Previous Article | Next Article 
Infect Immun, March 1998, p. 980-986, Vol. 66, No. 3
0019-9567/98/$04.00+0
Copyright © 1998, American Society for Microbiology. All rights reserved.
A Monoclonal Antibody Generated by Antigen Inoculation via Tick
Bite Is Reactive to the Borrelia burgdorferi Rev
Protein, a Member of the 2.9 Gene Family Locus
Robert D.
Gilmore Jr.1,* and
M.
Lamine
Mbow2
Division of Vector-Borne Infectious Diseases,
National Center for Infectious Diseases, Centers for Disease Control
and Prevention,1 and
Department of
Pathology, Colorado State University,2 Fort
Collins, Colorado
Received 29 July 1997/Returned for modification 3 September
1997/Accepted 5 December 1997
 |
ABSTRACT |
Murine monoclonal antibodies directed against proteins of
Borrelia burgdorferi B31 (low passage) were generated by
the administration of antigen via the bite of borrelia-infected ticks.
This strategy was employed as a mechanism to create antibodies against
antigens presented by the natural route of tick transmission versus
those presented by inoculation with cultured borreliae. One of the
resultant antibodies reacted with a 17-kDa antigen from cultured
B. burgdorferi, as seen by immunoblot analysis. This
antibody was used to screen a B. burgdorferi genomic
DNA lambda vector expression library, and an immunoreactive clone was
isolated. DNA sequence analysis of this clone, containing a 2.7-kb
insert, revealed several open reading frames. These open reading frames
were found to be homologs of genes discovered as a multicopy gene
family in the 297 strain of B. burgdorferi by Porcella
et al. (S. F. Porcella, T. G. Popova, D. R. Akins, M. Li, J. D. Radolf, and M. V. Norgard, J. Bacteriol. 178:3293-3307, 1996). By selectively subcloning genes found in this
insert into an Escherichia coli plasmid expression vector, the observation was made that the rev gene product was the
protein reactive with the 17-kDa-specific monoclonal antibody. The
rev gene product was found to be expressed in
low-passage, but not in high-passage, B. burgdorferi B31. Correspondingly, the rev gene was
not present in strain B31 genomic DNA from cultures that had been
passaged >50 times. Serum samples from Lyme disease patients demonstrated an antibody response against the Rev protein. The generation of an anti-Rev response in Lyme disease patients, and in
mice by tick bite inoculation, provides evidence that the Rev protein
is expressed and immunogenic during the course of natural transmission
and infection.
 |
INTRODUCTION |
Lyme disease is caused by pathogenic
species of the Borrelia burgdorferi sensu lato complex
(4, 16), which are transmitted to humans by the bite of
Ixodes ticks, and results in a wide range of clinical
manifestations if left untreated (11, 18, 31). The
mechanisms involved in the spread and dissemination of the organism to
various tissues and organ systems of the host are not well defined;
however, studies to identify potential virulence factors responsible
for transmission and infection have centered on several outer surface
membrane-associated proteins (3, 10, 17, 19, 21, 24). The
genes encoding these proteins have been localized to extrachromosomal
plasmids (2, 25), which, along with a linear chromosome
(8), make up the B. burgdorferi genome.
Although a correlation has been made between plasmid loss caused by
prolonged culture passage and subsequent loss of the organism's
infectivity (15, 22, 27, 29, 35), there has not been a
direct link established to any gene products responsible for this
phenomenon.
When grown in culture in vitro, B. burgdorferi differs
phenotypically from its state associated with the tick. Some genes that
are expressed only in the mammalian host following transmission, and
that are not seen in medium-cultured borrelia, have been described (1, 7, 9, 20, 33, 34). Also, the genes expressing outer
surface protein A (OspA) and OspC have been shown to be regulated by
factors involved during tick feeding (28). Therefore, in
studying factors that may be involved in mechanisms of the infectious
process, it is important to recognize the differences in borrelia
protein expression between the two environments.
This report involves one of several monoclonal antibodies (MAbs) that
were developed by tick bite inoculation of B. burgdorferi as the primary route of antigen administration.
Antibodies generated by this method may recognize antigens that are
essential to the transmission and dissemination of B. burgdorferi. When one of the antibodies was used as an
immunoreactive probe against a phage lambda expression library of
B. burgdorferi B31 genes, its specificity was
determined to be against a gene product termed Rev. The rev gene has been described as part of a plasmid-encoded, multicopy gene
family in B. burgdorferi 297 (designated the 2.9 locus)
which, because of its complexity, has been postulated to play a role in
facilitating the organism's survival in diverse environments (23). (The term Rev was used simply to describe the gene's
reverse strand orientation in comparison with adjacent genes.) This
paper reports the molecular characterization of the B31 strain
rev gene, as well as the flanking genes and regions, and
their comparison to the 2.9 locus genes of strain 297. Additionally,
the presence and expression of the rev gene in various
B. burgdorferi strains with varied in vitro culture
passage histories were examined.
 |
MATERIALS AND METHODS |
Borrelia strains.
B. burgdorferi sensu stricto
B31 (low passage, <10 passages; high passage, >50 passages) was
provided by A. Barbour (University of California, Irvine). Strains N40
and HB19 were obtained from J. Leong (University of Massachusetts), and
strain 297 was obtained from W. Probert (Centers for Disease Control
and Prevention [CDC], Fort Collins, Colo.). Low passage for these
strains was defined as <10 passages, and high-passage numbers were
unknown. Borreliae were grown in Barbour-Stoenner-Kelley modified
medium (Sigma Chemical Co., St. Louis, Mo.) supplemented with 6%
rabbit serum (PelFreeze, Rogers, Ark.) at 34°C until cell growth
reached approximately 107 to 108 organisms/ml,
after which the cell pellet was collected, washed, and frozen at
20°C until needed. B31-infected Ixodes scapularis was
provided by J. Piesman (CDC).
Production of anti-B. burgdorferi MAbs.
B. burgdorferi-infected nymphal ticks were allowed to
feed on female BALB/cByJ mice (8 to 12 weeks old). Infection of mice with B. burgdorferi was confirmed by positive cultures
derived from ear biopsy specimens (30). Mice were reinfested
with B. burgdorferi-infected ticks 1 month later. At
the end of this immunization schedule, serum samples were analyzed by
enzyme-linked immunosorbent assay, and the mouse with the highest titer
was selected for hybridoma production. Three days before the cell
fusion procedure, 105 low-passage strain B31 organisms
(passage 1, cultured from ticks) were injected intravenously. Spleen
cells were harvested and fused with cP3×63-Ag8.653 myeloma cells by
use of polyethylene glycol 1000. The spleen cell/myeloma cell ratio was
approximately 5:1. Fused cells were selected by using medium containing
hypoxanthine-aminopterin-thymidine. Wells were screened by
enzyme-linked immunosorbent-assay and Western blotting with low-passage
B. burgdorferi B31 as the antigen. Cells from positive
wells were expanded and cloned by limited dilution. The antibody
specific for the Rev protein was designated YM.17. The isotype was
determined to be immunoglobulin G2A (IgG2a) by using an immunoglobulin
typing kit (Gibco BRL, Gaithersburg, Md.).
B. burgdorferi genomic library.
The
B. burgdorferi genomic library was generated by
EcoRI "star" digestion of B. burgdorferi
genomic DNA and ligated into the Lambda-Zap(II) cloning vector
(Stratagene, La Jolla, Calif.) as previously described (12).
The lambda library was plated onto Escherichia coli XLI Blue
MRF' (Stratagene), and plaques were immunologically screened with MAb
YM.17 according to standard procedures; these are described in a
separate study (13).
DNA procedures and analysis.
Lambda phage vectors containing
cloned DNA inserts were converted to pBluescript phagemids by the in
vivo excision method, according to the manufacturer's instructions
(Stratagene). Recombinant plasmid isolation from E. coli was
performed by using the QIAprep-spin Plasmid kit (Qiagen, Chatsworth,
Calif.). DNA sequencing was performed with the Taq DyeDeoxy Terminator
Cycle Sequencing kit (Applied Biosystems, Inc., Foster City, Calif.).
Sequencing reactions were run and analyzed by the automated sequencing
apparatus, model 373A (Applied Biosystems, Inc.). DNA sequences were
computer analyzed with Lasergene software (DNASTAR, Madison, Wis.).
Southern transfer and hybridization procedures, probe generation, and
detection have been described in detail previously (13). Briefly, total genomic DNA was fractionated on a 0.35%
Tris-acetate-EDTA agarose gel. Following electrophoresis, the DNA was
transferred to Nytran membranes (Schleicher & Schuell, Keene, N.H.).
Probes were generated and detected according to the manufacturer's
directions by using an ECL Probe-Amp kit (Amersham Life Science, Little
Chalfont, Buckinghamshire, England). PCR conditions for rev
gene probe generation are detailed below. Hybridization conditions were
5× SSC (1× SSC is 0.15 M NaCl plus 0.015 M sodium citrate), 0.5%
blocking agent (Amersham), 0.1% sodium dodecyl sulfate, and 5%
dextran sulfate overnight at 60°C. Blots were washed three times for
10 min each time with a stringency of 0.5× SSC at 60°C.
PCR subcloning.
Coding sequence regions of selected genes
were amplified by PCR and subcloned into plasmid expression vectors as
follows. PCR primers for the rev gene were Rev-F1 (5'
AAAGCATATGTAGAAGAAAAG 3') and Rev-B1 (5'
TTAGTGCCCTCTTCGAGGAAC 3'), where Rev-F1 is sequence from the 5'
end of the gene, starting just past the putative signal peptide, and
Rev-B1 is sequence from the end of the coding sequence. PCR primers for
the lipoprotein gene (LP) were LP-F1 (5'
ATGAAAATCATCAACATATTA 3') and LP-B1 (5'
TTAGGACCCATTGCCGCAGGT 3') and were derived from the beginning and
end of the coding sequence, respectively. B1 primers for both genes
were from the inverse complement of the coding sequence. The fragments
were amplified from the original cloned insert in phagemid pBluescript (Stratagene) under the following conditions: 10 mM Tris-HCl (pH 8.3),
50 mM KCl, 1.5 mM MgCl2, 0.001% gelatin, 200 µM (each)
dATP, dCTP, dGTP, and dTTP, 1 µM each primer, and 2.5 U of
Taq DNA polymerase (AmpliTaq; Perkin-Elmer Cetus, Norwalk,
Conn.). Amplification was performed in a GeneAmp PCR System 9600 thermocycler (Perkin-Elmer Cetus), with the parameters of 94°C for
30 s, 48°C for 30 s, and 72°C for 2 min, for 35 cycles.
The amplified gene fragments were ligated into the expression vector
pSCREEN-1b(+) (Novagen, Madison, Wis.) according to the manufacturer's
directions. The constructs produced a recombinant fusion protein when
expressed in E. coli Novablue (DE3) (Novagen).
Recombinant gene expression and Western blot analysis.
Cultures of E. coli containing the rev or
LP gene inserted in the expression vector pSCREEN were begun
by using a single transformant colony as the inoculum. The cells were
grown in Luria-Bertani broth supplemented with 250 µg of
carbenicillin/ml at 37°C until growth had progressed to mid-log
phase. Isopropyl-
-D-thiogalactopyranoside (IPTG) was
added to the culture to a concentration of 0.5 mM to induce expression
of the fusion protein. The culture was allowed to incubate further for
about 2 h; then the cells were pelleted by centrifugation, the
supernatant was discarded, and the cell pellet was frozen until ready
for use. To obtain expression of recombinant protein, it was critical
to induce the primary culture started from a transformant colony. A
primary culture grown to saturation, and subsequently used as a starter
inoculum for a new culture, did not produce recombinant protein.
Expression of recombinant protein was poor or nonexistent when an
overnight culture was used to start a fresh subculture, even when
antibiotic pressure was consistent. E. coli whole-cell
lysates expressing the recombinant protein, and lysates grown from
cells containing plasmid only, were subjected to Western blot analysis
according to standard procedures and have been described
(13). An ascites preparation of MAb YM.17 was used at a
dilution of 1:1,000.
Serum samples from Lyme disease patients were from the CDC National
Lyme Disease Reference Serobank. Samples were used in immunoblots
according to standard Western blot procedures. B. burgdorferi lysates were electrophoresed in 15% acrylamide gels, and E. coli recombinant Rev lysates were electrophoresed in
10% gels. The serum samples were reacted against the recombinant
antigen at a 1:1,000 dilution and against the B. burgdorferi lysate antigen at a 1:500 dilution. Detection for both
IgG and IgM antibodies was performed.
Nucleotide sequence accession numbers.
The GenBank accession
no. for the B31 "2.9-like" locus is AF000270. The 297 strain loci
are deposited under accession no. U45421 through U45427.
 |
RESULTS |
Gene isolation with MAb YM.17.
The specificity of MAb YM.17
was determined by Western blot analysis against a whole-cell lysate of
low-passage B. burgdorferi B31. The immunoblot showed
that MAb YM.17 was reactive against a protein with a molecular mass of
approximately 16 to 17 kDa (Fig. 1, lane
3). The MAb was used to immunologically screen a lambda expression
library of B. burgdorferi B31 genomic DNA in order to
isolate the gene encoding the YM.17-reactive protein. Two weakly
reactive plaques, with a signal slightly stronger than background, were
chosen for further analysis.

View larger version (23K):
[in this window]
[in a new window]
|
FIG. 1.
Western blot showing reactivities to MAb YM.17. Lanes:
1, E. coli containing pSCREEN plasmid vector with no insert;
2, E. coli containing pSCREEN plasmid vector with the
rev gene; 3, low-passage B. burgdorferi B31
lysate. Arrows indicate the approximate molecular sizes of native Rev
(17 kDa) and the recombinant Rev fusion product (55 kDa).
|
|
These clones were isolated, plaque purified, and cultured to produce
E. coli cell lysates as described in Materials and Methods.
The lysates were subjected to Western blot analysis with MAb YM.17
so
that the size of the recombinant product could be observed.
The
recombinant lysate produced a very weak or negative band upon
colorimetric detection of the immunoblot. Only by development
with a
more sensitive chemiluminescent assay was a specific product
of
approximately 16 to 17 kDa detected in the recombinant lysate
samples
(data not shown). Plasmid miniprep analysis showed that
the insert size
of this clone was approximately 2.7 kb. Therefore,
it was probable that
the gene was localized in the interior of
the insert, where gene
expression was not driven by the plasmid
vector's
lacZ
promoter, but rather by the native borrelia promoter,
which produced
low, barely detectable amounts of expressed gene
product.
In order to determine the location and number of open reading frames
(ORFs) to potentiate a 16- to 17-kDa gene product, the
DNA of the
entire cloned insert was sequenced. The sequencing
results revealed
several ORFs on both strands along the length
of the insert, all
potential candidates to encode the YM.17-specific
protein. A search of
the GenBank database identified these ORFs
as homologs of multicopy
genes found in several loci (termed the
2.9 locus) in
B. burgdorferi 297 and described by Porcella et
al. (
23).
Description of the B31 strain 2.9-like locus genes.
A diagram
of the B31 insert containing the 2.9-like locus is shown in Fig.
2. Although very similar to the loci
described for strain 297, this B31 locus was distinct in its gene order and arrangement from any single 2.9 locus. Also, the DNA sequences for
the individual genes in the B31 clone were different from those of the
corresponding genes in strain 297.

View larger version (18K):
[in this window]
[in a new window]
|
FIG. 2.
Diagram of the cloned insert containing the B31 2.9-like
locus. Arrows represent genes and directions of transcription. The
approximate molecular mass of the encoded protein is given above each
gene.
|
|
The 5' end of the insert began with the
orfC gene, followed
by the
orfD gene. Downstream of
orfD, on the
opposite strand,
lay the
rev gene, followed by the
LP gene back on the positive
strand. At the end of the
insert, on the negative strand, were
two overlapping ORFs, one of which
had homology to the
36kDa gene
from the 2.9-5 locus of
strain 297 (
23) (Fig.
2).
The
orfC coding region was 333 bp, encoding a protein of 111 amino acids with an estimated molecular mass of 12.9 kDa. Alignments
of
the B31 OrfC amino acid sequence against the OrfC amino acid
sequences
reported for strain 297 showed identity values from
94.6 to 81.5%. The
orfD coding sequence overlapped slightly with
that of the
orfC, which was also seen in the strain 297 loci.
The
orfD coding region consisted of 351 bp, encoding a protein
of 117 amino acids with a calculated molecular mass of 13.6 kDa.
Identity alignments against the OrfD amino acid sequences of the
strain
297 loci indicated a high degree of conservation, with
a range from
94.0 to 91.5%. Not present on this cloned insert,
but identified in
the strain 297 2.9 loci, were ORFs A and B,
directly upstream of ORFs C
and D (
23). Recently, ORFs A and
B for strain B31 have been
described as encoding proteins with
hemolytic activity against
erythrocytes and have been termed
blyA and
blyB,
respectively (
14).
The lipoprotein ORF was 444 bp, encoding a protein of 148 amino acids
with a calculated molecular mass of 16.4 kDa. When it
was compared to
the lipoproteins of strain 297, substantial homology
was seen, although
less than that with the
orfC and
orfD genes.
The
B31 lipoprotein fit into the class 2 category, as defined
for the
strain 297 lipoproteins (
23). The seven 2.9 lipoproteins
in
strain 297 diverged into two distinct classes after the first
50 amino
acids. The amino acid identities of the B31 lipoprotein
with the three
class 2 lipoproteins of strain 297 were 75.9, 77.1,
and 70.4%. Like
the sequences of the products of the
LP genes
from strain
297, the B31 lipoprotein amino acid sequence contained
the L-N-S-C
signal peptidase II motif for lipoprotein processing
and modification.
Between the
orfD and
LP genes, on the opposite
strand, was the
rev gene. It was seen in only one of the
described strain 297
loci, 2.9-7. The B31
rev gene was 480 bp and encoded a polypeptide
of 160 amino acids with an estimated
molecular mass of 17.9 kDa.
The B31
rev coding sequence
contained the same number of amino
acids as its strain 297 counterpart,
although the amino acid identity
between the two was only 68.8% (Fig.
3), and the nucleotide alignment
showed
74.5% agreement. As described for the strain 297
rev, the
B31
rev contained a putative leader peptide with a signal
peptidase
I cleavage site. Also identified for this gene were putative
ribosome
binding,

10, and

35 promoter sites, and inverted repeats
serving
as a transcription termination site. Protein sequence analysis
revealed a secondary structure dominated by alpha-helical regions.
The
protein was composed of several hydrophilic regions, except
for the
hydrophobic amino-terminal end characteristic of a membrane-anchoring
domain.

View larger version (22K):
[in this window]
[in a new window]
|
FIG. 3.
Alignment of the deduced amino acid sequences of the Rev
proteins for B. burgdorferi B31 and 297. Differing
amino acid residues are shaded.
|
|
An interesting feature of the B31 locus was the presence of two
overlapping ORFs downstream and on the opposite strand from
the
LP gene. One of the ORFs has some similarity to a gene found
in locus 2.9-5 of strain 297 which encoded a 36-kDa polypeptide
and was
designated
36kDa. The B31 ORFs were termed
36orf1
and
36orf2 (Fig.
2). A partial coding sequence is shown for
36orf1,
as the 5' end of the gene extends beyond the cloned
insert. The
36orf2 gene was 498 bp, encoding a protein of
166 amino acids
with a calculated molecular mass of 19.6 kDa. The
homology of
B31 36-Orf1 to the 297 36-kDa protein was limited to just
certain
stretches of the amino acid sequence, with large gaps in the
alignment,
but these stretches had a 72.7% identity to the 297 sequence.
The B31 36-Orf2 amino acid sequence showed slight similarity
to
the 297 36-kDa amino acid sequence, with 25.1% identity.
Rev expression and reactivity with MAb YM.17.
To identify
which gene encoded the protein reactive with MAb YM.17, subclones
containing only a selected ORF, in which the individual expressed
product could be tested by immunoblotting, were constructed. The
LP gene seemed a logical candidate, but the expressed
recombinant product demonstrated no reactivity to MAb YM.17 (data not
shown). The next gene subcloned for expression was the rev
gene. The recombinant Rev protein reacted strongly in a Western blot
with MAb YM.17, thus demonstrating that YM.17 was specific to Rev (Fig.
1, lane 2). The large size of the recombinant reflects its expression
as a 55-kDa fusion protein in this system.
MAb YM.17 was immunoblotted against lysates of low- and high-passage
cultures of
B. burgdorferi strains. B31 low-passage
cultured
organisms showed the Rev 17-kDa reactive band (Fig.
4, lane 1).
However, the Rev antigen was
absent in high-passage B31 lysate
(Fig.
4, lane 2). Figure
4 also shows
no MAb YM.17 reactivity
with lysates of high-passage cultures of
strains HB19, 297, and
N40. A weakly reactive band was seen in
low-passage HB19 lysate
(Fig.
4, lane 3), but no immunologic
cross-reactivity was seen
with MAb YM.17 against the Rev protein in
strains 297 and N40.

View larger version (15K):
[in this window]
[in a new window]
|
FIG. 4.
Western blot of B. burgdorferi lysates
against MAb YM.17. Lanes: 1, low-passage B31; 2, high-passage B31; 3, low-passage HB19; 4, high-passage HB19; 5, low-passage 297; 6, high-passage 297; 7, low-passage N40; 8, high-passage N40. YM.17 was
used at a dilution of 1:1,000.
|
|
DNA hybridizations.
To determine the presence and general
genomic location of the rev gene in total DNA preparations
of B. burgdorferi strains, Southern blot analysis was
performed. Figure 5A shows the plasmid profiles of DNA purified from low- and high-passage cultures of various
strains of B. burgdorferi. Following hybridization, the rev gene was detected in the low-passage B31 DNA, but not in
the high-passage B31 DNA (Fig. 5B, lanes 1 and 2). Accordingly,
low-passage HB19 DNA hybridized with the rev gene probe, but
high-passage HB19 DNA did not (Fig. 5B, lanes 3 and 4). In contrast,
the rev gene was present in both low- and high-passage DNAs
of the 297 and N40 strains (Fig. 5B, lanes 5 and 6 and lanes 7 and 8, respectively). To further explore this observation of rev
association in low- versus high-passage genomes, DNA was isolated from
strain B31 cultures with known in vitro culture passage histories and
was probed with rev. The rev gene was present in
both passage-3 and passage-26 genomes (Fig. 5B, lanes 9 and 10).
Therefore, one explanation for the results seen in the Southern blot is
that the plasmid harboring the rev gene is lost upon
extremely prolonged culture passage, i.e., more than 26 passages in
this case. The numbers of passages for the HB19, 297, and N40 samples
were unknown, but the B31 had been passaged more than 50 times. It is
possible that the HB19 had also been passaged many times, while the 297 and N40 were passaged relatively fewer times and thus retained the rev-containing plasmid.

View larger version (67K):
[in this window]
[in a new window]
|
FIG. 5.
Southern blot of total genomic DNA of B. burgdorferi strains hybridized against rev gene probe.
(A) Ethidium bromide stain of DNA in 0.35% agarose; (B) Southern blot
of gel in panel A probed with rev. Lanes: 1, low-passage
B31; 2, high-passage B31; 3, low-passage HB19; 4, high-passage HB19; 5, low-passage 297; 6, high-passage 297; 7, low-passage N40; 8, high-passage N40; 9, cloned strain of B31 in lane 1, passage 3; 10, cloned strain of B31 in lane 1, passage 26; 11, B. hermsii. Linear DNA size markers in kilobases are shown to the
left of panel A.
|
|
The Southern blot also demonstrated the plasmid location of the
rev gene. The hybridizing bands in Fig.
5B were consistent
with the various forms of a supercoiled 30- to 32-kb plasmid (
6,
32), which has been described as the location for both the 2.9
locus genes in strain 297 (
23) and the
blyA and
blyB genes in
strain B31 (
14). It has not yet
been determined whether the
assorted hybridizing bands were indicative
of multiple copies
of the
rev gene, supercoiled forms of the
plasmid, or a combination
of both.
B. hermsii genomic
DNA was included in the Southern blot
as a control, and no
rev-hybridizing bands were observed in it
(Fig.
5B, lane
11).
Serological reactivity to Rev protein.
Serum samples from Lyme
disease patients were assayed for antibody reactivity to the Rev
protein by Western blotting. The individual samples had been obtained
various times after the onset of illness was assessed in these
patients. Some samples showed prominent seroreactivity against the Rev
protein when they were blotted against B. burgdorferi
B31 lysates. These samples had been taken 90 days or less from the
onset of disease, and the representative blots are shown in Fig.
6A. Not all serum drawn from patients
diagnosed with early Lyme disease exhibited anti-Rev activity, and a
more detailed serological survey involving Rev is in progress. The
blots in Fig. 6 show IgG specificity, although IgM responses were also
seen (data not shown). The samples were also blotted against
recombinant Rev protein expressed in E. coli lysates and
were positive (Fig. 6B). These results demonstrate that (i) humans
develop an antibody response against the Rev protein as a result of
infection and (ii) an antibody with reactivity directed against the
B. burgdorferi Rev antigen is also reactive to the
recombinant form of the protein.

View larger version (65K):
[in this window]
[in a new window]
|
FIG. 6.
Western blot reactivities of serum samples from human
Lyme disease patients to Rev antigen. (A) Low-passage B31 as substrate
antigen; (B) E. coli lysate expressing recombinant Rev as
substrate antigen. Lanes 1 to 5 represent five human serum samples and
are the same in panels A and B. Lane YM.17 shows the MAb specific
to Rev serving as a marker. Arrows indicate the locations of the Rev
antigens.
|
|
 |
DISCUSSION |
MAbs against B. burgdorferi antigens were
generated in mice by the bite of borrelia-infected ticks, which served
as the primary and first-booster injections. This method provided for
the same manner of presentation of borrelia antigens to the host's
immune system as is seen in natural infections. Therefore, antibody
production presumably represents those antigens processed upon
transmission and infection. An important distinction between
culture-grown, needle-inoculated organisms and tick-transmitted,
host-adapted borreliae is that the latter express proteins not seen in
cultured borreliae and that they differentially express proteins during tick feeding (1, 7, 9, 20, 28, 33, 34). An antibody, YM.17,
generated by this method was found to be specific to a 17-kDa antigen,
termed Rev, which apparently is expressed in, or present on, infectious
B. burgdorferi cells. Rev, however, is also expressed
in cultured low-passage infectious B. burgdorferi and
therefore is not selectively expressed in vivo during host transmission. To our knowledge, this is the first description of a MAb
generated by this tick-bite inoculation method, in which the
corresponding gene product has been identified and molecularly characterized.
The B31 2.9-like locus is the counterpart of a multicopy locus
consisting of a tandemly arrayed gene family in strain 297 described by
Porcella et al. (23). This group demonstrated that there
were at least seven loci containing similar gene copies of several
ORFs, which they termed orfA through orfD,
rep+, rep
, and
LP. However, of these seven loci, only one (2.9-7) contained the rev gene. Their study showed that the 297 rev
gene probe hybridized with a single restriction digest fragment in
strain 297 but failed to hybridize with any fragments in strain B31.
This result could have been due to probe mismatching, since the 297 rev oligomer probe differed from the B31 sequence by 2 bases. It is also possible that the plasmid harboring rev
was missing from these investigators' B31 isolate or DNA preparation,
or both.
As seen with the 297 strain rev, the B31 rev gene
had a characteristic leader signal peptide and the protein was
hydrophilic, which indicates a potential outer membrane surface
location. Even though it is flanked by adjacent genes, rev
resides on the opposite DNA strand from these genes, and so apparently
is transcribed by its own promoter. Sequences resembling consensus
ribosome binding,
10, and
35 promoter regions were identified
upstream of the B31 and 297 rev coding sequences.
Immunoblotting analysis with MAb YM.17 showed that the 17-kDa Rev
protein was present in cultured low-passage B31 spirochetes but was not
expressed in culture in high-passage B31. Low-passage HB19 expressed a
Rev protein that was reactive to MAb YM.17, but the signal was weaker
than that seen with B31, which may be due to heterogeneity between the
two proteins or to differences in the protein expression level. No
cross-immunoreactivity to Rev with MAb YM.17 was seen in the 297 and
N40 strains. Since the amino acid alignment of the B31 and 297 Rev
proteins showed only about 69% identity, the reactive epitope to MAb
YM.17 probably lies in a less-conserved region. Either the same
explanation holds for N40, or N40 does not express a Rev protein. None
of the high-passage cultured organisms were recognized by MAb YM.17.
However, Southern blot analysis showed that the rev gene was
present in both low- and high-passage 297 and N40. Because the same
cultures were used to isolate the protein and DNA used for the Western
and Southern blots, respectively, the most logical explanation is that
Rev is probably expressed by these two strains but is not
cross-reactive with MAb YM.17. The lack of anti-Rev reactivity with
high-passage B31, however, is explained by the loss of the
rev gene, as seen in the Southern blot. A question remained
as to why the rev gene was absent in high-passage B31 but
not in 297 or N40. It was known that the high-passage B31 had been
passaged in culture over a period of years, probably more than 100 times. Perhaps the high-passage 297 and N40 had not undergone such an
extensive history of in vitro cultivation and thus had not yet lost the
gene. To address this observation, a population from the low-passage
B31 was passaged in culture, and cells were saved from selected
passages for DNA and protein purification. Southern blot analysis of
passage 26 of this B31 population showed that the rev gene
was still present, even though this was considered high-passage B31.
Passage-26 organisms expressed Rev, as seen by Western blotting (data
not shown), but by inoculation of organisms from passage 26 into mice,
it was determined that they were noninfectious (23a).
Therefore, it was concluded that, in this case, rev may
still be expressed in culture-passaged cells that have lost
infectivity.
It has been well documented that B. burgdorferi
undergoes changes in protein expression, with a concomitant loss of
plasmids, during continuous passages in in vitro culture (2, 5,
15, 22, 26, 27, 35). Generally, at some point during prolonged culture passage, depending on the strain, the borreliae become noninfectious. There are only a few examples of characterized genes
which reside on plasmids which are lost during prolonged cultivation,
but they have not consistently been shown to be associated with the
infectivity phenotype. The ospD gene, on a 38-kb linear plasmid (21), and the eppA gene, on a 9-kb
circular plasmid (7), are two such cases. Also, Zhang et al.
have recently associated the 28-kb linear plasmid-encoded
vls locus to mainly high-infectivity-phenotype clones
(36). Other groups have investigated and identified by molecular size some proteins associated with infectious low-passage organisms, but these have yet to be molecularly characterized (5,
22, 35). Xu et al. have proposed a link between a 24.7-kb or
equivalent linear plasmid and infectivity with the three genospecies of
Lyme disease borreliae, but as yet they have not characterized gene
products encoded from this plasmid (35).
The results from this study demonstrate that rev is a
plasmid-residing gene that is lost upon prolonged in vitro culture
passage in strain B31. A correlation between the organism's loss of
infectivity and loss of rev and/or the plasmid on which it
is located remains to be elucidated. However, the one example (B31,
passage 26) that was examined in this study appears to demonstrate that
the presence of rev is not directly associated with an
infectivity phenotype. Further studies are needed to address whether
rev is expressed in other noninfectious isolates of various
strains of B. burgdorferi, and thus whether there may
be a correlation between rev, or any of the 2.9 locus genes,
and the pathogenicity of the organism.
A panel of serum samples from patients with confirmed cases of Lyme
disease was used to survey seroreactivity against the Rev antigen. In
this preliminary screening, it was found that some samples had a
pronounced antibody response against Rev when they were blotted
against strain B31 lysate. Representative samples showing this
reactivity are shown in Fig. 6. This clearly demonstrates that Rev is
recognized during human infection. Generally, serum samples drawn from
patients 3 months or less from the onset of illness showed the
strongest reactivity, although not all early Lyme samples exhibited
anti-Rev activity by Western blotting. More extensive serological
surveys are required to determine sensitivities and specificities of
the humoral response to this antigen in patients at differing stages of
Lyme disease. The sera with an antibody response to the borrelia Rev
also reacted with the recombinant Rev, as seen in Fig. 6. Therefore,
the Rev protein may have promise as a diagnostic antigen for Lyme
disease serology.
In conclusion, a MAb was made by a technique which involved borrelia
inoculation into the host mouse by way of tick bite, representing the
route of transmission of the organism in nature. The MAb was specific
to the Rev protein, an antigen that was recognized by the antibody
response of serum from human Lyme disease patients. The rev
gene was associated with a multicopy locus gene family consisting of
lipoprotein and hemolysin genes, as well as other genes of unknown
function. It should prove interesting to further explore the potential
role of these genes in the infectious process and pathogenesis of
B. burgdorferi, particularly in the context of
tick-host interactions.
 |
ACKNOWLEDGMENTS |
We acknowledge the contributions of the following: J. Boonjakuakul for help in plasmid isolations, S. Sviat for
Borrelia culturing assistance, R. Tsuchiya for DNA
sequencing support, and B. J. B. Johnson and W. Probert for their work in characterizing strains and for their
critiques and helpful discussions regarding the manuscript. Special
thanks are due to S. Porcella for sharing his thoughts and providing
unique insight to this project.
 |
FOOTNOTES |
*
Corresponding author. Mailing address: DVBID, Centers
for Disease Control and Prevention, P.O. Box 2087, Foothills Campus, Fort Collins, CO 80522. Phone: (970) 221-6405. Fax: (970) 221-6476. E-mail: rbg9{at}cdc.gov.
Editor: J. G. Cannon
 |
REFERENCES |
| 1.
|
Akins, D. R.,
S. F. Porcella,
T. G. Popova,
D. Shevchenko,
S. I. Baker,
M. Li,
M. V. Norgard, and J. D. Radolf.
1995.
Evidence for in vivo but not in vitro expression of a Borrelia burgdorferi outer surface protein F (OspF) homologue.
Mol. Microbiol.
18:507-520[Medline].
|
| 2.
|
Barbour, A. G.
1993.
Linear DNA of Borrelia species and antigenic variation.
Trends Microbiol.
1:236-239[Medline].
|
| 3.
|
Bergstrom, S.,
V. G. Bundoc, and A. G. Barbour.
1989.
Molecular analysis of linear plasmid-encoded major surface proteins, OspA and OspB, of the Lyme disease spirochaete Borrelia burgdorferi.
Mol. Microbiol.
3:479-486[Medline].
|
| 4.
|
Burgdorfer, W.,
A. G. Barbour,
S. F. Hayes,
J. L. Benach,
E. Grunwaldt, and J. P. Davis.
1982.
Lyme disease a tick-borne spirochetosis?
Science
216:1317-1319[Abstract/Free Full Text].
|
| 5.
|
Carroll, J. A., and F. C. Gherardini.
1996.
Membrane protein variations associated with in vitro passage of Borrelia burgdorferi.
Infect. Immun.
64:392-398[Abstract].
|
| 6.
|
Casjens, S.,
R. van Vugt,
K. Tilly,
P. A. Rosa, and B. Stevenson.
1997.
Homology throughout the multiple 32-kilobase circular plasmids present in Lyme disease spirochetes.
J. Bacteriol.
179:217-227[Abstract/Free Full Text].
|
| 7.
|
Champion, C. I.,
D. R. Blanco,
J. T. Skare,
D. A. Haake,
M. Giladi,
D. Foley,
J. N. Miller, and M. A. Lovett.
1994.
A 9.0-kilobase-pair circular plasmid of Borrelia burgdorferi encodes an exported protein: evidence for expression only during infection.
Infect. Immun.
62:2653-2661[Abstract/Free Full Text].
|
| 8.
|
Ferdows, M. S., and A. G. Barbour.
1989.
Megabase-sized linear DNA in the bacterium Borrelia burgdorferi, the Lyme disease agent.
Proc. Natl. Acad. Sci. USA
86:5969-5973[Abstract/Free Full Text].
|
| 9.
|
Fikrig, E.,
S. W. Barthold,
W. Sun,
W. Feng,
S. R. Telford III, and R. A. Flavell.
1997.
Borrelia burgdorferi P35 and P37 proteins, expressed in vivo, elicit protective immunity.
Immunity
6:1-20[Medline].
|
| 10.
|
Fuchs, R.,
S. Jauris,
F. Lottspeich,
V. Preac-Mursic,
B. Wilske, and E. Soutschek.
1992.
Molecular analysis and expression of a Borrelia burgdorferi gene encoding a 22 kDa protein (pC) in Escherichia coli.
Mol. Microbiol.
6:503-509[Medline].
|
| 11.
|
Garcia-Monco, J. C., and J. L. Benach.
1995.
Lyme neuroborreliosis.
Ann. Neurol.
37:691-702[Medline].
|
| 12.
|
Gilmore, R. D., Jr.,
K. J. Kappel,
M. C. Dolan,
T. R. Burkot, and B. J. B. Johnson.
1996.
Outer surface protein C (OspC), but not P39, is a protective immunogen against a tick-transmitted Borrelia burgdorferi challenge: evidence for a conformational protective epitope in OspC.
Infect. Immun.
64:2234-2239[Abstract].
|
| 13.
|
Gilmore, R. D., Jr.,
K. J. Kappel, and B. J. B. Johnson.
1997.
Molecular characterization of a 35-kilodalton protein of Borrelia burgdorferi, an antigen of diagnostic importance in early Lyme disease.
J. Clin. Microbiol.
35:86-91[Abstract].
|
| 14.
|
Guina, T., and D. B. Oliver.
1997.
Cloning and analysis of a Borrelia burgdorferi membrane-interactive protein exhibiting haemolytic activity.
Mol. Microbiol.
24:1201-1213[Medline].
|
| 15.
|
Johnson, R. C.,
N. Marek, and C. Kodner.
1984.
Infection of Syrian hamsters with Lyme disease spirochetes.
J. Clin. Microbiol.
20:1099-1101[Abstract/Free Full Text].
|
| 16.
|
Johnson, R. C.,
G. P. Schmid,
F. W. Hyde,
A. G. Steigerwalt, and D. J. Brenner.
1984.
Borrelia burgdorferi sp. nov.: etiological agent of Lyme disease.
Int. J. Syst. Bacteriol.
34:496-497.
|
| 17.
|
Lam, T. T.,
T. P. Nguyen,
R. R. Montgomery,
F. S. Kantor,
E. Fikrig, and R. A. Flavell.
1994.
Outer surface proteins E and F of Borrelia burgdorferi, the agent of Lyme disease.
Infect. Immun.
62:290-298[Abstract/Free Full Text].
|
| 18.
|
Logigian, E. L.,
R. F. Kaplan, and A. C. Steere.
1990.
Chronic neurologic manifestations of Lyme disease.
N. Engl. J. Med.
323:1438-1444[Abstract].
|
| 19.
|
Marconi, R. T.,
D. S. Samuels, and C. F. Garon.
1993.
Transcriptional analyses and mapping of the ospC gene in Lyme disease spirochetes.
J. Bacteriol.
175:926-932[Abstract/Free Full Text].
|
| 20.
|
Montgomery, R. R.,
S. E. Malawista,
K. J. Feen, and L. K. Bockenstedt.
1996.
Direct demonstration of antigenic substitution of Borrelia burgdorferi ex vivo: exploration of the paradox of the early immune response to outer surface proteins A and C in Lyme disease.
J. Exp. Med.
183:261-269[Abstract/Free Full Text].
|
| 21.
|
Norris, S. J.,
C. J. Carter,
J. K. Howell, and A. G. Barbour.
1992.
Low-passage-associated proteins of Borrelia burgdorferi B31: characterization and molecular cloning of OspD, a surface-exposed, plasmid-encoded lipoprotein.
Infect. Immun.
60:4662-4672[Abstract/Free Full Text].
|
| 22.
|
Norris, S. J.,
J. K. Howell,
S. A. Garza,
M. S. Ferdows, and A. G. Barbour.
1995.
High- and low-infectivity phenotypes of clonal populations of in vitro-cultured Borrelia burgdorferi.
Infect. Immun.
63:2206-2212[Abstract].
|
| 23.
|
Porcella, S. F.,
T. G. Popova,
D. R. Akins,
M. Li,
J. D. Radolf, and M. V. Norgard.
1996.
Borrelia burgdorferi supercoiled plasmids encode multicopy tandem open reading frames and a lipoprotein gene family.
J. Bacteriol.
178:3293-3307[Abstract/Free Full Text].
|
| 23a.
| Probert, W. Personal communication.
|
| 24.
|
ad iene, A.,
B. Wilske,
M. S. Ferdows, and A. G. Barbour.
1993.
The cryptic ospC gene of Borrelia burgdorferi B31 is located on a circular plasmid.
Infect. Immun.
61:2192-2195[Abstract/Free Full Text].
|
| 25.
|
Saint Girons, I.,
I. G. Old, and B. E. Davidson.
1994.
Molecular biology of the Borrelia, bacteria with linear replicons.
Microbiology
140:1803-1816[Free Full Text].
|
| 26.
|
Schwan, T. G., and W. Burgdorfer.
1987.
Antigenic changes of Borrelia burgdorferi as a result of in vitro cultivation.
J. Infect. Dis.
156:852-853[Medline]. (Letter.)
|
| 27.
|
Schwan, T. G.,
W. Burgdorfer, and C. F. Garon.
1988.
Changes in infectivity and plasmid profile of the Lyme disease spirochete, Borrelia burgdorferi, as a result of in vitro cultivation.
Infect. Immun.
56:1831-1836[Abstract/Free Full Text].
|
| 28.
|
Schwan, T. G.,
J. Piesman,
W. T. Golde,
M. C. Dolan, and P. A. Rosa.
1995.
Induction of an outer surface protein on Borrelia burgdorferi during tick feeding.
Proc. Natl. Acad. Sci. USA
92:2909-2913[Abstract/Free Full Text].
|
| 29.
|
Simpson, W. J.,
C. F. Garon, and T. G. Schwan.
1990.
Analysis of supercoiled circular plasmids in infectious and non-infectious Borrelia burgdorferi.
Microb. Pathog.
8:109-118[Medline].
|
| 30.
|
Sinsky, R. J., and J. Piesman.
1989.
Ear punch biopsy method for detection and isolation of Borrelia burgdorferi from rodents.
J. Clin. Microbiol.
27:1723-1727[Abstract/Free Full Text].
|
| 31.
|
Steere, A. C.
1989.
Lyme disease.
N. Engl. J. Med.
321:586-596[Abstract].
|
| 32.
|
Stevenson, B.,
K. Tilly, and P. A. Rosa.
1996.
A family of genes located on four separate 32-kilobase circular plasmids in Borrelia burgdorferi B31.
J. Bacteriol.
178:3508-3516[Abstract/Free Full Text].
|
| 33.
|
Suk, K.,
S. Das,
W. Sun,
B. Jwang,
S. W. Barthold,
R. A. Flavell, and E. Fikrig.
1995.
Borrelia burgdorferi genes selectively expressed in the infected host.
Proc. Natl. Acad. Sci. USA
92:4269-4273[Abstract/Free Full Text].
|
| 34.
|
Wallich, R.,
C. Brenner,
M. D. Kramer, and M. M. Simon.
1995.
Molecular cloning and immunological characterization of a novel linear-plasmid-encoded gene, pG, of Borrelia burgdorferi expressed only in vivo.
Infect. Immun.
63:3327-3335[Abstract].
|
| 35.
|
Xu, Y.,
C. Kodner,
L. Coleman, and R. C. Johnson.
1996.
Correlation of plasmids with infectivity of Borrelia burgdorferi sensu stricto type strain B31.
Infect. Immun.
64:3870-3876[Abstract].
|
| 36.
|
Zhang, J.,
J. M. Hardham,
A. G. Barbour, and S. J. Norris.
1997.
Antigenic variation in Lyme disease borreliae by promiscuous recombination of VMP-like sequence cassettes.
Cell
89:275-285[Medline].
|
Infect Immun, March 1998, p. 980-986, Vol. 66, No. 3
0019-9567/98/$04.00+0
Copyright © 1998, American Society for Microbiology. All rights reserved.
This article has been cited by other articles:
-
Brissette, C. A., Bykowski, T., Cooley, A. E., Bowman, A., Stevenson, B.
(2009). Borrelia burgdorferi RevA Antigen Binds Host Fibronectin. Infect. Immun.
77: 2802-2812
[Abstract]
[Full Text]
-
Barbour, A. G., Jasinskas, A., Kayala, M. A., Davies, D. H., Steere, A. C., Baldi, P., Felgner, P. L.
(2008). A Genome-Wide Proteome Array Reveals a Limited Set of Immunogens in Natural Infections of Humans and White-Footed Mice with Borrelia burgdorferi. Infect. Immun.
76: 3374-3389
[Abstract]
[Full Text]
-
Nowalk, A. J., Gilmore, R. D. Jr, Carroll, J. A.
(2006). Serologic Proteome Analysis of Borrelia burgdorferi Membrane-Associated Proteins. Infect. Immun.
74: 3864-3873
[Abstract]
[Full Text]
-
Earnhart, C. G., Buckles, E. L., Dumler, J. S., Marconi, R. T.
(2005). Demonstration of OspC Type Diversity in Invasive Human Lyme Disease Isolates and Identification of Previously Uncharacterized Epitopes That Define the Specificity of the OspC Murine Antibody Response. Infect. Immun.
73: 7869-7877
[Abstract]
[Full Text]
-
Carroll, J. A., El-Hage, N., Miller, J. C., Babb, K., Stevenson, B.
(2001). Borrelia burgdorferi RevA Antigen Is a Surface-Exposed Outer Membrane Protein Whose Expression Is Regulated in Response to Environmental Temperature and pH. Infect. Immun.
69: 5286-5293
[Abstract]
[Full Text]
-
El-Hage, N., Babb, K., Carroll, J. A., Lindstrom, N., Fischer, E. R., Miller, J. C., Gilmore, R. D. Jr, Mbow, M. L., Stevenson, B.
(2001). Surface exposure and protease insensitivity of Borrelia burgdorferi Erp (OspEF-related) lipoproteins. Microbiology
147: 821-830
[Abstract]
[Full Text]
-
Yang, X., Popova, T. G., Hagman, K. E., Wikel, S. K., Schoeler, G. B., Caimano, M. J., Radolf, J. D., Norgard, M. V.
(1999). Identification, Characterization, and Expression of Three New Members of the Borrelia burgdorferi Mlp (2.9) Lipoprotein Gene Family. Infect. Immun.
67: 6008-6018
[Abstract]
[Full Text]
-
Gilmore, R. D. Jr., Mbow, M. L.
(1999). Conformational Nature of the Borrelia burgdorferi B31 Outer Surface Protein C Protective Epitope. Infect. Immun.
67: 5463-5469
[Abstract]
[Full Text]
-
Mbow, M. L., Gilmore, R. D. Jr., Titus, R. G.
(1999). An OspC-Specific Monoclonal Antibody Passively Protects Mice from Tick-Transmitted Infection by Borrelia burgdorferi B31. Infect. Immun.
67: 5470-5472
[Abstract]
[Full Text]
-
Skare, J. T., Foley, D. M., Hernandez, S. R., Moore, D. C., Blanco, D. R., Miller, J. N., Lovett, M. A.
(1999). Cloning and Molecular Characterization of Plasmid-Encoded Antigens of Borrelia burgdorferi. Infect. Immun.
67: 4407-4417
[Abstract]
[Full Text]