C for 1 min, and 72°C for 2 min. The
PCR
products were separated by electrophoresis through 2% agarose
gels.
Marker rescue of flanking genomic DNA.
To determine the
Tn917 insertion site within the 16F-157 S. aureus
chromosome, genomic DNA was prepared from this strain with the AGTC kit
and the DNA was digested with KpnI, EcoRI,
XbaI, or SphI (Boehringer Mannheim). Digested DNA
was recircularized by ligation of 100 ng of DNA per ligation reaction
and transformed into E. coli DH10B MAX efficiency competent
cells. Transformants were selected on Luria agar plates containing
ampicillin.
Phagemid screening and excision.
A commercially prepared
(Stratagene) lambda ZAP II bacterial genomic library from S. aureus RN6390 was used for phagemid screening and excision. The
phage library was grown on E. coli XL1-Blue MRF' as
specified by the manufacturer, and the propagated phage were aligned
into a 96-well array. Phagemids were excised with the ExAssist
interference-resistant helper phage and SOLR cells (Stratagene) as
specified by the manufacturer. The DNAs from each XL1-Blue phagemid
were extracted, normalized to 10 ng/ml, denatured, and pinned onto
nylon filters as noted above. Southern blot hybridization of membranes
prepared from the array were performed to identify putP-containing phagemids as described above.
DNA sequencing and homology analysis.
Double-stranded
plasmid or PCR-generated DNAs were sequenced by the dideoxy chain
termination procedure (36) with an ABI 377 automated
sequencer (ABI). The Tn917 5' primer (5'
CCATACGCAAGACCAATCACT 3') was used for the initial sequencing to
verify the transposon chromosome junction. Additional primers to the
putP sequence were synthesized to complete the ORF of the
gene as well as flanking DNA sequences. DNA sequencing runs were
aligned into a contig with the Sequencher software package (Gene Code
Corp., Ann Arbor, Mich.). BLASTX and TBLASTN analyses were performed to
identify potential homologies in the GenBank database (1).
Transduction into a new genetic background.
The
Tn917 insertion into putP in strain RN6390 was
transduced into another S. aureus genetic background,
S. aureus S6C, with phage
80
as described above.
Transductions were set up with a multiplicity of infection of 1:1
(phage-to-bacterium ratio) or 0.1:1. Transductants were selected on BHI
agar containing erythromycin and 2 mM sodium citrate and incubated at
30°C for 2 to 4 days. Emr colonies were screened for
Cmr. The DNAs from transductants that were Emr
Cmr were processed for Southern blot hybridization and PCR
analyses. To verify the insertion of Tn917 into the
putP gene, PCR amplifications were undertaken with a primer
in the putP gene (16F-157I, 5' GTTTAGGTATTAGCTGGATGGC 3') paired with the Tn917 5' primer as follows: an
initial denaturation at 94°C for 2 min followed by 31 cycles of
94°C for 30 s, 48°C for 1 min, and 72°C for 30 s.
Assay for proline transport.
Transport of proline into the
bacterial cell was analyzed by the filtration method described by Bae
and Miller (2). Bacteria were suspended to a final
concentration of approximately 25 to 40 µg of total cellular
protein/ml as measured with the Bio-Rad protein assay kit
(5). The S. aureus cells were preincubated at
37°C for 5 min in the transport buffer, and
L-[2,3-3H]proline (DuPont/NEN) was added at a
final concentration of 5 µM (specific activity, 40 Ci/mmol). The
bacterial cells were agitated at 37°C for up to 10 min. Aliquots (1 ml) were removed from the culture after 2, 6, or 10 min and filtered
through 0.45-µm-pore-size HA filters (Millipore, Bedford, Mass.) with
a sampling manifold (Millipore). The filters were washed twice with
unlabeled transport buffer and then dried in scintillation vials.
Radioactive samples were counted in 3.5 ml of Ecoscint scintillation
solution (National Diagnostics) with a Beckman LS 6000SC scintillation
spectrophotometer. When the inhibitors
3,4-dehydro-D,L-proline (DHP) (Sigma) or
L-azetidine-carboxylic acid (AZ) (Sigma) were used, they
were added at a final concentration of 10 mM at the same time as the
[3H]proline. Additions of 100-fold molar excesses of cold
L-proline (Sigma) or cold L-valine (Sigma) to
the reaction mixture to test the competition with the
[3H]proline were also made just before addition of the
[3H] proline.
Nucleotide sequence accession number.
The nucleotide
sequence data has been submitted to GenBank under accession no.
AF024571.
 |
RESULTS |
Large- and small-pool screening of the Tn917 SigTag
library.
A library of 1,520 Tn917 OST mutants was
generated for testing of attenuated virulence. Sixteen pools of 95 individual Tn917 mutants were screened in three animal
models (abscess, wound, bacteremia) to determine attenuation for in
vivo growth and survival. A total of 237 in vivo attenuated mutants,
including mutant 16F-157, were identified (10). This
Tn917 mutant demonstrated a diminished hybridization signal
in the Southern analyses of the pooled DNA collected from all three
animal models tested compared to in vitro-grown cells (Fig.
1). A Tn917 insertion in an
unrelated locus showed hybridization patterns from in vivo-passaged
bacteria that were similar to those for in vitro-grown cells.

View larger version (45K):
[in this window]
[in a new window]
|
FIG. 1.
Identification of attenuated genes by large-pool DNA dot
blot hybridizations. PCR-amplified DNAs from S. aureus cells
passaged through culture (in vitro), an abscess model, an i.v. (IV)
systemic model (spleen and liver), and a wound model were radiolabelled
and used to probe a 96-well array. The hybridization patterns from the
array for the putP::Tn917 mutant strain
16F-157 and an unrelated (UR) Tn917 mutant of strain RN6390
are depicted.
|
|
To verify that the 16F-157 mutant was attenuated for growth, a smaller
pool of 11 mutants that comprised a mixture of large-pool
attenuated
mutants, including 16F-157, and unattenuated mutants
was screened
through the bacteremia model of infection. Two days
after intravenous
injection of the small pool, the spleens and
livers of the SKH-1 mice
were collected and PCR amplifications
of DNA were performed.
Hybridization results demonstrated a fainter
signal in the in
vivo-passaged 16F-157 lane than in the in vitro-passaged
cells (data
not shown), confirming the attenuation of the 16F-157
mutant.
The pool of 11 mutants was also tested in an rabbit endocarditis model
of infection. Cardiac vegetations were collected after
24 h and
genomic DNA extracted from bacterial colonies arising
from the
homogenized tissue. PCR amplifications that used primers
specific for
the 16F-157 OST and an unrelated OST were performed
on fourfold serial
dilutions of the genomic DNAs, comparing DNAs
from in vitro-grown
staphylococcal cells to the DNAs from staphylococcal
cells obtained
after infection of three separate rabbits. The
limiting-dilution PCR
analyses showed that the amount of strain
16F-157 DNA (the 299-bp PCR
product) was reduced 16- to 64-fold
in the three rabbits compared to
the in vitro preparation whereas
the level of the unrelated OST DNA
(295-bp PCR product) remained
unchanged or even increased in the
rabbits that were inoculated
(Fig.
2).

View larger version (78K):
[in this window]
[in a new window]
|
FIG. 2.
Limiting-dilution PCR analyses of DNA from S. aureus cells isolated from infected cardiac vegetations compared
to in vitro-grown cells. New Zealand White rabbits were infected with a
pool of 11 S. aureus ST mutants, and the infected cardiac
tissue was collected 1 day postinoculation. DNAs were serially diluted
1/4, starting at a concentration of 10 ng/µl, and each dilution was
PCR amplified with either a 157-plus-SIG-BLOT-R primer pair (16F-157)
or a 123-plus-SIG-BLOT-R primer pair (unrelated [UR] Tn917
mutant). A 100-bp molecular size marker (MW; Gibco/BRL) was used to
measure the sizes of the UR Tn917 PCR product (295 bp) and
the 16F-157 PCR product (299 bp).
|
|
Localization of the transposon insertion in the 16F-157
mutant.
The transposon and flanking genomic DNA from strain
16F-157 was rescued and transformed into E. coli. The DNA
sequence was obtained for the entire ORF and compared to DNA and
protein databases for homologies to any known gene(s). The BLAST search
indicated that the gene in the 16F-157 strain where Tn917
inserted showed 99% identity to the putP gene previously
cloned from S. aureus ATCC 12600 (43). Five
nucleotides were changed, but only one predicted amino acid difference
was noted at position 374, an Asp-to-His change. The Tn917
insertion was between nucleotides 879 and 880 within the ORF, which is
approximately two-thirds of the way through the ORF of putP.
On the basis of this marked homology, we concluded that the transposon
was inserted into the S. aureus putP gene.
Diminished proline uptake by the putP mutant
strain.
To test whether the putP mutant was
functionally impaired for proline transport, proline uptake was
measured (2). Compared to wild-type strain RN6390, the
putP mutant displayed an approximate 33% overall decline in
[3H]proline uptake (Fig.
3). These results demonstrated that the putP mutation affected proline transport into the S. aureus cells. Two analog inhibitors of proline, AZ and DHP
(4, 11, 17), showed approximately 95% inhibition of proline
uptake when used at a 2,000-fold molar excess. The specificity of the
system was ascertained by using either a 100-fold molar excess of cold
L-proline or a 100-fold molar excess of
L-valine. L-proline inhibited
[3H]proline uptake by 95%, whereas a 100-fold molar
excess of L-valine did not significantly affect the amount
of [3H]proline entering the staphylococcal cells (data
not shown). The growth curves of the putP mutant compared to
the parent strain RN6390 were the same in BHI broth (Fig.
4) and minimal medium broth (reference
34 and data not shown). Proline analogs that inhibited proline uptake were also tested to determine if they would
impede the growth of RN6390 cells. AZ had no effect on the growth of
RN6390; however, DHP was able to partially inhibit the growth of RN6390
cells in the first 8 h (Fig. 4).

View larger version (19K):
[in this window]
[in a new window]
|
FIG. 3.
Proline uptake by the high-affinity system of S. aureus. Transport measurements were performed after 2, 6, or 10 min by the filtration method outlined in the text. Proline was present
at 5 µM. Cells were suspended in transport buffer at 40 µg of total
cellular protein per ml. Symbols: , RN6390; , RN6390 plus 10 mM
AZ; , RN6390 plus 10 mM DHP; , 16F-157
(putP::Tn917). This is a
representative graph from three independent experiments.
|
|

View larger version (19K):
[in this window]
[in a new window]
|
FIG. 4.
Growth curves of 16F-157
(putP::Tn917) and the parental strain
RN6390 with or without proline analogs in BHI broth. Symbols: ,
RN6390; , RN6390 plus 10 mM DHP; , RN6390 plus 10 mM AZ; ,
16F-157 (putP::Tn917). This is a
representative graph from two independent experiments.
|
|
Analysis of the putP mutant in animal models.
The
putP mutant was tested in a wound model and an abscess model
to determine the extent of its attenuation compared to wild-type strain
RN6390. Viable counts of the putP mutant were significantly lower in both the abscess model (Fig. 5)
(P < 0.0088) and the wound model (Fig.
6) (P < 0.0003) of
infection than those of the parental strain RN6390. Another unrelated
Tn917 mutant showed no significant change in the viable
counts from infected abscess (P < 0.1013) or wound
(P < 0.2164) tissues. A mutant deficient in the
accessory global regulator (agr) that transcriptionally activates a number of S. aureus virulence factors
(32) also displayed significantly fewer CFU per milliliter
in the abscess model (Fig. 5) (P < 0.0056) but showed
no overall difference in the viable counts (3.45 × 107 ± 1.92 × 107 and 3.61 × 107 ± 1.60 × 107 CFU/ml for the mutant
and wild-type RN6390, respectively [P < 0.4164]) in
the wound model.

View larger version (20K):
[in this window]
[in a new window]
|
FIG. 5.
Comparison of the putP mutant and two other
mutants to the wild-type strain RN6390 in the murine abscess model.
Viable counts were determined for the initial inocula and at 3 or 7 days postinoculation. Symbols: , RN6390; , 16F-157
(putP::Tn917); , an unrelated (UR)
Tn917 SigTag mutant; , an agr mutant
(agr::TetM) of strain RN6390.
|
|

View larger version (28K):
[in this window]
[in a new window]
|
FIG. 6.
Comparison of the putP mutant and another
Tn917 mutant to the wild-type strain RN6390 in the murine
burn wound model. Viable counts were determined at 1, 4, and 7 days
postinoculation. Symbols: , RN6390;
&atyp0220;, 16F-157
(putP::Tn917); , an unrelated (UR)
Tn917 SigTag mutant.
|
|
Phage

80

was used to move the
putP mutation from
strain 16F-157 (RN6390 background) into another
S. aureus
strain (S6C)
containing a different genetic background. The S6C strain
was
chosen because phage

80

was able to transduce into this
strain
and not into other
S. aureus strains that we had
available. This
transfer of the
putP mutation into strain
S6C was confirmed by
PCR and Southern blot hybridization analyses (data
not shown).
The viable counts of the resulting
putP mutant
in this genetic
background were again significantly less (9.06 × 10
6 CFU/ml;
P < 0.0107) than those of the
wild-type strain S6C (3.43
× 10
7 CFU/ml). This study
confirmed that PutP is needed by
S. aureus to obtain maximal
growth and achieve maximum survival potential
when present in murine
tissues.
 |
DISCUSSION |
Early studies of S. aureus have described the species
as being auxotrophic for proline (15). Previous studies have
suggested that under high-osmolarity growth conditions, proline
accumulates and serves as an osmoprotectant for S. aureus
(2, 16, 29, 40, 43) and Bacillus subtilis
(42) as well as gram-negative bacteria (12,
44). There appear to be at least two proline transport systems
for bringing proline into S. aureus cells: a high-affinity
system that is thought to be used primarily for scavenging proline for
nitrogen and carbon sources and a low-affinity system that is
osmotically regulated (2, 40, 43). Past studies have not
examined the role of proline permease in S. aureus survival
in vivo and in the overall virulence of the organism.
An STM system was used to generate Tn917 insertions in the
S. aureus genome (10) to study the effect of
these mutations on growth when the mutants were passaged through animal
models. The largest class of mutants affected peptide and amino acid
transport functions (10), including two amino acid permease
mutants. One of these permease mutants that was identified and
characterized from this technique affected the high-affinity proline
permease gene, putP. Large-pool and small-pool screening
suggested that the putP mutant was attenuated in all of the
animal models that were used (abscess, bacteremia, endocarditis, and
wound). By using four diverse animal models, the relevance of
attenuation of specific genes could be broadly delineated. For example,
the burn wound model measures the ability of an organism to initiate
rapid growth (41) whereas the abscess model characterizes
its ability to grow in a closed space under pressure from host
inflammatory responses (45). When the putP mutant
was tested as a homogeneous population in two animal models, its
virulence was reduced by approximately 1 log unit compared to that of
the wild-type parental strain, RN6390 (Fig. 5 and 6). An unrelated
Tn917 OST mutant was not significantly attenuated,
demonstrating that random Tn917 mutations themselves do not
always result in a change in the virulence of the bacteria. Furthermore, an agr mutant of strain RN6390 (32)
displayed a 1-log-unit decrease in the viable count from abscess
material, but the strain was not significantly changed for its overall
survival when growing in wounds. Agr regulates the production of
several exoproteins, including
-hemolysin, serine-protease, lipase,
and DNase (9, 32). These exoproteins may be needed to
establish and sustain an infection in the abscess milieu.
Proline is required by the S. aureus to grow. The in vivo
attenuation noted for the putP mutant corresponds to a
deficiency in the ability to scavenge proline, and our transport assay
results support these findings. Less proline was imported into the
S. aureus cells possessing a Tn917 insertion in
putP than into the wild-type parental strain. Although the
reduction in the uptake of proline was not substantial (approximately
33% overall), it appears to be sufficient to cause less growth of the
S. aureus in animal tissues. It has been previously shown
that the bacteria have a diminished capacity to import a variety of
amino acids, including alanine, lysine, and proline, within the depths
of cardiac vegetations infected with gram-positive bacteria in cases of
endocarditis (13). Thus, it is quite reasonable to conclude
that a limited ability to take up a specific essential amino acid (via
a mutation) would result in in vivo attenuation of that organism.
L-Proline can be utilized as the sole source of carbon and
nitrogen in several species of bacteria (44). In E. coli and Salmonella typhimurium, the putP
gene product serves as a major carrier, bringing L-proline across the cytoplasmic membrane (24, 25). By knocking out this high-affinity permease, the bacteria may not be able to procure enough proline in vivo within abscess, cardiac, or wound tissues to
allow maximal growth to occur. Gram-negative bacteria have three
proline permeases (44), and S. aureus has at
least two proline permease systems, a low-affinity system and a
high-affinity system (2, 40), which have partially redundant
functions. The transport experiments also reflect this redundancy in
that a mutation in putP did not totally abolish proline
uptake into the staphylococcal cells. Genetic knockouts of all of the
proline permease systems in S. aureus may show even greater
attenuation of growth in vivo.
The mutation in putP did affect the virulence of the
S. aureus cells, suggesting that an inhibitor of proline
uptake may function as a bacteriostatic agent. Two proline analogs that
are well characterized, AZ and DHP, interrupted 95% of the proline
transport into the staphylococcal cells, and DHP also temporarily
affected the growth of S. aureus RN6390. Additional
retardation of growth by DHP may not have occurred due to catabolism of
the inhibitor, rendering it inactive over time. These analogs of
proline have different effects on specific proline uptake pathways. It
has been demonstrated that AZ and DHP affect the proline transporters
differently in E. coli (38). Furthermore, the
inhibition of proline uptake was shown to be more effective for DHP
than for AZ when the low-affinity proline permease transport systems
were tested (33, 40), which could explain why DHP may have
impeded the growth of the staphylococcal cells more effectively than AZ
did. Both proline analogs are only 77 to 95% effective against
inhibiting the uptake of all proline transporters, which could allow
enough proline into the bacterial cells to permit growth. Other
investigators have shown that these proline analogs can be toxic for
E. coli (38) and S. typhimurium (25). On the other hand, both analogs also have deleterious effects on mammalian cells, making both unusable as components of
therapeutic drugs. A new proline analog antibiotic that is not toxic to
humans but blocks proline uptake in disease-causing bacteria could be
useful in treating S. aureus infections.
 |
ACKNOWLEDGMENTS |
We thank A. Cheung, B. Kreiswirth, and S. Projan for bacterial
strains and phages. We are grateful to D. Portnoy and G. Muller for the
pLTV1 plasmid. We appreciate the efforts of L. Goltry and E. Tolentino
for the synthesis of oligonucleotides and the ABI DNA sequencing. We
thank K. Miller for helpful suggestions about the proline uptake assay.
We are also grateful to W. Hufnagle for critiquing the manuscript and
S. Earhart for technical assistance. We thank I. Kupferwasser for
technical assistance in the animal endocarditis studies.
 |
FOOTNOTES |
*
Corresponding author. Mailing address: PathoGenesis
Corp., 201 Elliott Ave. West, Seattle, WA 98119. Phone: (206) 467-8100. Fax: (206) 282-5065. E-mail: bschwan{at}path.path.com.
Editor: V. A. Fischetti
 |
REFERENCES |
| 1.
|
Altschul, S. F.,
W. Gish,
W. Miller,
E. W. Meyers, and D. J. Lipman.
1990.
Basic local alignment search tool.
J. Mol. Biol.
215:403-410[Medline].
|
| 2.
|
Bae, J.-H., and K. J. Miller.
1992.
Identification of two proline transport systems in Staphylococcus aureus and their possible roles in osmoregulation.
Appl. Environ. Microbiol.
58:471-475[Abstract/Free Full Text].
|
| 3.
|
Bergdoll, M. S.
1989.
Staphylococcus aureus, p. 463-523. In
M. P. Doyle (ed.), Foodborne bacterial pathogens.
Marcel Dekker, Inc., New York, N.Y.
|
| 4.
|
Berman, H. M.,
E. L. McGandy,
J. W. Burgner II, and R. L. VanEtten.
1969.
The crystal and molecular structure of L-azetidine-2-carboxylic acid. A naturally occurring homolog of proline.
J. Am. Chem. Soc.
91:6177-6182[Medline].
|
| 5.
|
Bradford, M. M.
1976.
A rapid and sensitive method for the quantitation of microgram quantities of protein utilizing the principle of protein-dye binding.
Anal. Biochem.
72:248-254[Medline].
|
| 6.
|
Camilli, A.,
D. A. Portnoy, and P. Youngman.
1990.
Insertional mutagenesis of Listeria monocytogenes with a novel Tn917 derivative that allows direct cloning of DNA flanking transposon insertions.
J. Bacteriol.
172:3738-3744[Abstract/Free Full Text].
|
| 7.
|
Centers for Disease Control and Prevention.
1997.
Reduced susceptibility of Staphylococcus aureus to vancomycin Japan, 1996.
Morbid. Mortal. Weekly Rep.
46:624-626[Medline].
|
| 8.
|
Centers for Disease Control and Prevention.
1997.
Staphylococcus aureus with reduced susceptibility to vancomycin United States, 1997.
Morbid. Mortal. Weekly Rep.
46:765-766[Medline].
|
| 9.
|
Cheung, A. L.,
J. M. Koomey,
C. A. Butler,
S. J. Projan, and V. A. Fischetti.
1992.
Regulation of exoprotein expression in Staphylococcus aureus by a locus (sar) distinct from agr.
Proc. Natl. Acad. Sci. USA
89:6462-6466[Abstract/Free Full Text].
|
| 10.
| Coulter, S. N., W. R. Schwan, E. Y. W. Ng, M. Langhorne, H. Ritchie, S. Westbrock-Wadman, W. O. Hufnagle, K. Folger, A. S. Bayer, and C. K. Stover.
Staphylococcus aureus genetic loci impacting growth and
survival in mutliple infection environments. Submitted for publication.
|
| 11.
|
Csonka, L. N.
1981.
The role of proline in osmoregulation in Salmonella typhimurium and Escherichia coli.
Basic Life Sci.
18:533-542[Medline].
|
| 12.
|
Csonka, L. N., and A. D. Hanson.
1991.
Prokaryotic osmoregulation: genetics and physiology.
Annu. Rev. Microbiol.
45:569-606[Medline].
|
| 13.
|
Durack, D. T., and P. B. Beeson.
1972.
Experimental bacterial endocarditis. II. Survival of bacteria in endocardial vegetations.
Br. J. Exp. Pathol.
53:50-53[Medline].
|
| 14.
|
Easmon, C. S. F., and C. Adlam.
1983.
.
Staphylococci and staphylococcal infections.
Academic Press, New York, N.Y.
|
| 15.
|
Gladstone, G. P.
1937.
The nutrition of Staphylococcus aureus: nitrogen requirements.
Br. J. Exp. Pathol.
19:208-226.
|
| 16.
|
Graham, J. E., and B. J. Wilkinson.
1992.
Staphylococcus aureus osmoregulation: roles for choline, glycine betaine, proline and taurine.
J. Bacteriol.
174:2711-2716[Abstract/Free Full Text].
|
| 17.
|
Grant, M. M.,
A. S. Brown,
L. M. Corwin,
R. F. Troxler, and C. Franzblau.
1875.
Effect of L-azetidine-2-carboxylic acid on growth and proline metabolism in Escherichia coli.
Biochim. Biophys. Acta
404:180-187.
|
| 18.
|
Hasegawa, N., and C. L. San Clemente.
1978.
Virulence and immunity of Staphylococcus aureus BB and certain deficient mutants.
Infect. Immun.
22:473-479[Abstract/Free Full Text].
|
| 19.
|
Hensel, M.,
J. E. Shea,
C. Gleeson,
M. D. Jones,
E. Dalton, and D. W. Holden.
1995.
Simultaneous identification of bacterial virulence genes by negative selection.
Science
269:400-403[Abstract/Free Full Text].
|
| 20.
|
Iandolo, J. J., and G. R. Kraemer.
1990.
High frequency transformation of Staphylococcus aureus by electroporation.
Curr. Microbiol.
21:373-376.
|
| 21.
|
Iandolo, J. J., and W. M. Shafer.
1977.
Regulation of staphylococcal enterotoxin B.
Infect. Immun.
16:610-616[Abstract/Free Full Text].
|
| 22.
| Jarvis, W. R., and W. J. Martone. 1992. Predominant pathogens in hospital infections. J. Antimicrob. Chemother.
29(Suppl A):19-24.
|
| 23.
|
Michel, M., and L. Gutmann.
1997.
Methicillin-resistant Staphylococcus aureus and vancomycin-resistant enterococci: therapeutic realities and possibilities.
Lancet
349:1901-1904[Medline].
|
| 24.
|
Motojima, K.,
I. Yamamoto, and I. Anraku.
1978.
Proline transport carrier-defective mutants of Escherichia coli K-12: properties and mapping.
J. Bacteriol.
136:5-9[Abstract/Free Full Text].
|
| 25.
|
Myers, R. S.,
D. Townsend, and S. Maloy.
1991.
Dissecting the molecular mechanism of ion-solute cotransport: substrate specificity mutations in the putP gene affect the kinetics of proline transport.
J. Membr. Biol.
121:201-214[Medline].
|
| 26.
|
Nicas, T. I.,
M. L. Zeckel, and D. K. Braun.
1997.
Beyond vancomycin: new therapies to meet the challenge of glycopeptide resistance.
Trends Microbiol.
5:240-249[Medline].
|
| 27.
|
Novick, R. P.
1990.
The Staphylococcus as a molecular genetic system, p. 1-40. In
R. P. Novick (ed.), Molecular biology of the staphylococci.
VCH Publishers, New York, N.Y.
|
| 28.
|
Perlman, B. B., and L. R. Freedman.
1971.
Experimental endocarditis. II. Staphylococcal infection of the aortic valve following placement of a polyethylene catheter in the left side of the heart.
Yale J. Biol. Med.
42:394-410.
|
| 29.
|
Pourkomailian, B., and I. R. Booth.
1994.
Glycine betaine transport by Staphylococcus aureus: evidence for feedback regulation of the activity of the two transport systems.
Microbiology
140:3131-3138[Abstract/Free Full Text].
|
| 30.
|
Proctor, A. R., and W. E. Kloos.
1970.
The tryptophan gene cluster of Staphylococcus aureus.
J. Gen. Microbiol.
64:319-327[Abstract/Free Full Text].
|
| 31.
|
Ratzkin, B.,
M. Grabnar, and J. Roth.
1978.
Regulation of the major proline permease in Salmonella typhimurium.
J. Bacteriol.
133:737-743[Abstract/Free Full Text].
|
| 32.
|
Recsei, P.,
B. Kreiswirth,
M. O'Reilly,
P. Schlievert,
A. Gruss, and R. P. Novick.
1986.
Regulation of exoprotein gene expression in Staphylococcus aureus by agr.
Mol. Gen. Genet.
202:58-61[Medline].
|
| 33.
|
Rowland, I., and H. Tristam.
1975.
Specificity of the Escherichia coli proline transport system.
J. Bacteriol.
123:871-877[Abstract/Free Full Text].
|
| 34.
|
Rudin, L.,
J. E. Sjostrom,
M. Lindberg, and L. Philipson.
1974.
Factors affecting competence for transformation in Staphylococcus aureus.
J. Bacteriol.
118:155-164[Abstract/Free Full Text].
|
| 35.
|
Sambrook, J.,
E. F. Fritsch, and T. Maniatis.
1989.
.
Molecular cloning: a laboratory manual, 2nd ed.
Cold Spring Harbor Laboratory Press, Plainview, N.Y.
|
| 36.
|
Sanger, F.,
S. Nicklen, and A. R. Coulson.
1977.
DNA sequencing with chain-terminating inhibitors.
Proc. Natl. Acad. Sci. USA
74:5463-5467[Abstract/Free Full Text].
|
| 37.
|
Schwan, W. R.,
S. Kügler,
S. Schüller,
D. J. Kopecko, and W. Goebel.
1996.
Detection and characterization by differential PCR of host eukaryotic cell genes differentially transcribed following uptake of intracellular bacteria.
Infect. Immun.
64:91-99[Abstract].
|
| 38.
|
Stalmach, M. E.,
S. Grothe, and J. M. Wood.
1983.
Two proline porters in Escherichia coli K-12.
J. Bacteriol.
156:481-486[Abstract/Free Full Text].
|
| 39.
| Thornsberry, C. 1994. Epidemiology of
staphylococcal infections a USA perspective. J. Chemother.
6(Suppl. 2):61-65.
|
| 40.
|
Townsend, D. E., and B. J. Wilkinson.
1992.
Proline transport in Staphylococcus aureus: a high-affinity system and a low affinity system involved in osmoregulation.
J. Bacteriol.
174:2702-2710[Abstract/Free Full Text].
|
| 41.
|
Vasishta, R.,
M. Saxena, and S. Chhibber.
1991.
Contribution of silver ion replacement to the pathogenicity of Pseudomonas aeruginosa with special reference to burn sepsis.
Folia Microbiol.
36:498-501.
|
| 42.
|
von Blohn, C.,
B. Kempf,
R. M. Kappes, and E. Bremer.
1997.
Osmostress response in Bacillus subtilis: characterization of a proline uptake system (OpuE) regulated by high osmolarity and the alternative transcription factor sigma B.
Mol. Microbiol.
25:175-187[Medline].
|
| 43.
|
Wengender, P. A., and K. J. Miller.
1995.
Identification of a PutP proline permease gene homolog from Staphylococcus aureus by expression cloning of the high-affinity proline transport system in Escherichia coli.
Appl. Environ. Microbiol.
61:252-259[Abstract].
|
| 44.
|
Wood, J. M.
1988.
Proline porters effect the utilization of proline as nutrient or osmoprotectant for bacteria.
J. Membr. Biol.
106:183-202[Medline].
|
| 45.
|
Xiong, Z.,
S. Ge,
N. Chamberlain, and F. Kapral.
1993.
Growth cycle-induced changes in sensitivity of Staphylococcus aureus to bacterial lipids from abscesses.
J. Med. Microbiol.
39:58-63[Abstract/Free Full Text].
|
Infect Immun, February 1998, p. 567-572, Vol. 66, No. 2
0019-9567/98/$04.00+0
Copyright © 1998, American Society for Microbiology. All rights reserved.
This article has been cited by other articles:
-
Zhu, Y., Xiong, Y. Q., Sadykov, M. R., Fey, P. D., Lei, M. G., Lee, C. Y., Bayer, A. S., Somerville, G. A.
(2009). Tricarboxylic Acid Cycle-Dependent Attenuation of Staphylococcus aureus In Vivo Virulence by Selective Inhibition of Amino Acid Transport. Infect. Immun.
77: 4256-4264
[Abstract]
[Full Text]
-
Himpsl, S. D., Lockatell, C. V., Hebel, J. R., Johnson, D. E., Mobley, H. L. T.
(2008). Identification of virulence determinants in uropathogenic Proteus mirabilis using signature-tagged mutagenesis. J Med Microbiol
57: 1068-1078
[Abstract]
[Full Text]
-
Price, C. T. D., Bukka, A., Cynamon, M., Graham, J. E.
(2008). Glycine Betaine Uptake by the ProXVWZ ABC Transporter Contributes to the Ability of Mycobacterium tuberculosis To Initiate Growth in Human Macrophages. J. Bacteriol.
190: 3955-3961
[Abstract]
[Full Text]
-
Schwan, W. R., Lehmann, L., McCormick, J.
(2006). Transcriptional Activation of the Staphylococcus aureus putP Gene by Low-Proline-High Osmotic Conditions and during Infection of Murine and Human Tissues. Infect. Immun.
74: 399-409
[Abstract]
[Full Text]
-
Bae, T., Banger, A. K., Wallace, A., Glass, E. M., Aslund, F., Schneewind, O., Missiakas, D. M.
(2004). Staphylococcus aureus virulence genes identified by bursa aurealis mutagenesis and nematode killing. Proc. Natl. Acad. Sci. USA
101: 12312-12317
[Abstract]
[Full Text]
-
Brown, J. S., Gilliland, S. M., Basavanna, S., Holden, D. W.
(2004). phgABC, a Three-Gene Operon Required for Growth of Streptococcus pneumoniae in Hyperosmotic Medium and In Vivo. Infect. Immun.
72: 4579-4588
[Abstract]
[Full Text]
-
Schwan, W. R., Wetzel, K. J., Gomez, T. S., Stiles, M. A., Beitlich, B. D., Grunwald, S.
(2004). Low-proline environments impair growth, proline transport and in vivo survival of Staphylococcus aureus strain-specific putP mutants. Microbiology
150: 1055-1061
[Abstract]
[Full Text]
-
Memmott, S. D., Ha, Y.-s., Dickman, M. B.
(2002). Proline Reverses the Abnormal Phenotypes of Colletotrichum trifolii Associated with Expression of Endogenous Constitutively Active Ras. Appl. Environ. Microbiol.
68: 1647-1651
[Abstract]
[Full Text]
-
Karlyshev, A. V., Oyston, P. C. F., Williams, K., Clark, G. C., Titball, R. W., Winzeler, E. A., Wren, B. W.
(2001). Application of High-Density Array-Based Signature-Tagged Mutagenesis To Discover Novel Yersinia Virulence-Associated Genes. Infect. Immun.
69: 7810-7819
[Abstract]
[Full Text]
-
Sleator, R. D., Gahan, C. G. M., Hill, C.
(2001). Mutations in the Listerial proB Gene Leading to Proline Overproduction: Effects on Salt Tolerance and Murine Infection. Appl. Environ. Microbiol.
67: 4560-4565
[Abstract]
[Full Text]
-
Sleator, R. D., Gahan, C. G. M., Hill, C.
(2001). Identification and Disruption of the proBA Locus in Listeria monocytogenes: Role of Proline Biosynthesis in Salt Tolerance and Murine Infection. Appl. Environ. Microbiol.
67: 2571-2577
[Abstract]
[Full Text]
-
Nelson, R. T., Hua, J., Pryor, B., Lodge, J. K.
(2001). Identification of Virulence Mutants of the Fungal Pathogen Cryptococcus neoformans Using Signature-Tagged Mutagenesis. Genetics
157: 935-947
[Abstract]
[Full Text]
-
Stutzmann Meier, P., Entenza, J. M., Vaudaux, P., Francioli, P., Glauser, M. P., Moreillon, P.
(2001). Study of Staphylococcus aureus Pathogenic Genes by Transfer and Expression in the Less Virulent Organism Streptococcus gordonii. Infect. Immun.
69: 657-664
[Abstract]
[Full Text]
-
Foulongne, V., Bourg, G., Cazevieille, C., Michaux-Charachon, S., O'Callaghan, D.
(2000). Identification of Brucella suis Genes Affecting Intracellular Survival in an In Vitro Human Macrophage Infection Model by Signature-Tagged Transposon Mutagenesis. Infect. Immun.
68: 1297-1303
[Abstract]
[Full Text]
-
Kiser, K. B., Cantey-Kiser, J. M., Lee, J. C.
(1999). Development and Characterization of a Staphylococcus aureus Nasal Colonization Model in Mice. Infect. Immun.
67: 5001-5006
[Abstract]
[Full Text]
-
McKenney, D., Pouliot, K. L., Wang, Y., Murthy, V., Ulrich, M., Döring, G., Lee, J. C., Goldmann, D. A., Pier, G. B.
(1999). Broadly Protective Vaccine for Staphylococcus aureus Based on an in Vivo-Expressed Antigen. Science
284: 1523-1527
[Abstract]
[Full Text]
-
Bayer, A. S., Coulter, S. N., Stover, C. K., Schwan, W. R.
(1999). Impact of the High-Affinity Proline Permease Gene (putP) on the Virulence of Staphylococcus aureus in Experimental Endocarditis. Infect. Immun.
67: 740-744
[Abstract]
[Full Text]