Previous Article | Next Article 
Infect Immun, April 1998, p. 1473-1481, Vol. 66, No. 4
0019-9567/98/$04.00+0
Copyright © 1998, American Society for Microbiology. All rights reserved.
Evolution of the Primary Immune Response to
Histoplasma capsulatum in Murine Lung
Judith A.
Cain and
George S.
Deepe Jr.*
Division of Infectious Diseases, Department
of Medicine, University of Cincinnati College of Medicine,
Cincinnati, Ohio 45267-0560, and Veterans Affairs Hospital, Cincinnati,
Ohio 48229
Received 8 October 1997/Returned for modification 4 December
1997/Accepted 2 January 1998
 |
ABSTRACT |
Histoplasma capsulatum induces a cell-mediated immune
response in the lungs and lymphoid organs of mammals. In this study, we
analyzed the progression of the cytokine and inflammatory reactions in
the lungs of mice infected intranasally with H. capsulatum. We measured cytokine mRNA levels and determined the inflammatory cell
populations during the active phase of infection (<3 weeks). Transcription of genes encoding interleukin-2 (IL-2), IL-4, and IL-12
and gamma interferon (IFN-
) was detectable as early as day 3 of
infection, whereas a signal for IL-10 was never observed. Competitive
PCR analysis demonstrated that enhanced expression of IL-12 mRNA was
observed by day 3 and that expression of mRNA for IL-2 and IFN-
progressively increased from day 5 to day 10. All levels declined by
day 14. Analysis of the inflammatory response revealed an initial
elevation in myeloid cells (Mac-1+) and natural killer (NK)
cells followed by a rise in T cells, predominantly CD4+
cells. Since IFN-
is a key factor in host defense, we performed cytoplasmic staining to determine the cell populations that produced this cytokine. The hierarchy of synthesis was CD4+ > CD8+ > NK cells. Thus, H. capsulatum provokes
an orderly modulation of the inflammatory and cytokine responses in
murine lungs.
 |
INTRODUCTION |
Resistance to Histoplasma
capsulatum infection in mammals is primarily dependent on a
cellular immune response mediated by T cells and mononuclear phagocytes
(8). The initial site of infection is the lung, where yeast
cells produced from inhaled microconidia are ingested by alveolar
macrophages (M
) via an interaction between the CD11/CD18 family of
adhesion molecules and yeast cell wall components (6).
Phagocytosis of H. capsulatum by M
results in a
permissive environment for survival and replication of yeast cells
until host resistance mechanisms induce clearance (22).
Resolution of infection in mice correlates with the production of
cytokines, especially gamma interferon (IFN-
), which has been shown
to induce fungistasis in peritoneal M
and in splenic M
in
combination with lipopolysaccharide (LPS) (20, 31).
Two critical determinants of the course of infection are the cytokines
released upon host-pathogen interaction and the inflammatory response
evoked in response to invasion. Therefore, the inability to produce the
appropriate cytokines that activate the antimicrobial properties of
phagocytes often leads to disease progression.
To understand the perturbations of immunity that lead to progressive
histoplasmosis, it is vitally important to gain knowledge concerning
the cytokine profile and inflammatory response during the course of an
infection that resolves without therapeutic intervention. This
information can be useful not only in the development of immunotherapeutic targets but also for utilization of pharmaceutical agents that may modify the potential inimical effects of certain cytokines or an inappropriate inflammatory response. The purpose of the
present study was to define the evolution of the primary immune
response to H. capsulatum in mouse lungs by (i) determining the pattern of cytokine-specific mRNA upregulation during the first 6 weeks of infection and measuring these changes by competitive PCR
analysis, (ii) characterizing the changes in lineage-specific cell
populations in the lung during infection, and (iii) measuring cytoplasmic levels of IFN-
protein and determining the phenotype of
cells producing this cytokine.
 |
MATERIALS AND METHODS |
Mice.
Male C57BL/6 mice were purchased from Jackson
Laboratory (Bar Harbor, Maine) and maintained in the animal facility at
the University of Cincinnati. All experiments employed animals that were 6 to 12 weeks of age. Control and infected mice were housed in
laminar-flow units.
Preparation of yeast cultures and intranasal infection of mice.
H. capsulatum yeast cells (strain G217B) were grown for
48 h at 37°C in 50 ml of Ham's F-12 medium supplemented with
glucose (18.2 g/liter), glutamic acid (1 g/liter), HEPES (6 g/liter), and cysteine (8.4 mg/liter). Cell suspensions were prepared by washing
the cells three times with Hanks' balanced salt solution containing
0.2 M HEPES and 0.5% bovine serum albumin (BSA), with the third wash
being done at 100 × g. The final volume was adjusted to equal 2.5 × 106 yeast cells per 50 µl of buffer.
Mice anesthetized with Metophane (Pitman-Moore, Mundelein, Ill.) were
infected with 2.5 × 106 yeast cells by pipetting the
50-µl volume into the nasal cavity with a micropipettor. Control
animals were given an equal volume of buffer.
Antibodies and immunofluorescent reagents.
The following
reagents were purchased from Pharmingen (San Diego, Calif.):
fluorescein isothiocyanate (FITC)-conjugated monoclonal antibodies
(MAbs) to CD45 (clone 30F11.1), CD45R/B220 (clone RA3-6B2), CD90.2
(Thy-1, clone 30-H12), CD4 (clone RM4-5), and Ly-6G/Gr-1 (clone
RB6-8C5); phycoerythrin-conjugated MAbs to NK1.1 (clone PK136), IFN-
(clone XMG1.2), and interleukin-2 (IL-2) (clone S4B6); and biotinylated
NK1.1 and streptavidin-FITC (SAv-FITC). Antibodies manufactured by the
hybridoma that produces anti-CD8 (clone 53.6.72; American Type Culture
Collection) and by the anti-Mac-1 hybridoma (anti-CR3; clone M1/70)
were purified from tissue culture supernatants by protein G affinity
column (Pharmacia, Piscataway, N.J.) and conjugated to FITC as
previously reported (15).
RNA and cDNA preparations.
At various times after intranasal
infection, lungs and spleens were removed from animals following
perfusion with 30 ml of Hanks' balanced salt solution. Total RNA was
isolated from tissues by using RNAzol (Tel-Test, Inc., Friendswood,
Tex.) in accordance with the manufacturer's instructions. The total
yield of RNA was quantified by measuring the optical density at 260 nm
(OD260), and the purity, monitored by determining
OD260/OD280 ratios, was >1.9 for all samples.
Oligo(dT)-primed cDNA was prepared by using the Reverse Transcriptase
System (Promega, Madison, Wis.). Single-stranded cDNA was synthesized,
using 1 µg of RNA as the template, by incubation at 42°C for 1 h in a total volume of 20 µl.
PCR primers and competitors.
Sense and antisense primers to
cytokines (IL-2, IL-4, IL-10, IFN-
, IL-12 p35, and IL-12 p40) and
hypoxanthine phosphoribosyltransferase (HPRT) were synthesized in
accordance with published sequences (23, 24).
Competitor DNA sequences for HPRT, IL-2, IL-4, IL-10, and IFN-
were
from the previously described polycompetitor vector pPQRS (kindly
provided by Richard M. Locksley, University of California, San
Francisco) (23). The competitor was linearized from the vector DNA by digestion with SfiI and NotI
restriction enzymes (New England Biolabs, Beverly, Mass.) and gel
purified.
To construct polycompetitors for murine IL-12 p40 and p35, we amplified
gene fragments from oligo(dT)-primed cDNA synthesized from RNA that was
harvested from mouse M
stimulated with LPS. For IL-12 p40, the
primer sequences were as follows: sense (5'-3'), CGGGATCCCTGGAGAAAGACGTTTATGT; and antisense (5'-3'),
CGGAATTCGGGAGTGCTCGAGGAGTCAG. For IL-12 p35, the primer
sequences were as follows: sense (5'-3'), ATAAGAATGCGGCCGCAAGAGACACAGTCCTGGG; and antisense
(5'-3'), GGAATTCTGCATCAGCTCATCGATGGC. The gene products were
amplified, gel purified, and checked for fidelity by restriction
mapping. The IL-12 p40 gene fragment was digested with BamHI
and EcoRI, and IL-12 p35 was digested with EcoRI
and NotI; both were cloned into pBluescript SK(
)
(Stratagene, La Jolla, Calif.). A 259-bp fragment from pGAD4 (Clontech,
Palo Alto, Calif.) was isolated by digestion with SalI and
HindIII and then cloned into the
XhoI-HindIII site of plasmid pIL1240. A
200-bp SpeI fragment from pYX213 (Novagen, Madison, Wis.)
was cloned into the XhoI site of pIL1235.
PCR analysis.
One microliter of cDNA was incubated in a
reaction mixture containing 50 mM KCl, 10 mM Tris-HCl (pH 9.0), 2.5 mM
MgCl2, 0.1% Triton X-100, 0.2 mM each deoxynucleoside
triphosphate, 1 µM each primer, and 0.625 U of Taq DNA
polymerase (Promega) in a final volume of 25 µl. For HPRT-, IFN-
-,
IL-2-, IL-10-, and IL-4-specific primers, the PCRs consisted of 35 cycles of 40 s at 94°C, 20 s at 60°C, and 40 s at
72°C followed by a 10-min extension. For IL-12-specific primers, the
PCR consisted of 35 cycles of 1 min at 94°C, 1 min at 63°C (p35
chain) or 67°C (p40 chain), and 1 min at 72°C followed by a 10-min
extension at 72°C.
For competitive PCR analysis, serial twofold dilutions of competitor
DNA of a known concentration were added to the same amplification reaction mixtures as cDNA synthesized from lung RNA samples. The relative densities of ethidium bromide-stained PCR products separated on a 3% agarose gel were measured with an IS-1000 digital imaging system (Alpha-Innotech, San Leandro, Calif.). Quantitation of cDNA was
accomplished by plotting the log of the lung sample/competitor density
ratio versus the log of the competitor concentration. The equivalence
point, defined as the point at which the density ratio equals zero, was
determined by linear regression analysis and solving for
y = 0. HPRT-specific cDNA was quantified as the amount
of mRNA in each sample. To normalize the amount of primable mRNA among
the samples, the data were analyzed as cytokine/HPRT concentration
ratios.
Preparation of single-cell suspensions from lung tissue.
The
lungs of infected animals were removed on one of several specified days
after infection, teased apart with forceps, and suspended in RPMI
medium containing glutamine (0.29 mg/ml), penicillin-streptomycin (100 U/ml and 100 mg/ml, respectively), and 10% fetal bovine serum (FBS).
The organs were homogenized into single-cell suspensions by sequential
passage through 16-, 18-, and 20-gauge needles. The mononuclear
fraction was isolated by separation on 40 to 70% Percoll gradients
(Pharmacia). For surface phenotyping, cells were resuspended in
phosphate-buffered saline (PBS; pH 7.3) containing 1% BSA and 0.1%
azide (PBS-BSA). For sorting experiments, adherent cells were removed
from lung preparations by incubation at 37°C in 7% CO2
for 1 h. Nonadherent cells were removed, washed, and resuspended
in PBS-BSA.
Cell surface phenotype.
Cells isolated from lungs were
pelleted (1 × 105 to 5 × 105) at
350 × g and incubated with a saturating amount of
antibody in a 20-µl volume for 15 min at 4°C. The cells were washed
twice with PBS-BSA before addition of SAv-FITC (for biotinylated
reagents) followed by incubation and washing as before. All samples
were resuspended in a 1% paraformaldehyde solution before analysis on
a Coulter Epics XL flow cytometer (Coulter Corp., Miami, Fla.). Flow
cytometry data, reported as the percentage of positive cells and mean
fluorescence intensity (MFI), were determined with Coulter XL-2
analysis software, using a log scale of 0.1 to 1,000 for fluorescence
intensity. The absolute number of cells expressing each surface marker
was calculated by multiplying the percentage of positive cells of each
phenotype by the total number of cells derived from the Percoll
gradients. Since cell types other than blood lineage cells were present
within the analysis gates, the data were normalized to represent
hemopoietic lineage cells within the gate by multiplying by the
percentage of CD45+ cells. This antibody (clone 30F11.1)
recognizes all blood cells except erythrocytes (25).
Cell sorting.
The nonadherent population of cells isolated
from the lungs of animals on day 9 or 10 of infection were stained as
described above with CD4-FITC, CD8-FITC, or NK1.1-biotin followed by
SAv-FITC, and the positive and negative populations were separated on a Coulter EPICS 753 instrument and collected into FBS.
Cytoplasmic expression of cytokines.
The detection procedure
for intracellular IFN-
protein was derived partially from a previous
method (3). Purified populations of lung cells at densities
of 2.0 × 106 per ml in 24-well tissue culture dishes
were suspended in RPMI medium containing penicillin G (100 U/ml),
streptomycin sulfate (100 µg/ml), glutamine (0.29 mg/ml),
nonessential amino acids, minimal essential medium amino acid solution,
sodium pyruvate (0.1 mM), 2-mercaptoethanol (0.5 mM), sodium
bicarbonate (0.75%), serine (2 µg/ml), asparagine (16 µg/ml), and
10% FBS and exposed to phorbol myristate acetate (10 ng/ml; Sigma, St.
Louis, Mo.), calcium ionomycin (250 ng/ml; Calbiochem, La Jolla,
Calif.), and Brefeldin A (200 ng/ml; Calbiochem) for 4 h at 37°C
in 7% CO2. This step was necessary for detection of
cytoplasmic IFN-
. Cells from naive animals incubated with this
cocktail never demonstrated intracellular cytokine. Cells were washed
in PBS, fixed in 4% paraformaldehyde for 20 min at 22°C, pelleted,
and washed in PBS-BSA before being resuspended in fresh PBS-BSA.
For cytoplasmic staining, cells were incubated in PBS-BSA containing
0.5% saponin (Calbiochem) for 30 min at 22°C before being stained
with phycoerythrin-conjugated anticytokine antibodies for 30 min. The
cells were washed twice with saponin buffer and then once with PBS-BSA.
Control samples were either permeabilized and stained with an
irrelevant MAb or were not saponin treated and stained with
anticytokine MAbs; in either case, they were subsequently washed with
PBS-BSA and saponin buffer. Samples were resuspended in PBS-BSA and
analyzed as described above.
Statistics.
Student's t test or analysis of
variance was used to analyze differences between groups. Statistical
significance is indicated either in the text or in the figure legends.
 |
RESULTS |
Total numbers of cells and organ weights during infection.
An
increase in the total number of mononuclear cells purified by Percoll
gradient centrifugation was observed during infection with H. capsulatum (Table 1). On day 5 of
infection, a threefold increase in cell numbers was observed over that
for control lungs. The peak number of cells isolated from infected
lungs on days 7 to 10 was seven- to ninefold larger than control
values. Subsequently, the number of cells declined. This pattern of
cell influx correlates with the CFU in lungs of mice exposed
intranasally to yeasts (9).
The mean lung weight of control animals ± standard error was
280 ± 2.3 mg (n = 8). During infection, the mean
weights on day 3 (290 ± 2.6 mg [n = 3]) and day
5 (363 ± 4.5 mg [n = 3]) did not differ
significantly (P > 0.05) from those of naive animals. In contrast, mean lung weights determined on day 7 (458 ± 2.6 mg
[n = 5]), day 10 (486 ± 4.2 mg
[n = 5]), day 14 (512 ± 2.7 mg
[n = 5]), day 22 (447 ± 2.2 mg
[n = 3]), and day 28 (413 ± 2.7 mg
[n = 3]) of infection exceeded (P < 0.01) those of controls. Organ weights had declined after day 14 and
were similar to control values by day 36 (313 ± 3.8 [n = 3]).
Phenotype of lineage-specific cells from infected lungs.
Single-cell suspensions prepared from lungs of infected animals during
infection with H. capsulatum were analyzed by flow cytometry
for cell surface markers that define specific cell lineages. Myeloid
lineage cells express the cell surface molecule recognized by
anti-Mac-1 (CR3, CD11b); therefore, this phenotype is shared by the
monocyte/M
as well as polymorphonuclear neutrophils (PMN) (21). The MAb Gr-1 (RB-6), which is specific for
granulocytes located in tissues other than bone marrow (12),
was used to distinguish between these two major myeloid populations of
the lung. In addition, CD45 (B220 isoform, specific for B cells), Thy-1
(specific for T cells), and the natural killer (NK) cell marker NK1.1
also were used in this analysis. Percentages and absolute numbers of
cells within each subpopulation were determined during infection. The
relative contribution of each lineage within the lung microenvironment
was reflected in percentage values.
Representative profiles for control and infected lungs on days 5, 7, 10, 12, and 14 of infection with H. capsulatum are
illustrated in Fig. 1. The percentage of
Mac-1+ cells increased threefold over that observed in
lungs from naive animals on day 5 of infection, was fivefold greater
than the control value on day 7, and then declined. The PMN population
increased, as did M
, and represented 50 to 80% of the
Mac-1+ cells throughout the time period analyzed. The
variation in percentages of NK cells was twofold greater than that of
control values on days 5 and 7 of infection, and the pattern of
fluctuation of the NK cell population correlated with the influx of
Mac-1+ cells. T-cell percentages increased from days 5 to
12 of infection, but a decreased percentage was evident on day 14. Percentages for B cells decreased during the course of infection to a
level fourfold lower than that for control lungs by day 7 of infection and increased to control levels thereafter.

View larger version (58K):
[in this window]
[in a new window]
|
FIG. 1.
Analysis of lineage-specific cells in lungs of mice
during H. capsulatum infection. Single-cell suspensions from
lungs of naive and infected animals, obtained on days 5, 7, 10, 12, and
14 of infection, were stained with lineage-specific MAbs. The numbers
in the upper right corners of the panels are the percentages of
positive cells. The data represent one of three experiments performed
per day of analysis. Naive animals (n = 5) were assayed
concomitantly with infected animals.
|
|
Since percentages do not always reveal the true variation in cell
populations during infection, the data were also analyzed as total
numbers of lineage-specific cells in control and infected lungs during
infection. The analysis revealed an initial increase in the total
numbers of cells expressing markers for all lineages by day 5 of
infection (Fig. 2). Peak levels of
absolute numbers of myeloid lineage and NK cells were observed on day 7 of infection, prior to the T-cell peak on day 10. The timing of
observed increases in percentages and absolute numbers of cells
correlated in all lineages analyzed except B cells. Although this
population declined as a percentage of the total cell population during
infection, the actual number of B cells in infected lungs increased.

View larger version (56K):
[in this window]
[in a new window]
|
FIG. 2.
Total number of lung cells expressing lineage-specific
markers during infection. Flow cytometry data for the percentages of
positive cells were corrected for the percentage of CD45+
cells within the analysis gate. The data are expressed as the
means ± standard error of values for five control (C) animals or
three infected animals at each time point analyzed. The P
value for numbers of B220+ cells on day (D) 5 of infection
was 0.03. All other data have significance values of 0.009.
|
|
Two populations of Mac-1+ cells that differed in
fluorescence intensity (a low-MFI population [Mac-1lo]
and a high-MFI population [Mac-1hi]) were observed in
lungs from naive and infected mice (Table 2). Among Mac-1+ cells in
uninfected animals, the Mac-1lo population represented
approximately 75% of the total cells and had an MFI of 14.5. The
Mac-1hi population manifested an MFI of 69.5. By contrast,
the Mac-1hi population (MFI = 97.3) had escalated to
51% on day 5 of infection. In addition, on day 7, when the percentage
of Mac-1+ cells was the highest (>50% of total cells), it
was difficult to distinguish two populations since one broad peak with
an MFI value of 43.6 that falls between the control and day 5 values was observed. On days 10 and 14 of infection, the proportions of both
populations of Mac-1+ cells were similar to those of
uninfected mice, although the Mac-1hi population exhibited
a much higher MFI.
CD4 and CD8 subset analysis.
Because of the established roles
of both CD4+ and CD8+ T cells in protective
immunity against H. capsulatum (7, 16, 29), we
analyzed these subsets in lungs during the course of infection. The
absolute numbers of CD4+ and CD8+ cells
increased up to day 10 of infection and then declined (Fig. 3). To determine the relative increase of
the two populations, the CD4/CD8 cell ratio during infection was
calculated. During the first week of infection, the
CD4+-to-CD8+ cell ratio observed in infected
lungs (1.7) was essentially the same as the ratio observed in lungs
from naive animals (1.8). During the second week of infection, the
CD4/CD8 ratio increased to approximately three times the control level
on day 10 of infection and remained elevated through day 14, reflecting
a greater increase in CD4+ T cells at the time when the
total T-cell population dramatically increased.

View larger version (26K):
[in this window]
[in a new window]
|
FIG. 3.
Fluctuations in CD4/CD8 cell ratios during infection.
The total number of CD4+ and CD8+ cells from
murine lungs was analyzed by flow cytometry. The data from five naive
animals (C) or three infected animals at each time point analyzed are
expressed as means ± standard error of the total number of
cells.
|
|
Analysis of cytokine-specific mRNA.
To determine the kinetics
of cytokine induction during pulmonary infection with H. capsulatum, oligo(dT)-primed cDNA prepared from RNA isolated from
the lungs of control and infected mice was analyzed by PCR for the
presence of cytokine-specific products. IFN-
-, IL-2-, IL-4-, and
IL-12 p35- and p40-specific PCR products amplified from the lungs of
H. capsulatum-infected mice were observed, but IL-10 message
was never seen (Fig. 4). IFN-
, IL-2,
and IL-4 transcripts were not detectable in the lungs of naive animals but were evident as early as day 1 of infection and were observed for
up to 5 weeks after infection. PCR products for both chains of IL-12
(p35 and p40) were amplified from lung RNA isolated from both control
and infected animals during the time period analyzed.

View larger version (48K):
[in this window]
[in a new window]
|
FIG. 4.
PCR analysis of cytokine-specific cDNA from infected
lung tissue. PCR products generated by amplification of 1 µl of cDNA
with primers specific for HPRT, IFN- , IL-12 p40, or IL-10 or of 2 µl of cDNA with IL-2-, IL-12 p35-, or IL-4-specific primers were
separated by electrophoresis on a 1.5% agarose gel. The
positive-control cDNA for IL-12 p35 and p40 (+) was made from RNA
isolated from LPS-stimulated peritoneal exudate cells. Control cDNA for
HPRT and lymphokines (C) was from concanavalin A-stimulated
splenocytes.
|
|
Competitive PCR analysis of cytokine mRNA.
To quantify the
transcripts observed during the course of infection, a competitive PCR
analysis was performed, using the previously described pPQRS
polycompetitor (23). A typical experiment (Fig. 5), consisting of six PCR analyses,
included tubes containing no pPQRS insert and other tubes with twofold
dilutions of the competitor DNA. The concentration of competitor DNA
was adjusted so that each analysis showed a linear response.

View larger version (44K):
[in this window]
[in a new window]
|
FIG. 5.
Protocol for analysis of competitive PCRs. Shown are
representative examples of ethidium bromide-stained gels of competition
reactions between the pPQRS competitor DNA and lung tissue cDNA for
IFN- on days (D) 5, 7, 10, and 14 of infection. The values below the
six lanes in each analysis are the dilutions of competitor added to the
reaction tubes. Lanes marked with 0 received no pPQRS.
|
|
Competitive PCR analyses were conducted for HPRT, IFN-
, IL-2, IL-4,
and the p35 and p40 chains of IL-12 (Fig.
6). Specific PCR products for IFN-
,
IL-2, and IL-4 from lungs of uninfected control animals were either not
detected or too low in concentration and therefore could not be
quantified. In infected animals, IFN-
and IL-2 mRNAs were detectable
starting on day 1 of infection; however, only for IFN-
, on days 7 and 10, was the level statistically significant (P
0.02). IL-4-specific transcripts, although evident on days 1, 3, and 5 of infection, were not at levels significantly different
(P > 0.05) from those of the controls. Values for the IL-12 p35 and p40 transcripts were significantly increased compared to
those of naive animals after day 5 of infection. The values determined
for the p40 chain on days 7, 10, and 14 were significantly different
from those of the controls (P
0.05). In contrast, only on day 7 was the IL-12 p35 chain data significantly different from
that of the controls (P
0.001).

View larger version (29K):
[in this window]
[in a new window]
|
FIG. 6.
Competitive PCR analysis for IL-12 p40 and p35, IFN- ,
IL-2, and IL-4. Densitometry measurements for specific PCR products
amplified from lung cDNA and pPQRS DNA were analyzed as described in
Materials and Methods for determination of equivalent concentrations
for standard (pPQRS) and experimental (lung) DNA. The data are
presented as ratios of cytokine values to HPRT values. Each point is
the mean ± standard error of data from three to five mice.
Asterisks indicate data that are significantly different from the
values for naive controls as determined by Student's t test
(P 0.05).
|
|
Cytoplasmic expression of IFN-
by lung cells.
IFN-
is
the only murine lymphokine that is known to be involved in the
clearance of H. capsulatum in vivo (32). To
determine the level of production of the IFN-
protein during primary
infection, single-cell suspensions prepared from the lungs of naive and
infected animals were examined for cytoplasmic expression of IFN-
at
several time points after infection. Cytoplasmic staining for IFN-
was not detected in lung cells from noninfected animals. In infected mice, the percentage of Thy-1+ cells that express IFN-
intracellularly was increased over that of naive controls during the
time period analyzed (Table 3). The MFI
values revealed that a relatively large amount of IFN-
was produced
by Thy-1+ cells on day 3 (19.6-fold increase). On day 5, the increase was less (8.9-fold); however, the values subsequently
increased through day 14 of infection. In some samples analyzed,
particularly on day 3, a fraction of IFN-
-producing cells that did
not bear Thy-1 was evident.
Since IFN-
can be produced by T cells and NK cells (17,
19), we determined the phenotype of cells producing this cytokine during primary infection. CD4, CD8, and NK cells were isolated on day 9 or 10 of infection by cell sorting to >96% purity before cytoplasmic
staining for IFN-
. The day 9-10 time point was chosen because this
was when peak levels of T cells were observed, NK cells also were
numerous, and a high level of cytoplasmic IFN-
was detected in the
total lung cell population. The results of this analysis (Fig.
7A) demonstrated that all three subsets
produced IFN-
, but not at the same levels. Analysis of the total
numbers of IFN-
+ cells in each group revealed that
CD4+ and CD8+ cell numbers were similar
(3.6 × 105 and 3.5 × 105 cells,
respectively) whereas 4.9 × 104 NK cells coexpressed
IFN-
.

View larger version (35K):
[in this window]
[in a new window]
|
FIG. 7.
Phenotype of cells expressing cytoplasmic IFN- . (A)
Sorted populations of cells isolated from infected mice on days 9 to 10 of infection were analyzed for cytoplasmic expression of IFN- as
described in Materials and Methods. The profiles shown are from one of
two similar experiments. (B) The total cell population isolated from
the lung was analyzed by two-color immunofluorescence analysis of
IFN- versus an irrelevant MAb (control), CD4, or B220. Fluorescence
intensity is measured on a log scale of 0.1 to 1,000.
|
|
To determine the relative amounts of protein produced, the MFIs of
cells expressing this cytokine were compared. The hierarchy of
synthesis on days 9 to 10 of infection was CD4+ cells
(MFI = 6.75) > CD8+ cells (MFI = 5.14), and the
lowest level of protein was produced by the NK cell population
(MFI = 4.43). To establish the specificity of expression of
IFN-
, lung cell suspensions were stained in a two-color analysis
with MAbs recognizing B cells or CD4+ T cells and IFN-
(Fig. 7B). This analysis demonstrated that the IFN-
MAb does not
react nonspecifically, since this cytokine was not detectable in B
cells that do not produce IFN-
but was detectable in
CD4+ T cells, which are known IFN-
producers.
 |
DISCUSSION |
Early studies of the primary immune response to H. capsulatum in mice have utilized a model of disseminated disease
by infecting animals intravenously and examining fungal burden,
cellular infiltration, or cytokines produced in the spleen after
infection (2, 29, 32). In the present study, we used the
intranasal route of delivering yeast cells to mimic the natural route
of infection rather than intravenous inoculation and concentrated on
the primary site of infection, the lung. The intent of this study was
to identify changes in the inflammatory and cytokine responses induced
by H. capsulatum infection in murine lungs over time.
The influx of hemopoietic cells into infected lungs after day 4 of
infection correlated with a large increase in the percentage and total
numbers of myeloid lineage cells. On day 7 of infection, these
phagocytic cells represented the most numerous population in the lung,
with >13 million cells. The myeloid population was composed of M
and PMN, and the latter represented 50 to 80% of the myeloid cell
population on all days analyzed. Both types of phagocytic cells ingest
H. capsulatum yeast cells, yet they have disparate
functions. M
provide an environment for replication of the yeast
cells and release monokines that amplify the immune response. Upon
activation, M
are induced to restrict the growth of H. capsulatum. PMN, in contrast, limit growth in the absence of
activation. Subsequently, this pathogen is cleared spontaneously in
immunocompetent hosts (22).
Since CR3 is a receptor used for the binding and ingestion of
unopsonized H. capsulatum yeast cells by M
and PMN
(6), and expression of this molecule is upregulated when
myeloid cells are stimulated in vitro (21) and at sites of
inflammation (1, 18), we measured Mac-1 (CR3) expression by
myeloid lineage cells during H. capsulatum infection. On day
5 of infection, approximately 50% of the Mac-1+ cells were
Mac-1hi, compared to 25% in naive mice and 15 to 25% on
days 10 and 14 of infection. Thus, by day 5 of infection, there was a
dramatic upregulation of surface CR3. It is likely that both M
and
PMN are included in the Mac-1hi population. This elevated
expression may serve as a mechanism by which phagocytes augment
ingestion of yeast cells and increase egress into sites of
inflammation.
We determined the changes in the cellular composition of lungs during
the course of the disease. In addition to measuring myeloid lineage
cells, T, B, and NK cells were monitored. The data demonstrated an
initial increase in the percentage and absolute cell number of myeloid
lineage cells early in infection (day 5). Peak levels of M
-PMN and
NK cells were observed on day 7, before the major increase in T cells
on day 10. The delay in T-cell expansion is not surprising since
signals from myeloid lineage cells are necessary for T-cell activation
(11). The elevation of the T-cell population probably occurs
too rapidly to be explained by in situ expansion of antigen-specific T
cells, and the increased cell number is more likely a result of influx.
The decline in the percentage of B cells during the first 10 days of
infection correlated with a modest increase in total cell numbers. This
finding indicated that the rate of increase of B cells early during
infection is slow compared to those of the other lineages. The total
number of B-lineage cells increased as the influx of M
-PMN and T
cells subsided. Therefore, there was an initial wave of myeloid and NK
cells infiltrating infected lungs. As their numbers diminished, the
T-cell population and, subsequently, the B-cell population increased.
As late as 2 weeks after infection, the cellular composition of lung
tissue differed from that observed in lungs from naive animals.
Previous reports have described the cellular composition of either
bronchoalveolar lavage (BAL) fluid or lymph nodes during infection.
Examination of BAL fluid cells from infected mice demonstrates a large
increase in the PMN population over that of naive animals on day 7 followed by a lymphocyte peak on day 10, but no differences in the
numbers of M
are observed (5). These data from cells isolated by BAL represent only a fraction of lung cells and neither reflect the dramatic change in myeloid cells that we observed early in
infection nor distinguish the types of lymphocytes enumerated. Phenotypic analysis of lung-associated lymph nodes revealed that expansion of the B-cell population is dominant in this tissue 7 days
after infection whereas T-cell increases are modest and M
numbers
remain constant (13). In contrast, in the current study, B
cells were not the dominant cell type in infected lungs. These
differences indicate that the inflammatory response may vary depending
on the tissue microenvironment. Since lymph nodes are not the initial
site of infection and therefore are not the first line of defense
against H. capsulatum, expansion of phagocytic cells there
is not necessary. In contrast to the lung, lymph node tissue functions
in the expansion of antigen-specific B cells in germinal centers.
Therefore, an increase in the B-cell population would be expected after
antigens carried by the lymphatic system arrive in the lymph nodes and
activate the selection and expansion of antibody-secreting cells.
Since secretion of monokines and cytokines is necessary for resolution
of an infection, the patterns of upregulation of cytokine-specific mRNA
were determined by competitive PCR analysis to confirm the order of
induction and the relative amounts of cytokine transcripts observed
during infection. The first transcripts to be detected were specific
for IL-12 and IL-4, and they were followed by IL-2 and IFN-
. The
observation that IL-12-specific transcripts were detected before those
of IL-2 and IFN-
supports and extends published data indicating that
IL-12 is one of the first cytokines induced after infection by
intracellular parasites and that secretion of IL-12 is necessary for
IFN-
production (14, 28). The generation of p35
transcripts was influenced by the infectious process less than that of
the p40 chain transcripts, since significance was evident only on day 7 of infection for the p35 chain. The disparity in the levels of the two
chains at certain time points supports the contention that synthesis of
the p35 chain determines the amount of functional IL-12 that is
eventually generated (27).
Quantitatively, the increase in IFN-
transcripts during the course
of infection was 2 logs higher than those of IL-2 and IL-4. The
elevated mRNA levels of IFN-
imply that this lymphokine may
contribute to host defense against H. capsulatum. Indeed, this postulate is true since IFN-
is necessary for the control of
infection (31, 32).
On the other hand, the small quantities of IL-2 and IL-4 produced
suggest that these cytokines do not play a prominent regulatory role in
controlling infection in hosts challenged with a sublethal dose. This
argument is supported by the finding that neither treatment with
recombinant IL-2 nor administration of anti-IL-4 MAb influences the
course of a sublethal infection (9, 10). Conversely, in vivo
treatment with anti-IL-4 MAb protects mice upon challenge with a lethal
dose of yeast cells (32). Taken together, these findings
indicate that there appears to be a correlation in sublethal histoplasmosis between the transcript level and the functional importance of that transcript.
Since the presence of transcript does not guarantee that protein is
produced, relative levels of IFN-
protein were measured by
cytoplasmic staining during the first 2 weeks of infection. The
percentage of Thy-1+ cells that produced IFN-
and the
levels of protein as measured by MFI values were approximately the same
at each time point examined except day 5 of infection, when fewer cells
were producing a smaller amount of cytokine than on day 3. The
relatively large amounts of IFN-
produced on day 3 were not expected
since the transcript levels for IFN-
were only slightly elevated.
These data indicate a disparity between quantities of mRNA and protein
production. In addition, the pattern of protein expression was not
expected since increased levels of NK and T cells, the principal
producers of IFN-
(17, 19), were observed later, on days
5 and 7, respectively. A possible explanation is that resident lung
cells, especially NK cells, that do not require specific antigen
recognition produce an initial burst of IFN-
after being stimulated
by IL-12 or other regulatory molecules, and then a subsequent wave of
protein is induced when the T-cell population expands on days 7 to 10. Two-color analyses of lung cells with MAbs to Thy-1 and IFN-
demonstrated that in several assays there was a small population of
IFN-
+ cells that were not T cells. Although it may be
assumed that these were NK cells, efforts to detect IFN-
-producing
NK cells were not successful because of the small numbers of cells in
total lung suspensions.
Another observation from the cytoplasmic staining data was that
although it is possible that most Thy-1+ cells are
producing IFN-
at levels too low to detect by cytoplasmic staining,
a small population of cells at all time points examined produced a
relatively large amount of protein. The data did not reveal whether the
same subset of cells is responsible for increased IFN-
production
throughout infection, but the cells producing the most cytokine during
the adaptive immune response after day 7 of infection may be responding
to an antigen and therefore may display a limited T-cell receptor
repertoire. Populations of IFN-
-producing cells observed as early as
day 3 could be NK cells or T cells bearing low-affinity receptors that
nonetheless react to H. capsulatum antigens.
Although CD4+ T cells are necessary for clearance of
organisms during H. capsulatum infection (16, 29,
30), CD8+ cells also contribute to host protection
(7). Measurement of T-cell numbers in infected lungs
revealed that the absolute numbers of CD8+ cells increased
as did the CD4+ population, but to a lesser extent. IFN-
can be produced by NK cells as well as CD4+ and
CD8+ T cells (4, 17, 19, 26), and all three cell
types were elevated in number after infection. Since previous studies
have not determined the cell lineages responsible for producing IFN-
in the lungs of mice infected with H. capsulatum, the
phenotype of cells producing this cytokine was determined after
isolating each population by cell sorting. This analysis revealed that
all three cell populations produced IFN-
on days 9 to 10 of
infection but at different levels. Approximately the same number of
CD4+ and CD8+ cells produce IFN-
, yet the
MFI values were greater for the CD4 subset, indicating that this is the
dominant producer of IFN-
. Although the hierarchy of IFN-
expression was CD4+ > CD8+ > NK cells, it is
interesting that all cell types are involved in cytokine production
relatively late in infection, when T cells are dominant.
In this study, we determined the order of influx of hemopoietic lineage
cells into the infected lungs of immunocompetent hosts and correlated
this inflammatory response with the production of cytokines during the
primary immune response to H. capsulatum infection in mice.
Knowledge about the sequence of events during the primary immune
response of an immunocompetent host infected with H. capsulatum is necessary to understand how and when
immunocompromised hosts fail to resolve the infection. The recognition
of deficiencies that result in deviations from the normal immune
response can direct the development of methods for therapeutic
intervention.
 |
ACKNOWLEDGMENTS |
This work was supported by grants AI-34361 and AI-42747 and by a
Merit Review Award from the Department of Veterans Affairs.
We thank Reta Gibbons for her excellent technical assistance and Simon
L. Newman for his critical review of the manuscript.
 |
FOOTNOTES |
*
Corresponding author. Mailing address: Department of
Internal Medicine, Division of Infectious Diseases, University of
Cincinnati Medical Center, P.O. Box 670560, Cincinnati, OH 45267-0560. Phone: (513) 558-4704. Fax: (513) 558-2089. E-mail:
deepegs{at}email.uc.edu.
Editor: T. R. Kozel
 |
REFERENCES |
| 1.
|
Allen, C. A.,
J. Highton, and D. G. Palmer.
1989.
Increased expression of p150,95 and CR3 leukocyte adhesion molecules by mononuclear phagocytes in rheumatoid synovial membranes.
Arthritis Rheum.
32:947-954[Medline].
|
| 2.
|
Artz, R. P., and W. E. Bullock.
1979.
Immunoregulatory responses in experimental disseminated histoplasmosis: lymphoid organ histopathology and serological studies.
Infect. Immun.
23:884-892[Abstract/Free Full Text].
|
| 3.
|
Assenmacher, M.,
J. Schmitz, and A. Radbruch.
1994.
Flow cytometric determination of cytokines in activated murine T helper lymphocytes: expression of interleukin-10 in interferon- - and in interleukin-4-expressing cells.
Eur. J. Immunol.
24:1097-1101[Medline].
|
| 4.
|
Bancroft, G. J.,
R. D. Schreiber, and E. R. Unanue.
1991.
Natural immunity: a T-cell-independent pathway of macrophage activation, defined in the scid mouse.
Immunol. Rev.
124:5-24[Medline].
|
| 5.
|
Baughman, R. P.,
C. K. Kim,
A. Vinegar,
D. E. Hendricks,
D. J. Schmidt, and W. E. Bullock.
1986.
The pathogenesis of experimental pulmonary histoplasmosis. Correlative studies of histopathology, bronchoalveolar lavage, and respiratory function.
Am. Rev. Respir. Dis.
134:771-776[Medline].
|
| 6.
|
Bullock, W. E., and S. D. Wright.
1987.
Role of the adherence-promoting receptors, CR3, LFA-1, and p150,95, in binding of Histoplasma capsulatum by human macrophages.
J. Exp. Med.
165:195-210[Abstract/Free Full Text].
|
| 7.
|
Deepe, G. S., Jr.
1994.
Role of CD8+ T cells in host resistance to systemic infection with Histoplasma capsulatum in mice.
J. Immunol.
152:3491-3500[Abstract].
|
| 8.
|
Deepe, G. S., Jr.
1994.
The immune response to Histoplasma capsulatum: unearthing its secrets.
J. Lab. Clin. Med.
123:201-205[Medline].
|
| 9.
| Deepe, G. S., Jr. Unpublished data.
|
| 10.
|
Deepe, G. S., Jr.,
C. L. Taylor,
J. E. Harris, and W. E. Bullock.
1986.
Modulation of cellular immune responses in mice with disseminated histoplasmosis by recombinant interleukin-2.
Infect. Immun.
53:6-12[Abstract/Free Full Text].
|
| 11.
|
Doherty, T. M.
1995.
T-cell regulation of macrophage function.
Curr. Opin. Immunol.
7:400-404[Medline].
|
| 12.
|
Fleming, T. J.,
M. L. Fleming, and T. R. Malek.
1993.
Selective expression of Ly-6G on myeloid lineage cells in mouse bone marrow.
J. Immunol.
151:2399-2408[Abstract].
|
| 13.
|
Fojtasek, M. F.,
M. R. Sherman,
T. Garringer,
R. Blair,
L. J. Wheat, and C. T. Schnizlein-Bick.
1993.
Local immunity in lung-associated lymph nodes in a murine model of pulmonary histoplasmosis.
Infect. Immun.
61:4607-4614[Abstract/Free Full Text].
|
| 14.
|
Gazzinelli, R. T.,
S. Hieny,
T. A. Wynn,
S. Wolf, and A. Sher.
1993.
Interleukin 12 is required for the T-lymphocyte-independent induction of interferon by an intracellular parasite and induces resistance in T-cell-deficient hosts.
Proc. Natl. Acad. Sci. USA
90:6115-6119[Abstract/Free Full Text].
|
| 15.
|
Goding, J. W.
1976.
Conjugation of antibodies with fluorochromes: modification to the standard methods.
J. Immunol. Methods
13:215-226[Medline].
|
| 16.
|
Gomez, A. M.,
W. E. Bullock,
C. L. Taylor, and G. S. Deepe, Jr.
1988.
Role of L3T4+ T cells in host defense against Histoplasma capsulatum.
Infect. Immun.
56:1685-1691[Abstract/Free Full Text].
|
| 17.
|
Handa, K.,
R. Suzuki,
H. Matsui,
Y. Shimizu, and K. Kumagai.
1983.
Natural killer (NK) cells as a responder to interleukin 2 (IL 2). II. IL 2-induced interferon production.
J. Immunol.
130:988-992[Abstract].
|
| 18.
|
Highton, J.,
B. Carlisle, and D. G. Palmer.
1995.
Changes in the phenotype of monocytes/macrophages and expression of cytokine mRNA in peripheral blood and synovial fluid of patients with rheumatoid arthritis.
Clin. Exp. Immunol.
102:541-546[Medline].
|
| 19.
|
Kasahara, T.,
J. J. Hooks,
S. F. Dougherty, and J. J. Oppenheim.
1983.
Interleukin 2-mediated immune interferon (IFN-gamma) production by human T cells and T cell subsets.
J. Immunol.
130:1784-1789[Abstract].
|
| 20.
|
Lane, T. E.,
B. A. Wu-Hsieh, and D. H. Howard.
1993.
Gamma interferon cooperates with liposaccharide to activate mouse splenic macrophages to an antihistoplasma state.
Infect. Immun.
61:1468-1473[Abstract/Free Full Text].
|
| 21.
|
Miller, L. J.,
D. F. Bainton,
N. Borregaard, and T. A. Springer.
1987.
Stimulated mobilization of monocyte Mac-1 and p150,95 adhesion proteins from an intracellular vesicular compartment to the cell surface.
J. Clin. Invest.
80:535-544.
|
| 22.
|
Newman, S. L., and W. E. Bullock.
1993.
Interaction of Histoplasma capsulatum yeasts and conidia with human and animal macrophages, p. 517-532. In
B. S. Zwilling, and T. K. Eisenstein (ed.), Macrophage-pathogen interactions.
Marcel Dekker, Inc., New York, N.Y.
|
| 23.
|
Reiner, S. L.,
S. Zheng,
D. B. Corry, and R. M. Locksley.
1993.
Constructing polycompetitor cDNAs for quantitative PCR.
J. Immunol. Methods
165:37-46[Medline].
|
| 24.
|
Romani, L.,
A. M. Mencacci,
L. Tonnetti,
R. Spaccapelo,
E. Cenci,
P. Puccetti,
S. F. Wolf, and F. Bistoni.
1994.
IL-12 is both required and prognostic in vivo for T helper type 1 differentiation in murine candidiasis.
J. Immunol.
152:5167-5175.
|
| 25.
|
Scheid, M. P., and D. Triglia.
1979.
Further description of the Ly-5 system.
Immunogenetics
9:423-433.
|
| 26.
|
Seder, R. A.,
R. Gazzinelli,
A. Sher, and W. P. Paul.
1993.
Interleukin 12 acts directly on CD4+ T cells to enhance priming for interferon production and diminishes interleukin 4 inhibition of such priming.
Proc. Natl. Acad. Sci. USA
90:10188-10192[Abstract/Free Full Text].
|
| 27.
|
Trinchieri, G.
1995.
Interleukin-12: a proinflammatory cytokine with immunoregulatory functions that bridge innate resistance and antigen-specific adaptive immunity.
Annu. Rev. Immunol.
13:251-276[Medline].
|
| 28.
|
Trinchieri, G.
1997.
Cytokines acting on or secreted by macrophages during intracellular infection (IL-10, IL-12, IFN- ).
Curr. Opin. Immunol.
9:17-23[Medline].
|
| 29.
|
Wu-Hsieh, B.
1989.
Relative susceptibilities of inbred mouse strains C57BL/6 and A/J to infection with Histoplasma capsulatum.
Infect. Immun.
57:3788-3792[Abstract/Free Full Text].
|
| 30.
|
Wu-Hsieh, B. A.
1993.
Resistance mechanisms in murine experimental histoplasmosis.
Arch. Med. Res.
24:233-238[Medline].
|
| 31.
|
Wu-Hsieh, B. A., and D. H. Howard.
1987.
Inhibition of the intracellular growth of Histoplasma capsulatum by recombinant murine gamma interferon.
Infect. Immun.
55:1014-1016[Abstract/Free Full Text].
|
| 32.
|
Zhou, P.,
M. C. Sieve,
J. Bennett,
K. J. Kwon-Chung,
R. P. Tewari,
R. T. Gazzinelli,
A. Sher, and R. A. Seder.
1995.
IL-12 prevents mortality in mice infected with Histoplasma capsulatum through induction of IFN- .
J. Immunol.
155:785-795[Abstract].
|
Infect Immun, April 1998, p. 1473-1481, Vol. 66, No. 4
0019-9567/98/$04.00+0
Copyright © 1998, American Society for Microbiology. All rights reserved.
This article has been cited by other articles:
-
Deepe, G. S. Jr, Gibbons, R. S., Smulian, A. G.
(2008). Histoplasma capsulatum manifests preferential invasion of phagocytic subpopulations in murine lungs. J. Leukoc. Biol.
84: 669-678
[Abstract]
[Full Text]
-
Lazar-Molnar, E., Gacser, A., Freeman, G. J., Almo, S. C., Nathenson, S. G., Nosanchuk, J. D.
(2008). The PD-1/PD-L costimulatory pathway critically affects host resistance to the pathogenic fungus Histoplasma capsulatum. Proc. Natl. Acad. Sci. USA
105: 2658-2663
[Abstract]
[Full Text]
-
Deepe, G. S. Jr., Gibbons, R. S.
(2008). TNF-{alpha} Antagonism Generates a Population of Antigen-Specific CD4+CD25+ T Cells That Inhibit Protective Immunity in Murine Histoplasmosis. J. Immunol.
180: 1088-1097
[Abstract]
[Full Text]
-
Allen, H. L., Deepe, G. S. Jr.
(2006). B Cells and CD4-CD8- T Cells Are Key Regulators of the Severity of Reactivation Histoplasmosis. J. Immunol.
177: 1763-1771
[Abstract]
[Full Text]
-
Lin, J.-S., Wu-Hsieh, B. A.
(2004). Functional T cells in primary immune response to histoplasmosis. Int Immunol
16: 1663-1673
[Abstract]
[Full Text]
-
Barton, L. F., Runnels, H. A., Schell, T. D., Cho, Y., Gibbons, R., Tevethia, S. S., Deepe, G. S. Jr., Monaco, J. J.
(2004). Immune Defects in 28-kDa Proteasome Activator {gamma}-Deficient Mice. J. Immunol.
172: 3948-3954
[Abstract]
[Full Text]
-
Deepe, G. S. Jr., Gibbons, R. S.
(2003). Protective and Memory Immunity to Histoplasma capsulatum in the Absence of IL-10. J. Immunol.
171: 5353-5362
[Abstract]
[Full Text]
-
McCormack, F. X., Gibbons, R., Ward, S. R., Kuzmenko, A., Wu, H., Deepe, G. S. Jr.
(2003). Macrophage-independent Fungicidal Action of the Pulmonary Collectins. J. Biol. Chem.
278: 36250-36256
[Abstract]
[Full Text]
-
Barton, L. F., Cruz, M., Rangwala, R., Deepe, G. S. Jr., Monaco, J. J.
(2002). Regulation of Immunoproteasome Subunit Expression In Vivo Following Pathogenic Fungal Infection. J. Immunol.
169: 3046-3052
[Abstract]
[Full Text]
-
Deepe, Jr.,, G. S., Gibbons, R. S.
(2002). Cellular and Molecular Regulation of Vaccination with Heat Shock Protein 60 from Histoplasma capsulatum. Infect. Immun.
70: 3759-3767
[Abstract]
[Full Text]
-
Wu-Hsieh, B. A., Whitmire, J. K., de Fries, R., Lin, J.-S., Matloubian, M., Ahmed, R.
(2001). Distinct CD8 T Cell Functions Mediate Susceptibility to Histoplasmosis During Chronic Viral Infection. J. Immunol.
167: 4566-4573
[Abstract]
[Full Text]
-
Gomez, F. J., Woodward, E. O., Pilcher-Roberts, R., Gibbons, R. S., Deepe, G. S. Jr.
(2001). V{{beta}}6+ and V{{beta}}4+ T Cells Exert Cooperative Activity in Clearance of Secondary Infection with Histoplasma capsulatum. J. Immunol.
166: 2855-2862
[Abstract]
[Full Text]
-
Deepe, G. S. Jr., Gibbons, R.
(2000). Recombinant Murine Granulocyte-Macrophage Colony-Stimulating Factor Modulates the Course of Pulmonary Histoplasmosis in Immunocompetent and Immunodeficient Mice. Antimicrob. Agents Chemother.
44: 3328-3336
[Abstract]
[Full Text]
-
Allendoerfer, R., Deepe, G. S. Jr.
(2000). Regulation of Infection with Histoplasma capsulatum by TNFR1 and -2. J. Immunol.
165: 2657-2664
[Abstract]
[Full Text]
-
Cain, J. A., Deepe, G. S. Jr.
(2000). Interleukin-12 Neutralization Alters Lung Inflammation and Leukocyte Expression of CD80, CD86, and Major Histocompatibility Complex Class II in Mice Infected with Histoplasma capsulatum. Infect. Immun.
68: 2069-2076
[Abstract]
[Full Text]
-
Deepe, G. S. Jr., Gibbons, R., Woodward, E.
(1999). Neutralization of Endogenous Granulocyte-Macrophage Colony-Stimulating Factor Subverts the Protective Immune Response to Histoplasma capsulatum. J. Immunol.
163: 4985-4993
[Abstract]
[Full Text]