This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow An erratum has been published
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowReprints and Permissions
Right arrow Copyright Information
Right arrow Books from ASM Press
Right arrow MicrobeWorld
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by French, D. M.
Right arrow Articles by Palmer, G. H.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by French, D. M.
Right arrow Articles by Palmer, G. H.

 Previous Article  |  Next Article 

Infect Immun, March 1998, p. 1200-1207, Vol. 66, No. 3
0019-9567/98/$04.00+0
Copyright © 1998, American Society for Microbiology. All rights reserved.

Expression of Anaplasma marginale Major Surface Protein 2 Variants during Persistent Cyclic Rickettsemia

Dorothy M. French,* Terry F. McElwain, Travis C. McGuire, and Guy H. Palmer

Department of Veterinary Microbiology and Pathology, Washington State University, Pullman, Washington 99164

Received 3 September 1997/Returned for modification 20 October 1997/Accepted 10 December 1997

    ABSTRACT
Top
Abstract
Introduction
Materials & Methods
Results
Discussion
References

Anaplasma marginale is an intraerythrocytic rickettsial pathogen of cattle in which infection persists for the life of the animal. Persistent A. marginale infection is characterized by repetitive rickettsemic cycles which we hypothesize reflect emergence of A. marginale antigenic variants. In this study, we determined whether variants of major surface protein 2 (MSP-2), a target of protective immunity encoded by a polymorphic multigene family, arise during persistent rickettsemia. By using a quantitative competitive PCR to identify rickettsemic cycles, msp-2 transcripts expressed in vivo were isolated from peak rickettsemia of sequential cycles. Cloning and sequencing of msp-2 cDNA revealed that genetic variants of MSP-2 emerge representing a minimum of four genetic variant types in each cycle during persistent infection. Two-color immunofluorescence using variant-specific antibody showed that emergence of MSP-2 variants resulted in expression of a minimum of three antigenic types of MSP-2 within one rickettsemic cycle. Therefore immune control of each cycle would require responses to an antigenically diverse A. marginale population. These findings demonstrate that polymorphic MSP-2 variants emerge during cyclic rickettsemia in persistent A. marginale infection and suggest that emergent variants play an important role in persistence.

    INTRODUCTION
Top
Abstract
Introduction
Materials & Methods
Results
Discussion
References

Rickettsiae are obligate intracellular bacteria that invade and multiply within host cells and, depending on the host infected, cause anemia, leukopenia, thrombocytopenia, or vasculitis that can result in death (37). Animals that survive acute infection have an effective immune response that either eliminates the infection or reduces rickettsemia to low, microscopically undetectable levels which persist. How rickettsiae persist despite a controlling immune response is unknown. Several rickettsial pathogens which establish persistent infections in their hosts, including Anaplasma marginale (15, 25), Rickettsia tsutsugamushi (5, 8, 21, 29, 30), Ehrlichia canis (3), and Cowdria ruminantium (1, 27), show variation in outer membrane proteins. Major surface protein 2 (MSP-2) of A. marginale (22, 23, 26), the 56-kDa major outer membrane protein of R. tsutsugamushi (17, 20, 31), and the MAP-1 protein of C. ruminantium (32, 34), for example, are surface expressed and are highly immunogenic. While surface protein variation is clearly involved in strain-specific immunity, the role of outer membrane protein variation in persistence of rickettsial infections is unknown.

A. marginale is an intraerythrocytic rickettsia that infects cattle and can cause severe anemia, abortion, or death (14). Immunity to A. marginale is directed against outer membrane surface proteins (22, 23, 26), including MSP-2. MSP-2 is encoded by a large, polymorphic, multigene family that comprises at least 1% of the genome (25), providing the genetic capacity for antigenic variation. Variant msp-2 transcripts cloned and sequenced from acute rickettsemia encode unique MSP-2 polypeptides which are expressed in vivo (4). Similarly, A. marginale bearing MSP-2 antigenic variants during acute rickettsemia has been demonstrated in assays using copy-specific monoclonal antibodies reactive with MSP-2 on some but not all organisms (25). The development of a primary immune response, by either infection or MSP-2 immunization, dramatically reduces but does not clear A. marginale rickettsemia (24). However, these immune cattle are protected against high level rickettsemia and acute disease following subsequent homologous strain challenge. Thus, persistence occurs despite development of a protective immune response against the initial infecting organisms. We have hypothesized that persistence, characterized by cyclic rickettsemia, reflects continual emergence of new antigenic variants (4, 11). The goal of this study was to determine whether MSP-2 variants arise during rickettsemic cycles in persistent A. marginale infection. A competitive PCR was developed to quantitate the rickettsemia levels in persistent infection. We then examined each identified peak of cyclic rickettsemia to determine if MSP-2 variants emerge within sequential peaks, or if MSP-2 is invariant during persistent A. marginale infection.

    MATERIALS AND METHODS
Top
Abstract
Introduction
Materials & Methods
Results
Discussion
References

Sample collection. Two Holstein steers (807 and 808) were experimentally infected with A. marginale Florida strain on October 3, 1994 (10-3-94 [this convention for expressing dates will be used hereafter]) by intravenous inoculation of 1 ml of whole blood from an acutely rickettsemic calf (2.4 × 109 infected erythrocytes/ml of blood). Beginning 3-6-96, peripheral blood was collected biweekly (in the morning) by venipuncture, and the following samples were stored: 10 ml of whole blood collected in acid citrate dextrose, mixed with TRIzol reagent (BRL) and frozen at -20°C for RNA extraction; 5 ml of whole blood collected in EDTA frozen at -20°C for DNA extraction; erythrocytes collected in heparin, washed three times in phosphate-buffered saline (PBS; 150 mM NaCl, 10 mM sodium phosphate [pH 7.4]) and frozen at -20°C for immunoblots; 3 ml of serum frozen at -20°C; and unstained whole blood smears stored at -70°C for fluorescent antibody tests.

Identification of rickettsemic cycles in persistently infected cattle. DNA was extracted from 100 µl of whole blood from persistently infected cattle, using a Puregene (Gentra) DNA extraction kit. DNA was then used in a competitive PCR to quantitate rickettsemia and identify cycles. Primers used for identification of rickettsemic cycles were based on A. marginale msp-5, a conserved single-copy gene (36). The external primers (5' primer, GCATAGCCTCCGCGTCTTTC; 3' primer, TCTGAGGGCCAAGGCGAGGA) amplify a 457-bp fragment. A 202-base msp-5 MIMIC (Clontech PCR MIMIC construction kit) with primer binding sites specific for A. marginale msp-5 was constructed. A constant amount of DNA extracted from persistently infected cattle was amplified in the presence of 10-fold dilutions of the msp-5 MIMIC. Amplifications were performed in 50-µl reaction volumes, using Boehringer Mannheim PCR Master. PCR products were evaluated densitometrically following electrophoresis on a 2% agarose gel. The initial molar amount of target msp-5 DNA (N0t) was extrapolated from a logarithmic plot of log [At/As] versus the log of the initial molar amount of mimic (log N0s), where At is the amount of amplified target, As is the amount of amplified standard, and N0s is the initial number of standard molecules. N0t is equal to N0s added in the reaction when an equimolar ratio of the two products is produced (i.e., where the log of At/As = log 1/1 = 0) (2). Rickettsemic cycles were identified by plotting the log of the target msp-5 concentration (in attomoles/microliter) versus the date of blood collection (Fig. 1). To ensure that the competitive PCR was consistent, standardized samples were evaluated. Blood from an acutely infected animal determined microscopically to have a rickettsemia level of 1.6 × 109 infected erythrocytes/ml of blood was diluted to 103 to 107 infected erythrocytes/ml of blood and run in the msp-5 competitive PCR. By determining the number of attomoles of msp-5 in samples with known numbers of infected erythrocytes, an approximation of the number of infected erythrocytes could be made for samples from persistently infected animals. Whole blood from an uninfected steer was also extracted and evaluated in the competitive PCR as a negative control.

Cloning and sequencing of msp-2 cDNA. Total RNA was extracted using TRIzol (BRL) from whole blood taken at the peak of each rickettsemic cycle and reverse transcribed by using random hexamers. Primers were derived from conserved regions based on sequence comparisons of the existing full-length genomic clones, DF5 msp-2 and pCKR11.2 msp-2; a partial genomic clone, pCKR5.2 msp-2; and a cDNA clone from acute rickettsemia, AR5 msp-2 (4, 25). The 5' and 3' primers for msp-2 were TGGAGGAGCAAGGGTTGAAGT and TTGTGCTGGTATCGGTGGTAA, respectively. The amplified central 595-bp region of the 1.2-kb genes includes a polymorphic region (4, 25). PCR products were ligated into pCR 2.1 (Invitrogen) by using the TA cloning kit (Invitrogen). Competent Escherichia coli XL-1 Blue was transformed with the ligated vector and plated with 5 mM isopropyl-1-beta -D-thiogalactopyranoside and 5-bromo-4-chloro-3-indolyl-beta -D-galactopyranoside for blue/white screening. The same cDNA was also amplified with the msp-5-specific primers listed above as a control for nucleotide changes generated during amplification. Presence of msp-2 or msp-5 inserts in plasmids from transformed colonies was confirmed by restriction digests or PCR. Plasmid DNA was extracted, and clones were sequenced in both directions by using an ABI PRISM (Applied Biosystems) automated DNA sequencer. Sequence analysis using the Genetics Computer Group package from the University of Wisconsin, version 8.1, was performed on a VAX11/785 computer.

Generation of antibody against polymorphic MSP-2 variants. To determine if different antigenic variants were expressed within one rickettsemic peak, genetic variants from peak 2 of animal 808 were used to generate specific antibodies. Two of the variant msp-2 sequences, designated Pk2-3 and Pk2-5, were subcloned in frame into the pET19b (Novagen) vector for expression of His-tagged fusion proteins. Pk2-3 and Pk2-5 were amplified by PCR with Taq DNA polymerase, using forward and reverse primers containing StuI and XhoI restriction sites, respectively. The vector was digested with NdeI, blunt ended with the Klenow fragment of DNA polymerase I, and subsequently digested with XhoI. The digested PCR fragments were then ligated into the pET19b plasmid between the NdeI and XhoI sites in the polylinker. Plasmids containing the inserts were sequenced to confirm reading frame and absence of nucleotide changes and used to transform competent E. coli BL21(DE3) cells. The clone generated from Pk2-3 was designated V3, and the clone from Pk2-5 was designated V5. V3 and V5 were then used for protein expression. Recombinant proteins were expressed and purified on Ni2+-charged columns under denaturing conditions as recommended by the manufacturer (Novagen) but modified by adding imidazole in the wash buffer (0.5 M NaCl, 20 mM Tris [pH 7.9], 80 mM imidazole) to minimize nonspecific binding of proteins to the column. Purified proteins were dialyzed against PBS for 48 h at 4°C. Rabbits were immunized twice subcutaneously at a 4-week interval with 100 µg of total protein emulsified in RIBI adjuvant (RIBI Immunochem Research, Inc.). Sera were obtained, and immunoglobulin G (IgG) was isolated by using a protein G-agarose column (Gibco BRL). The antibodies were cross-adsorbed: anti-V3 IgG was adsorbed with purified V5 protein, anti-V5 IgG was adsorbed with purified V3 protein, and as a negative control, anti-bovine interleukin-4 (IL-4) IgG was adsorbed with purified Babesia bigemina RAP-1 protein. Adsorption experiments were done by adding 20 µg of recombinant protein (V3, V5, or B. bigemina RAP-1) to 200 µg of purified IgG against V5, V3, or IL-4, respectively, and incubation for 4 h at room temperature followed by centrifugation for 5 min at 12,000 × g. Specific reactivity of the antibodies with respective variants was tested by immunoblotting. Purified proteins were electrophoresed on sodium dodecyl sulfate-containing polyacrylamide gels. Separated proteins were transferred electrophoretically to a nitrocellulose membrane and reacted with a 1:5,000 dilution of either the preadsorbed anti-V3, anti-V5, or anti-IL-4 IgG. Bound antibody was detected with peroxidase-labeled goat anti-rabbit IgG with enhanced chemiluminescence detection (25).

Identification of variant MSP-2 coexpressed in one peak during persistent rickettsemia. Following confirmation of antibody specificity for the respective variants, IgG isolated from the anti-V3 serum was directly labeled with rhodamine, and IgG from anti-V5 or anti-IL-4 polyclonal sera was directly labeled with fluorescein (9). Solutions of 7 mg of IgG/ml were prepared by dilution with 0.1 M sodium carbonate. One milliliter of IgG solution was incubated for 8 h at 4°C with 50 µg of tetramethylrhodamine isothiocyanate or fluorescein isothiocyanate dissolved in dimethyl sulfoxide. The conjugated antibody was separated from unbound dye by gel filtration and subsequently used in direct immunofluorescence. Methanol-fixed blood smears from the second rickettsemic peak in animal 808 (5-10-96) were incubated first with rhodamine-conjugated anti-V3 for 30 min at 37°C. Slides were washed three times in PBS and then incubated with either fluorescein-conjugated anti-V5 or, as a negative control, anti-IL-4. Following three additional washes in PBS, slides were examined at a magnification of ×400, using an excitation wavelength of 450 to 490 nm to detect fluorescein-labeled organisms and a wavelength of 546 nm to detect rhodamine-labeled organisms.

    RESULTS
Top
Abstract
Introduction
Materials & Methods
Results
Discussion
References

Identification of rickettsemic cycles in persistently infected cattle. Animals that survive acute A. marginale infection become persistently infected with low cyclic levels of rickettsemia (6, 7, 11). Rickettsemic cycles were identified in two persistently infected animals, 808 and 807, by quantitation using msp-5 competitive PCR. Since the msp-5 gene is present as a single genomic copy (36), each molecule of msp-5 represents a single organism. Major sequential cycles, defined as >= 106 rickettsiae per ml of blood, occurred at 6- to 8-week intervals during the 18-week study period (corresponding to 72 to 90 weeks or 504 to 630 days postinfection [Fig. 1]). Each major peak was followed by a rapid decline in rickettsemia of at least 102 per ml of blood. In Fig. 1, for animal 808 the highest major peak on 3-12-96 had 2.2 × 107 organisms per ml (-2.15 log attomol/µl of blood), and the low point on 5-31-96 had 4 × 103 organisms per ml of whole blood (-5.55 log amol/µl of blood). Rickettsemic cycles in animal 807 had similar fluctuations but reached a low point of 2 × 103 organisms per ml of blood (-5.82 log amol/µl of blood) on several sampling days (Fig. 1).


View larger version (32K):
[in this window]
[in a new window]
 
FIG. 1.   Detection of rickettsemic cycles by using competitive PCR. A. marginale organisms were quantitated in blood from two animals, 808 (A) and 807 (B), over an 18-week period.

Since A. marginale organisms replicate within erythrocytes and are microscopically detectable in acute infection, rickettsemia levels have often been described as numbers of infected erythrocytes. To estimate the number of parasitized erythrocytes during persistent infection using competitive PCR, dilutions of known numbers of infected erythrocytes obtained from an experimental acute infection were used. In persistently infected animals, rickettsemia levels corresponded to approximately 107 infected erythrocytes per ml of blood at the highest peaks, 3-12-97 for animal 808 and 3-8-97 for animal 807 (Fig. 1). The low point of the rickettsemic cycles corresponded to approximately 103 infected erythrocytes per ml of blood on 5-31-96 in animal 808 and approximately 102.5 infected erythrocytes per ml of blood on 5-21-97 in animal 807. Samples from the uninfected animal were negative using competitive msp-5 PCR.

Variation in msp-2 transcripts during persistent rickettsemia. To determine whether polymorphic msp-2 genes are expressed during persistent infection, total RNA was extracted from three sequential peaks of rickettsemia in animals 807 and 808, and msp-2 mRNA was amplified by reverse transcription-PCR (RT-PCR). The msp-2 gene-specific primers were selected from conserved regions that flank a central polymorphic region based on alignment of the full-length msp-2 genomic clones, pCKR11.2 msp-2 and DF5 msp-2; a partial genomic clone, pCKR5.2 msp-2; and a cDNA clone from acute rickettsemia, AR5 msp-2 (4, 25). RT-PCR products obtained from each peak of cyclic rickettsemia were cloned, and 10 msp-2 cDNA clones were randomly selected and sequenced. The msp-2 cDNA clones varied in size, ranging from 585 to 600 bp, compared to the 595 bp amplified in the pCKR11.2 msp-2 from acute rickettsemia. As described below, this size polymorphism reflects nucleotide deletions and insertions. Within each peak, the 10 cDNA clones represented a minimum of four unique sequence types. Sequence types are defined based on the variable region shown in Fig. 2, amino acids 185 to 280 (numbering is based on the predicted amino acid sequence of pCKR11.2 msp-2 [25]). To ensure that 10 clones were representative of msp-2 genetic types expressed within a given peak, an additional 10 msp-2 cDNA clones were generated from one peak (animal 808, peak 2), sequenced, and compared to the initial 10 clones from the same peak. This second set of clones had sequences identical to those of the original set of clones (data not shown) and therefore represent the same types.


View larger version (42K):
[in this window]
[in a new window]
 
FIG. 2.   Amino acid sequence alignment of the polymorphic region of types of clones from peak 2 of animal 808 and peak 3 of animal 807. Types of clones for 808 peak 2 are as follows: type I includes clones 9 and 10 (clone 10 has a gap at amino acid 218 relative to clone 9); type II includes clones 6 and 7; type III includes clone 5; type IV includes clone 8; and type V includes clones 1 to 4 (clone 4 has a single amino acid change relative to clones 1 to 3, amino acid 187 Kright-arrowN). Types of clones for 807 peak 3 are as follows: type I includes clones 3 to 6 (clone 6 has an amino acid change relative to clones 3 to 5, amino acid 249 Sright-arrowN); type II includes clone 7; type III includes clones 1 and 2; type IV includes clone 8; type V includes clone 9; and type IV includes clone 10. The central polymorphic region of each type is shown from amino acids 185 to 297 relative to the 11.2 msp-2 clone (25). Areas of amino acid substitutions, insertions, and deletions are indicated by a white background, areas of amino acid identity have a black background, and grey shading indicates conservative amino acid changes. The dots designate deletions.

All msp-2 cDNA clones obtained from both animals have the predicted open reading frame based on the previously sequenced full-length msp-2 clones (4, 25). As a control for sequence polymorphism generated by reverse transcriptase or Taq polymerase misincorporation, specific primers for the single-copy, genus-conserved msp-5 gene were also used in RT-PCR with the same total RNA as a template. Three nucleotide substitutions occurred following RT-PCR and sequencing of 10 457-bp msp-5 cDNA clones. Therefore, relatively few nucleotide changes were generated in the RT-PCR of the total A. marginale RNA; assuming that the three substitutions in a total of 4,570 msp-5 bases sequenced are errors and not true nucleotide changes, this is an error rate of 7 × 10-4, consistent with a predicted error rate of 2 × 10-4 for Taq polymerase (10). In addition, increased error rate of Taq polymerase due to msp-2-specific secondary structure (13) is not likely because comparison of several msp-2 cDNA clones following Taq-based subcloning did not result in nucleotide misincorporations relative to the original clones.

Comparison of all msp-2 cDNA clones representative of the different types obtained from animal 808 revealed a central region of polymorphism between nucleotides 555 and 882 (numbering is based on the full-length pCKR11.2 msp-2 clone [25]). Relative to the other cDNA types obtained from the same animal, the central polymorphic region had insertions, deletions, and substitutions that resulted in amino acid changes (Fig. 2). All msp-2 cDNA types obtained from animal 807 had similar central regions of polymorphism with nucleotide insertions, deletions, and substitutions. Interestingly, comparison of predicted amino acid sequences of all of the clones representative of the different types obtained from animal 808 revealed a distinct hypervariable region that spans amino acid positions 60 to 155 (Fig. 3). Similarly, clones from animal 807 have a prominent hypervariable region that spans amino acid positions 60 to 150 (Fig. 3). These positions represent amino acids 186 to 281 and 186 to 276, respectively, of the predicted amino acid sequence of pCKR11.2 msp-2 (25).


View larger version (16K):
[in this window]
[in a new window]
 
FIG. 3.   Plot similarity of amino acid sequences of all MSP-2 clones obtained from each of three peaks of cyclic rickettsemia in animals 808 and 807. Similarity score is plotted as a function of amino acid position. The dashed line that transects the plot at approximately 1.2 along the y axis indicates the average similarity score of all of the clones. Clones from animal 808 have a distinct hypervariable region that spans amino acid positions 60 to 155, and clones from animal 807 have a single hypervariable region that spans amino acid positions 60 to 150, corresponding to amino acids 186 to 281 and 186 to 276, respectively, of the pCKR11.2 MSP-2 (25).

Comparison of predicted amino acid sequences between peaks revealed a range of identities from 78 to 99% for animal 808 (Table 1). None of the clones representative of the different types obtained from one peak in animal 808 were identical to clones obtained from subsequent peaks. However, in animal 807, several clones from peak 1 recurred in peaks 2 and 3. Type I, represented by identical clones 1-1 and 1-2 from peak 1, showed 100% amino acid identity with clone 2-9 in peak 2 indicating the recurrence of this type. Similarly, type IV, represented by clones 1-5 and 1-6 from peak 1, recurred in peak 3 (clone 3-5 in peak 3), and type VII clone 1-7 from peak 1 showed 100% amino acid identity with peak 3 clones 3-6, 3-7, and 3-8. 

                              
View this table:
[in this window]
[in a new window]
 
TABLE 1.   Comparison of amino acid identity among MSP-2 clones obtained within a peak or from different peaks

Within each peak of cyclic rickettsemia, a minimum of four polymorphic sequence types were identified (Fig. 2). Amino acid sequence identity between clones obtained within the same peak or between any two peaks ranged from 78 to 100% (Table 1). The ranges of amino acid identities within a peak were similar for clones obtained from each of three peaks of cyclic rickettsemia from both animals, 807 and 808 (Table 1). In peaks 1 and 2 from both animals, comparison of clones representing different types revealed clusters around 80 and 90% identity (Fig. 4). As persistent infection progressed in both animals, however, types within peak 3 tended to diverge, with amino acid identities that clustered less and became more evenly distributed from 70 to 97% (Fig. 4).


View larger version (20K):
[in this window]
[in a new window]
 
FIG. 4.   Pairwise comparison of amino acid identity of MSP-2 clone types obtained within peaks 1, 2, and 3 during persistent rickettsemia in animals 808 and 807. Types are defined based on the variable region shown in Fig. 2 and 3, amino acids 186 to 281. Each graph represents a single peak of cyclic rickettsemia. Within the peaks, each type (designated by a symbol) is compared to each of the other clone types obtained from the same peak (designated along the x axis) and plotted as the percent amino acid identity. Comparison of each type with itself is not shown. For example, from animal 808 peak 1, type 1 is compared with type 2 in the second column and the percent amino acid identity is indicated by a circle at 98.5%. Similarly, in the third column, types 1 and 2 are compared to type 3 and designated by a circle at 80% for type 1 and a square at 78% for type 2. In some cases the symbols overlap because the percent amino acid identities are similar; for example, in column 5, types 1 and 2 have similar percent amino acid identities (72.4 and 72.8%, respectively) compared to clone 5; therefore, the square that represents type 2 overlies the circle that represents type 1.

Expression of antigenically distinct MSP-2 during persistent rickettsemia. To investigate whether antigenically distinct MSP-2 molecules were expressed during a single rickettsemic cycle, variant-specific antibodies were used in a two-color immunofluorescence assay. A. marginale-infected erythrocytes were collected at the same time as the blood used to generate MSP-2 clones V3 and V5 (5-10-96 in animal 808). Antibodies were generated against the V3 or V5 variants and cross-adsorbed with purified V5 or V3 protein to ensure variant specificity. Each antibody reacted specifically with its respective polypeptide in immunoblots (Fig. 5). Anti-V3 antibody reacted with the recombinant V3 polypeptide with an apparent molecular size of 27 kDa, and anti-V5 antibody reacted with the recombinant V5 polypeptide with an apparent molecular size of 29 kDa. The 2-kDa difference between the apparent molecular sizes of V3 and V5 reflected the predicted difference attributable to the nucleotide deletions within the polymorphic region of V3 relative to V5 (Fig. 2). The anti-V3 antibody did not react with the 29-kDa V5 polypeptide, nor did the anti-V5 antibody react with the 27-kDa V3 polypeptide. Therefore, these antibodies bound different variant-specific epitopes. Neither antiserum reacted with the negative control B. bigemina RAP-1 polypeptide (Fig. 5), nor did the control anti-IL-4 antibody react with the V3 and V5 polypeptides.


View larger version (11K):
[in this window]
[in a new window]
 
FIG. 5.   Binding of variant-specific antibody to respective MSP-2 polymorphic variants. Recombinant V3 (lanes 3 and 6), V5 (lanes 2 and 5), or the negative control RAP-1 (lanes 1 and 4) was purified, electrophoresed on a polyacrylamide gel, and transferred to nitrocellulose. The membranes were reacted with either anti-V3 (lanes 1 to 3) or anti-V5 (lanes 4 to 6) antibody followed by goat anti-rabbit IgG and developed by using enhanced chemiluminescence.

Immunofluorescence using the specific antibodies, anti-V3 and anti-V5, showed that polymorphic MSP-2 molecules can be coexpressed within a single A. marginale-infected erythrocyte obtained from a peak of cyclic rickettsemia (Fig. 6). These data confirm that A. marginale can contain epitopes encoded by different msp-2 transcripts. However, A. marginale that contained epitopes reactive with either the anti-V3 or anti-V5 antibodies were also identified (data not shown), indicating that a minimum of three antigenic types (V3 only, V5 only, and V3 plus V5) of MSP-2 are expressed within peak 2 of animal 808. The negative control anti-IL-4 antibodies did not bind organisms on the same blood smear.


View larger version (92K):
[in this window]
[in a new window]
 
FIG. 6.   Coexpression of MSP-2 variant types within a single A. marginale-infected erythrocyte. The smears used in the immunofluorescence were made from the same blood used to generate MSP-2 clones V3 and V5. The same microscopic field is shown in both panels. An excitation wavelength of 450 to 490 nm (top) or 546 nm (bottom) was used to detect A. marginale bound by fluorescein-labeled anti-V5 (top) or rhodamine-labeled anti-V3 (bottom) antibodies.

    DISCUSSION
Top
Abstract
Introduction
Materials & Methods
Results
Discussion
References

Recovery from acute A. marginale infection results in persistence characterized by repetitive cyclic fluctuations of rickettsemia (6, 7, 11). Sequential rickettsemic cycles during persistent infection were originally detected by using nucleic acid probe hybridization based on the multicopy msp-1b gene (6, 7, 11). Competitive msp-5 PCR has increased sensitivity over msp-1b probe hybridization, which is limited to approximately 103 infected erythrocytes per ml of blood (6), and allows quantitation of A. marginale based on the single-copy msp-5 gene (36). The rickettsemic cycles in this study occurred at intervals similar to those described previously (6, 7, 11), with major peaks of up to 107 infected erythrocytes per ml of blood occurring every 6 to 8 weeks. Each cycle terminated after the major peak by a dramatic reduction in rickettsemia, hypothesized to reflect a variant-specific immune response (11). Because the number of organisms could be determined in a sample containing a known number of infected erythrocytes, the number of organisms within a single infected erythrocyte could be ascertained. A single A. marginale organism invades and replicates within an erythrocyte, giving rise to a cluster of organisms within each infected erythrocyte (12, 28). The estimated average of two to four organisms per infected erythrocyte determined in this study is consistent with prior studies indicating that a single invading organism replicates one to three times within the erythrocyte (28).

Following identification of rickettsemic cycles by competitive PCR (Fig. 1), msp-2 cDNA clones were sequenced from each rickettsemic peak and shown to have an approximately 300-nucleotide area of polymorphism. The nucleotide changes resulted in amino acid substitutions, deletions, or insertions (Fig. 2). Interestingly, the genetic diversity of msp-2 variants within each peak was similar to that seen in acute infection, during which several classes of variant msp-2 genes are transcribed (4). Within each peak of cyclic rickettsemia, a minimum of four different msp-2 cDNA sequence types were isolated, and the translated amino acid sequences had the predicted open reading frames which were correspondingly polymorphic (Fig. 2). Clones were grouped into types defined by the polymorphic region between amino acids 186 and 281 (Fig. 2). This is a minimal estimate of sequence variation, as some of the sequences have known and may have unknown amino acid changes outside this region. The possibility of creating artificial variants during PCR amplification was considered. The large central region of polymorphism in the msp-2 clones is not likely due to Taq polymerase misincorporation because the number of nucleotide changes in the msp-2 clones is considerably greater than the deduced Taq misincorporation rate and greater than that seen in the msp-5 control, using the same RNA and identical amplification protocol. Because msp-5 is conserved within the genus Anaplasma (36), the low rate of nucleotide polymorphism observed in the msp-5 cDNA clones either reflects slight variation within the Florida strain or was generated in the reverse transcription or elongation during PCR. It has also been suggested that recombinant DNA molecules can form during PCR when two distinct gene sequences are coamplified (16). Polymorphic msp-2 cDNA clones generated in this study are not likely the result of recombination during PCR for several reasons: (i) all of the clones had the predicted msp-2 open reading frames, (ii) generation and sequencing of an additional 10 clones from peak 2 (5-10-96) of animal 808 yielded identical sequences, and (iii) frequency of homologous recombination is low (16) and would therefore not account for the high frequency of polymorphism observed in the msp-2 cDNA clones. Moreover, frequency of homologous recombination can be further reduced by an adequate DNA polymerase elongation time (16), a parameter that was taken into consideration in designing these experiments. Consequently, based on these data, we conclude that the observed MSP-2 polymorphism was generated in vivo, consistent with the msp-2 polymorphism in the genome (25).

The polymorphism of MSP-2 variants within each peak was prominent, with predicted amino acid sequence identities for clones ranging from approximately 80 to 100% (Table 1) and the identity between clones representing different types clustering around 80 and 90% (Fig. 4). Interestingly, the range of amino acid identities of clones representative of each type compared to other clones representative of different types obtained from within the same peak was similar to the range of amino acid identities of clones compared between any two peaks (Table 1). Comparison of AR5, an msp-2 cDNA clone transcribed during acute infection (4), with msp-2 cDNA clones from each peak in persistent infection showed blocks of identity between the acute and persistent infection types. However, none of the clones were 100% identical between acute and persistent infection. The occurrence of polymorphic msp-2 transcripts during rickettsemic cycles in persistent infection together with the polymorphism between AR5, an msp-2 clone from acute infection, and the msp-2 clones from persistent infection supports our hypothesis that polymorphic msp-2 variants emerge during rickettsemic cycles in persistent infection.

Even though multiple polymorphic msp-2 transcripts occurred within a peak, whether the whole population of emergent organisms expresses the same set of MSP-2 molecules was not known. Dual-staining immunofluorescence confirms that a minimum of three antigenically distinct populations are present in a single peak: rickettsia-expressed MSP-2 recognized only by the anti-V3 variant-specific antibody, MSP-2 recognized only by anti-V5 variant-specific antibody, or MSP-2 recognized by both antibodies. Expression of MSP-2 recognized by both antibodies (Fig. 6) may reflect two separate MSP-2 molecules expressed in the same A. marginale organism or expression of a hybrid MSP-2 including both V3 and V5 epitopes; less likely, native V3 MSP-2 is bound by anti-V5 antibody due to cross-reacting epitopes not represented in the recombinant proteins used in adsorption. Nonetheless, it is clear that complete clearance by immune responses to MSP-2 requires recognition of a combination of MSP-2 epitopes. During acute A. marginale infection, multiple MSP-2 antigenic variants are expressed (4), followed by development of a primary immune response which eliminates >99% of the rickettsiae but fails to completely clear the infection (11). Each rickettsemic cycle during persistent infection also attains a high-level peak rickettsemia that rapidly declines, similar to acute infection, and may result from recognition of most but not all variant MSP-2 by a new primary immune response.

Multiple msp-2 variant types emerge within each peak of cyclic rickettsemia. However, a few variant types recur in subsequent peaks; either these variant types evaded the existing immune response or their emergence is unrelated to immune pressure and persistence. Recurrent types were always accompanied by emergence of new variant types. Expression of recurrent types together with new types may contribute to the formation of new epitopes that were not previously recognized by the immune response. Because MSP-2 dimerizes on the surface of A. marginale (35), simultaneous expression of variants within a single organism could result in formation of conformationally unique epitopes. If a few organisms expressing a unique combination of variant MSP-2 are able to escape immune clearance in one rickettsemic cycle, then a new population of A. marginale expressing the combination of a recurrent type and a newly generated variant MSP-2 may emerge in the subsequent cycle. Another possibility is that other hypervariable regions occur 5' or 3' of the central polymorphic region and may result in expression of unique MSP-2 variants that are identical in the central polymorphic region examined in this study. Whether the expression of variant MSP-2 molecules results in a completely antigenically distinct population in each peak and how the immune system controls each rickettsemic cycle are unknown and appear to be critical for understanding the role of antigenic variation in persistent rickettsemia.

    ACKNOWLEDGMENTS

We thank Curtis Brandt for excellent technical assistance and William P. Cheevers, Isidro Hötzel, and Carlos Suarez for helpful comments and discussion. We also acknowledge Jeff Abbott, Ignacio Echaide, Carla Robertson, and Bev Hunter for technical advice and support and Barbara von Beust for providing the anti-bovine IL-4 serum.

This work was supported by NIH/NIAID grant 5 K08 AI01371-02, USDA grant 95-372204-2348, the U.S.-Israel BARD program, and AVMF grant 96-09.

    FOOTNOTES

* Corresponding author. Mailing address: Department of Veterinary Microbiology and Pathology, Washington State University, Pullman, WA 99164-7040. Phone: (509) 335-6030. Fax: (509) 335-8529. E-mail: dmf{at}vetmed.wsu.edu.

Editor:  P. E. Orndorff

    REFERENCES
Top
Abstract
Introduction
Materials & Methods
Results
Discussion
References

1. Barbet, A. F., S. M. Semu, N. Chigagure, P. J. Kelly, F. Jongejan, and S. M. Mahan. 1994. Size variation of the major immunodominant protein of Cowdria ruminantium. Clin. Diagn. Lab. Immunol. 1:744-746[Abstract/Free Full Text].
2. Bouboula, M., P. Legoux, B. Pességué, B. Delpech, X. Dumont, M. Piechaczyk, P. Casellas, and D. Shire. 1992. Standardization of mRNA titration using a polymerase chain reaction method involving co-amplification with a multispecific internal control. J. Biol. Chem. 267:21830-21838[Abstract/Free Full Text].
3. Brouqui, P., J. S. Dumler, D. Raoult, and D. H. Walker. 1992. Antigenic characterization of ehrlichiae: protein immunoblotting of Ehrlichia canis, Ehrlichia sennetsu, and Ehrlichia risticii. J. Clin. Microbiol. 30:1062-1066[Abstract/Free Full Text].
4. Eid, G., D. M. French, A. M. Lundgren, A. F. Barbet, T. F. McElwain, and G. H. Palmer. 1996. Expression of major surface protein 2 antigenic variants during acute Anaplasma marginale rickettsemia. Infect. Immun. 64:836-841[Abstract].
5. Eisemann, G. H., and J. V. Osterman. 1997. Identification of strain-specific and group-reactive antigenic determinants on the Karp, Gilliam, and Kato strains of Rickettsia tsutsugamushi. Am. J. Trop. Med. Hyg. 34:1173-1178.
6. Eriks, I. S., G. H. Palmer, T. C. McGuire, D. R. Allred, and A. F. Barbet. 1989. Detection and quantitation of Anaplasma marginale in carrier cattle by using a nucleic acid probe. J. Clin. Microbiol. 27:279-284[Abstract/Free Full Text].
7. Eriks, I. S., D. Stiller, and G. H. Palmer. 1993. Impact of persistent Anaplasma marginale rickettsemia on tick infection and transmission. J. Clin. Microbiol. 31:2091-2096[Abstract/Free Full Text].
8. Hanson, B. 1985. Identification and partial characterization of Rickettsia tsutsugamushi major protein immunogens. Infect. Immun. 50:603-609[Abstract/Free Full Text].
9. Harlow, E., and D. Lane. 1988. , p. 321-359. Antibodies: a laboratory manual Cold Spring Harbor Laboratory, Cold Spring Harbor, N.Y.
10. Keohavong, P., and W. G. Thilly. 1989. Fidelity of DNA polymerases in DNA amplification. Proc. Natl. Acad. Sci. USA 86:9253-9257[Abstract/Free Full Text].
11. Kieser, S. T., I. S. Eriks, and G. H. Palmer. 1990. Cyclic rickettsemia during persistent Anaplasma marginale infection of cattle. Infect. Immun. 58:1117-1119[Abstract/Free Full Text].
12. Krier, J. P., R. Gothe, G. M. Ihler, H. E. Krampitz, G. Mernaugh, and G. H. Palmer. 1991. The hemotrophic bacteria: the families Bartonellaciae and Anaplasmataceae, p. 3994-4022. In A. Balows, H. G. Truper, M. Dworkin, W. Harder, and K. H. Schleifer (ed.), The prokaryotes: a handbook on the biology of bacteria: ecophysiology, isolation, identification, applications. Springer-Verlag, New York, N.Y.
13. Loewen, P. C., and J. Switala. 1995. Template secondary structure can increase the error frequency of the DNA polymerase from Thermus aquaticus. Gene 164:59-63[Medline].
14. Losos, G. J. 1986. Anaplasmosis, p. 743-795. In G. J. Losos (ed.), Infectious tropical diseases of domestic animals. Longman Press, Essex, United Kingdom.
15. McGuire, T. C., G. H. Palmer, W. L. Goff, M. I. Johnson, and W. C. Davis. 1984. Common and isolate-restricted antigens of Anaplasma marginale detected with monoclonal antibodies. Infect. Immun. 45:697-700[Abstract/Free Full Text].
16. Meyerhans, A., J. P. Vartanian, and S. Wain-Hobson. 1990. DNA recombination during PCR. Nucleic Acids Res. 18:1687-1691[Abstract/Free Full Text].
17. Murata, M., Y. Yoshida, M. Osono, N. Ohashi, M. Oyanagi, H. Urakami, A. Tamura, S. Nogami, H. Tanaka, and A. J. Kawamura. 1986. Production and characterization of monoclonal strain-specific antibodies against prototype strains of Rickettsia tsutsugamushi. Microbiol. Immunol. 30:599-610[Medline].
18. Oaks, E. V., C. K. Stover, and R. M. Rice. 1987. Molecular cloning and expression of Rickettsia tsutsugamushi genes for two major protein antigens in Escherichia coli. Infect. Immun. 55:1156-1162[Abstract/Free Full Text].
19. Oaks, E. V., R. M. Rice, D. J. Kelly, and C. K. Stover. 1989. Antigenic and genetic relatedness of eight Rickettsia tsutsugamushi antigens. Infect. Immun. 57:3116-3122[Abstract/Free Full Text].
20. Ohashi, N., A. Tamura, M. Ohta, and K. Hayashi. 1989. Purification and partial characterization of a type-specific antigen of Rickettsia tsutsugamushi. Infect. Immun. 57:1427-1431[Abstract/Free Full Text].
21. Ohashi, N., H. Nashimoto, H. Ikeda, and A. Tamura. 1992. Diversity of immunodominant 56-kDa type-specific antigen (TSA) of Rickettsia tsutsugamushi. Sequence and comparative analyses of the genes encoding TSA homologues from four antigenic variants. J. Biol. Chem. 267:12728-12735[Abstract/Free Full Text].
22. Palmer, G. H., and T. C. McGuire. 1984. Immune serum against Anaplasma marginale initial bodies neutralizes infectivity for cattle. J. Immunol. 133:1010-1015[Abstract].
23. Palmer, G. H., A. F. Barbet, W. C. Davis, and T. C. McGuire. 1986. Immunization with an isolate-common surface protein protects cattle against anaplasmosis. Science 231:1299-1302[Abstract/Free Full Text].
24. Palmer, G. H., S. M. Oberle, A. F. Barbet, W. L. Goff, W. C. Davis, and T. C. McGuire. 1988. Immunization of cattle with a 36-kilodalton surface protein induces protection against homologous and heterologous Anaplasma marginale challenge. Infect. Immun. 56:1526-1531[Abstract/Free Full Text].
25. Palmer, G. H., G. Eid, A. F. Barbet, T. C. McGuire, and T. F. McElwain. 1994. The immunoprotective Anaplasma marginale major surface protein 2 is encoded by a polymorphic multigene family. Infect. Immun. 62:3808-3816[Abstract/Free Full Text].
26. Palmer, G. H., and T. F. McElwain. 1995. Molecular basis for vaccine development against anaplasmosis and babesiosis. Vet. Parasitol. 57:233-253[Medline].
27. Reddy, G. R., C. R. Sulsona, R. H. Harrison, S. M. Mahan, M. J. Burridge, and A. F. Barbet. 1996. Sequence heterogeneity of the major antigenic protein 1 genes from Cowdria ruminantium isolates from different geographical areas. Clin. Diagn. Lab. Immunol. 3:417-422[Abstract].
28. Ristic, M., and A. M. Watrach. 1963. Anaplasmosis. VI. Studies and a hypothesis concerning the cycle of development of the causative agent. Am. J. Vet. Res. 24:267-277.
29. Seong, S. Y., M. S. Huh, W. J. Jang, S. G. Park, J. G. Kim, S. G. Woo, M. S. Choi, I. S. Kim, and W. H. Chang. 1997. Induction of homologous immune response to Rickettsia tsutsugamushi Boryong with a partial 56-kilodalton recombinant antigen fused with the maltose-binding protein MBP-Bor56. Infect. Immun. 65:1541-1545[Abstract].
30. Stover, C. K., D. P. Marana, J. M. Carter, B. A. Roe, E. Mardis, and E. V. Oaks. 1990. The 56-kilodalton major protein antigen of Rickettsia tsutsugamushi: molecular cloning and sequence analysis of the sta56 gene and precise identification of a strain-specific epitope. Infect. Immun. 58:2076-2084[Abstract/Free Full Text].
31. Tamura, A., N. Ohashi, H. Urakami, K. Takahashi, and M. Oyanagi. 1985. Analysis of polypeptide composition and antigenic components of Rickettsia tsutsugamushi by polyacrylamide gel electrophoresis and immunoblotting. Infect. Immun. 48:671-675[Abstract/Free Full Text].
32. van Vliet, A. H., F. Jongejan, M. van Kleef, and B. A. van der Zeijst. 1994. Molecular cloning, sequence analysis, and expression of the gene encoding the immunodominant 32-kilodalton protein of Cowdria ruminantium. Infect. Immun. 62:1451-1456[Abstract/Free Full Text].
33. van Vliet, A. H., B. A. van der Zeijst, E. Camus, S. M. Mahan, D. Martinez, and F. Jongejan. 1995. Use of a specific immunogenic region on the Cowdria ruminantium MAP1 protein in a serological assay. J. Clin. Microbiol. 33:2405-2410[Abstract].
34. van Vliet, A. H., B. A. van der Zeijst, E. Camus, S. M. Mahan, D. Martinez, and F. Jongejan. 1996. Recombinant expression and use in serology of a specific fragment from the Cowdria ruminantium MAP1 protein. Ann. N. Y. Acad. Sci. 791:35-45[Medline].
35. Vidotto, M. C., T. C. McGuire, T. F. McElwain, G. H. Palmer, and D. P. J. Knowles. 1994. Intermolecular relationships of major surface proteins of Anaplasma marginale. Infect. Immun. 62:2940-2946[Abstract/Free Full Text].
36. Visser, E. S., T. C. McGuire, G. H. Palmer, W. C. Davis, V. Shkap, E. Pipano, and D. P. J. Knowles. 1992. The Anaplasma marginale msp5 gene encodes a 19-kilodalton protein conserved in all recognized Anaplasma species. Infect. Immun. 60:5139-5144[Abstract/Free Full Text].
37. Wanduragala, L., and M. Ristic. 1993. Anaplasmosis, p. 65-87. In Z. Woldehiwet, and M. Ristic (ed.), Rickettsial and chlamydial diseases of domestic animals. Pergamon Press, Oxford, United Kingdom.


Infect Immun, March 1998, p. 1200-1207, Vol. 66, No. 3
0019-9567/98/$04.00+0
Copyright © 1998, American Society for Microbiology. All rights reserved.



This article has been cited by other articles:

  • Futse, J. E., Brayton, K. A., Nydam, S. D., Palmer, G. H. (2009). Generation of Antigenic Variants via Gene Conversion: Evidence for Recombination Fitness Selection at the Locus Level in Anaplasma marginale. Infect. Immun. 77: 3181-3187 [Abstract] [Full Text]  
  • Barbet, A. F., Byrom, B., Mahan, S. M. (2009). Diversity of Ehrlichia ruminantium Major Antigenic Protein 1-2 in Field Isolates and Infected Sheep. Infect. Immun. 77: 2304-2310 [Abstract] [Full Text]  
  • Han, S., Norimine, J., Palmer, G. H., Mwangi, W., Lahmers, K. K., Brown, W. C. (2008). Rapid Deletion of Antigen-Specific CD4+ T Cells following Infection Represents a Strategy of Immune Evasion and Persistence for Anaplasma marginale. J. Immunol. 181: 7759-7769 [Abstract] [Full Text]  
  • Futse, J. E., Brayton, K. A., Dark, M. J., Knowles, D. P. Jr., Palmer, G. H. (2008). Superinfection as a driver of genomic diversification in antigenically variant pathogens. Proc. Natl. Acad. Sci. USA 105: 2123-2127 [Abstract] [Full Text]  
  • Granquist, E. G., Stuen, S., Lundgren, A. M., Braten, M., Barbet, A. F. (2008). Outer Membrane Protein Sequence Variation in Lambs Experimentally Infected with Anaplasma phagocytophilum. Infect. Immun. 76: 120-126 [Abstract] [Full Text]  
  • delos Santos, J. R. C., Boughan, K., Bremer, W. G., Rizzo, B., Schaefer, J. J., Rikihisa, Y., Needham, G. R., Capitini, L. A., Anderson, D. E., Oglesbee, M., Ewing, S. A., Stich, R. W. (2007). Experimental infection of dairy calves with Ehrlichia chaffeensis. J Med Microbiol 56: 1660-1668 [Abstract] [Full Text]  
  • Zhuang, Y., Futse, J. E., Brown, W. C., Brayton, K. A., Palmer, G. H. (2007). Maintenance of Antibody to Pathogen Epitopes Generated by Segmental Gene Conversion Is Highly Dynamic during Long-Term Persistent Infection. Infect. Immun. 75: 5185-5190 [Abstract] [Full Text]  
  • Palmer, G. H., Futse, J. E., Leverich, C. K., Knowles, D. P. Jr., Rurangirwa, F. R., Brayton, K. A. (2007). Selection for Simple Major Surface Protein 2 Variants during Anaplasma marginale Transmission to Immunologically Naive Animals. Infect. Immun. 75: 1502-1506 [Abstract] [Full Text]  
  • Ganta, R. R., Cheng, C., Miller, E. C., McGuire, B. L., Peddireddi, L., Sirigireddy, K. R., Chapes, S. K. (2007). Differential Clearance and Immune Responses to Tick Cell-Derived versus Macrophage Culture-Derived Ehrlichia chaffeensis in Mice. Infect. Immun. 75: 135-145 [Abstract] [Full Text]  
  • Barbet, A. F., Lundgren, A. M., Alleman, A. R., Stuen, S., Bjoersdorff, A., Brown, R. N., Drazenovich, N. L., Foley, J. E. (2006). Structure of the Expression Site Reveals Global Diversity in MSP2 (P44) Variants in Anaplasma phagocytophilum. Infect. Immun. 74: 6429-6437 [Abstract] [Full Text]  
  • Macmillan, H., Brayton, K. A., Palmer, G. H., McGuire, T. C., Munske, G., Siems, W. F., Brown, W. C. (2006). Analysis of the Anaplasma marginale Major Surface Protein 1 Complex Protein Composition by Tandem Mass Spectrometry. J. Bacteriol. 188: 4983-4991 [Abstract] [Full Text]  
  • Noh, S. M., Brayton, K. A., Knowles, D. P., Agnes, J. T., Dark, M. J., Brown, W. C., Baszler, T. V., Palmer, G. H. (2006). Differential Expression and Sequence Conservation of the Anaplasma marginale msp2 Gene Superfamily Outer Membrane Proteins.. Infect. Immun. 74: 3471-3479 [Abstract] [Full Text]  
  • Wang, X., Kikuchi, T., Rikihisa, Y. (2006). Two Monoclonal Antibodies with Defined Epitopes of P44 Major Surface Proteins Neutralize Anaplasma phagocytophilum by Distinct Mechanisms. Infect. Immun. 74: 1873-1882 [Abstract] [Full Text]  
  • Abbott, J. R., Palmer, G. H., Kegerreis, K. A., Hetrick, P. F., Howard, C. J., Hope, J. C., Brown, W. C. (2005). Rapid and Long-Term Disappearance of CD4+ T Lymphocyte Responses Specific for Anaplasma Marginale Major Surface Protein-2 (MSP2) in MSP2 Vaccinates following Challenge with Live A. marginale. J. Immunol. 174: 6702-6715 [Abstract] [Full Text]  
  • Lahmers, K. K., Norimine, J., Abrahamsen, M. S., Palmer, G. H., Brown, W. C. (2005). The CD4+ T cell immunodominant Anaplasma marginale major surface protein 2 stimulates {gamma}{delta} T cell clones that express unique T cell receptors. J. Leukoc. Biol. 77: 199-208 [Abstract] [Full Text]  
  • Brayton, K. A., Kappmeyer, L. S., Herndon, D. R., Dark, M. J., Tibbals, D. L., Palmer, G. H., McGuire, T. C., Knowles, D. P. Jr. (2005). Complete genome sequencing of Anaplasma marginale reveals that the surface is skewed to two superfamilies of outer membrane proteins. Proc. Natl. Acad. Sci. USA 102: 844-849 [Abstract] [Full Text]  
  • Wang, X., Rikihisa, Y., Lai, T.-H., Kumagai, Y., Zhi, N., Reed, S. M. (2004). Rapid Sequential Changeover of Expressed p44 Genes during the Acute Phase of Anaplasma phagocytophilum Infection in Horses. Infect. Immun. 72: 6852-6859 [Abstract] [Full Text]  
  • Stich, R. W., Olah, G. A., Brayton, K. A., Brown, W. C., Fechheimer, M., Green-Church, K., Jittapalapong, S., Kocan, K. M., McGuire, T. C., Rurangirwa, F. R., Palmer, G. H. (2004). Identification of a Novel Anaplasma marginale Appendage-Associated Protein That Localizes with Actin Filaments during Intraerythrocytic Infection. Infect. Immun. 72: 7257-7264 [Abstract] [Full Text]  
  • Abbott, J. R., Palmer, G. H., Howard, C. J., Hope, J. C., Brown, W. C. (2004). Anaplasma marginale Major Surface Protein 2 CD4+-T-Cell Epitopes Are Evenly Distributed in Conserved and Hypervariable Regions (HVR), Whereas Linear B-Cell Epitopes Are Predominantly Located in the HVR. Infect. Immun. 72: 7360-7366 [Abstract] [Full Text]  
  • Brown, W. C., Palmer, G. H., Brayton, K. A., Meeus, P. F. M., Barbet, A. F., Kegerreis, K. A., McGuire, T. C. (2004). CD4+ T Lymphocytes from Anaplasma marginale Major Surface Protein 2 (MSP2) Vaccinees Recognize Naturally Processed Epitopes Conserved in MSP3. Infect. Immun. 72: 3688-3692 [Abstract] [Full Text]  
  • Brayton, K. A., Meeus, P. F. M., Barbet, A. F., Palmer, G. H. (2003). Simultaneous Variation of the Immunodominant Outer Membrane Proteins, MSP2 and MSP3, during Anaplasma marginale Persistence In Vivo. Infect. Immun. 71: 6627-6632 [Abstract] [Full Text]  
  • Kocan, K. M., de la Fuente, J., Guglielmone, A. A., Melendez, R. D. (2003). Antigens and Alternatives for Control of Anaplasma marginale Infection in Cattle. Clin. Microbiol. Rev. 16: 698-712 [Abstract] [Full Text]  
  • Lin, Q., Rikihisa, Y., Ohashi, N., Zhi, N. (2003). Mechanisms of Variable p44 Expression by Anaplasma phagocytophilum. Infect. Immun. 71: 5650-5661 [Abstract] [Full Text]  
  • Li, J. S.-y., Winslow, G. M. (2003). Survival, Replication, and Antibody Susceptibility of Ehrlichia chaffeensis outside of Host Cells. Infect. Immun. 71: 4229-4237 [Abstract] [Full Text]  
  • Brown, W. C., Brayton, K. A., Styer, C. M., Palmer, G. H. (2003). The Hypervariable Region of Anaplasma marginale Major Surface Protein 2 (MSP2) Contains Multiple Immunodominant CD4+ T Lymphocyte Epitopes That Elicit Variant-Specific Proliferative and IFN-{gamma} Responses in MSP2 Vaccinates. J. Immunol. 170: 3790-3798 [Abstract] [Full Text]  
  • Lohr, C. V., Brayton, K. A., Shkap, V., Molad, T., Barbet, A. F., Brown, W. C., Palmer, G. H. (2002). Expression of Anaplasma marginale Major Surface Protein 2 Operon-Associated Proteins during Mammalian and Arthropod Infection. Infect. Immun. 70: 6005-6012 [Abstract] [Full Text]  
  • Brown, W. C., McGuire, T. C., Mwangi, W., Kegerreis, K. A., Macmillan, H., Lewin, H. A., Palmer, G. H. (2002). Major Histocompatibility Complex Class II DR-Restricted Memory CD4+ T Lymphocytes Recognize Conserved Immunodominant Epitopes of Anaplasma marginale Major Surface Protein 1a. Infect. Immun. 70: 5521-5532 [Abstract] [Full Text]  
  • IJdo, J. W., Wu, C., Telford III, S. R., Fikrig, E. (2002). Differential Expression of the p44 Gene Family in the Agent of Human Granulocytic Ehrlichiosis. Infect. Immun. 70: 5295-5298 [Abstract] [Full Text]  
  • Lin, Q., Zhi, N., Ohashi, N., Horowitz, H. W., Aguero-Rosenfeld, M. E., Raffalli, J., Wormser, G. P., Rikihisa, Y. (2002). Analysis of Sequences and Loci of p44 Homologs Expressed by Anaplasma phagocytophila in Acutely Infected Patients. J. Clin. Microbiol. 40: 2981-2988 [Abstract] [Full Text]  
  • Shkap, V., Molad, T., Brayton, K. A., Brown, W. C., Palmer, G. H. (2002). Expression of Major Surface Protein 2 Variants with Conserved T-Cell Epitopes in Anaplasma centrale Vaccinates. Infect. Immun. 70: 642-648 [Abstract] [Full Text]  
  • Stich, R. W., Rikihisa, Y., Ewing, S. A., Needham, G. R., Grover, D. L., Jittapalapong, S. (2002). Detection of Ehrlichia canis in Canine Carrier Blood and in Individual Experimentally Infected Ticks with a p30-Based PCR Assay. J. Clin. Microbiol. 40: 540-546 [Abstract] [Full Text]  
  • Unver, A., Ohashi, N., Tajima, T., Stich, R. W., Grover, D., Rikihisa, Y. (2001). Transcriptional Analysis of p30 Major Outer Membrane Multigene Family of Ehrlichia canis in Dogs, Ticks, and Cell Culture at Different Temperatures. Infect. Immun. 69: 6172-6178 [Abstract] [Full Text]  
  • de la Fuente, J., Kocan, K. M. (2001). Expression of Anaplasma marginale Major Surface Protein 2 Variants in Persistently Infected Ticks. Infect. Immun. 69: 5151-5156 [Abstract] [Full Text]  
  • Barbet, A. F., Yi, J., Lundgren, A., McEwen, B. R., Blouin, E. F., Kocan, K. M. (2001). Antigenic Variation of Anaplasma Marginale: Major Surface Protein 2 Diversity during Cyclic Transmission between Ticks and Cattle. Infect. Immun. 69: 3057-3066 [Abstract] [Full Text]  
  • Liang, F. T., Bowers, L. C., Philipp, M. T. (2001). C-Terminal Invariable Domain of VlsE Is Immunodominant but Its Antigenicity Is Scarcely Conserved among Strains of Lyme Disease Spirochetes. Infect. Immun. 69: 3224-3231 [Abstract] [Full Text]  
  • Palmer, G. H., Rurangirwa, F. R., McElwain, T. F. (2001). Strain Composition of the Ehrlichia Anaplasma marginale within Persistently Infected Cattle, a Mammalian Reservoir for Tick Transmission. J. Clin. Microbiol. 39: 631-635 [Abstract] [Full Text]  
  • Shu-yi Li, J., Yager, E., Reilly, M., Freeman, C., Reddy, G. R., Reilly, A. A., Chu, F. K., Winslow, G. M. (2001). Outer Membrane Protein-Specific Monoclonal Antibodies Protect SCID Mice from Fatal Infection by the Obligate Intracellular Bacterial Pathogen Ehrlichia chaffeensis. J. Immunol. 166: 1855-1862 [Abstract] [Full Text]  
  • Brown, W. C., McGuire, T. C., Zhu, D., Lewin, H. A., Sosnow, J., Palmer, G. H. (2001). Highly Conserved Regions of the Immunodominant Major Surface Protein 2 of the Genogroup II Ehrlichial Pathogen Anaplasma marginale Are Rich in Naturally Derived CD4+ T Lymphocyte Epitopes that Elicit Strong Recall Responses. J. Immunol. 166: 1114-1124 [Abstract] [Full Text]  
  • Barbet, A. F., Lundgren, A., Yi, J., Rurangirwa, F. R., Palmer, G. H. (2000). Antigenic Variation of Anaplasma marginale by Expression of MSP2 Mosaics. Infect. Immun. 68: 6133-6138 [Abstract] [Full Text]  
  • Rurangirwa, F. R., Stiller, D., Palmer, G. H. (2000). Strain Diversity in Major Surface Protein 2 Expression during Tick Transmission of Anaplasma marginale. Infect. Immun. 68: 3023-3027 [Abstract] [Full Text]  
  • Camacho-Nuez, M., de Lourdes Munoz, M., Suarez, C. E., McGuire, T. C., Brown, W. C., Palmer, G. H. (2000). Expression of Polymorphic msp1beta Genes during Acute Anaplasma marginale Rickettsemia. Infect. Immun. 68: 1946-1952 [Abstract] [Full Text]  
  • Tuo, W., Palmer, G. H., McGuire, T. C., Zhu, D., Brown, W. C. (2000). Interleukin-12 as an Adjuvant Promotes Immunoglobulin G and Type 1 Cytokine Recall Responses to Major Surface Protein 2 of the Ehrlichial Pathogen Anaplasma marginale. Infect. Immun. 68: 270-280 [Abstract] [Full Text]  
  • French, D. M., Brown, W. C., Palmer, G. H. (1999). Emergence of Anaplasma marginale Antigenic Variants during Persistent Rickettsemia. Infect. Immun. 67: 5834-5840 [Abstract] [Full Text]  
  • Ijdo, J. W., Wu, C., Magnarelli, L. A., Fikrig, E. (1999). Serodiagnosis of Human Granulocytic Ehrlichiosis by a Recombinant HGE-44-Based Enzyme-Linked Immunosorbent Assay. J. Clin. Microbiol. 37: 3540-3544 [Abstract] [Full Text]  
  • Walls, J. J., Aguero-Rosenfeld, M., Bakken, J. S., Goodman, J. L., Hossain, D., Johnson, R. C., Dumler, J. S. (1999). Inter- and Intralaboratory Comparison of Ehrlichia equi and Human Granulocytic Ehrlichiosis (HGE) Agent Strains for Serodiagnosis of HGE by the Immunofluorescent-Antibody Test. J. Clin. Microbiol. 37: 2968-2973 [Abstract] [Full Text]  
  • Zhi, N., Ohashi, N., Rikihisa, Y. (1999). Multiple p44 Genes Encoding Major Outer Membrane Proteins Are Expressed in the Human Granulocytic Ehrlichiosis Agent. J. Biol. Chem. 274: 17828-17836 [Abstract] [Full Text]  
  • Rurangirwa, F. R., Stiller, D., French, D. M., Palmer, G. H. (1999). Restriction of major surface protein 2 (MSP2) variants during tick transmission of the ehrlichia Anaplasma marginale. Proc. Natl. Acad. Sci. USA 96: 3171-3176 [Abstract] [Full Text]  
  • Barbet, A. F., Blentlinger, R., Yi, J., Lundgren, A. M., Blouin, E. F., Kocan, K. M. (1999). Comparison of Surface Proteins of Anaplasma marginale Grown in Tick Cell Culture, Tick Salivary Glands, and Cattle. Infect. Immun. 67: 102-107 [Abstract] [Full Text]  
  • Palmer, G. H., Abbott, J. R., French, D. M., McElwain, T. F. (1998). Persistence of Anaplasma ovis Infection and Conservation of the msp-2 and msp-3 Multigene Families within the Genus Anaplasma. Infect. Immun. 66: 6035-6039 [Abstract] [Full Text]  
  • Brown, W. C., Shkap, V., Zhu, D., McGuire, T. C., Tuo, W., McElwain, T. F., Palmer, G. H. (1998). CD4+ T-Lymphocyte and Immunoglobulin G2 Responses in Calves Immunized with Anaplasma marginale Outer Membranes and Protected against Homologous Challenge. Infect. Immun. 66: 5406-5413 [Abstract] [Full Text]  
  • Brown, W. C., Zhu, D., Shkap, V., McGuire, T. C., Blouin, E. F., Kocan, K. M., Palmer, G. H. (1998). The Repertoire of Anaplasma marginale Antigens Recognized by CD4+ T-Lymphocyte Clones from Protectively Immunized Cattle Is Diverse and Includes Major Surface Protein 2 (MSP-2) and MSP-3. Infect. Immun. 66: 5414-5422 [Abstract] [Full Text]  

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow An erratum has been published
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowReprints and Permissions
Right arrow Copyright Information
Right arrow Books from ASM Press
Right arrow MicrobeWorld
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by French, D. M.
Right arrow Articles by Palmer, G. H.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by French, D. M.
Right arrow Articles by Palmer, G. H.