This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow E-mail this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in ASM journals
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowReprints and Permissions
Right arrow Copyright Information
Right arrow Books from ASM Press
Right arrow MicrobeWorld
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Cain, J. A.
Right arrow Articles by Deepe, G. S.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Cain, J. A.
Right arrow Articles by Deepe, G. S., Jr.

 Previous Article  |  Next Article 

Infect Immun, April 1998, p. 1473-1481, Vol. 66, No. 4
0019-9567/98/$04.00+0
Copyright © 1998, American Society for Microbiology. All rights reserved.

Evolution of the Primary Immune Response to Histoplasma capsulatum in Murine Lung

Judith A. Cain and George S. Deepe Jr.*

Division of Infectious Diseases, Department of Medicine, University of Cincinnati College of Medicine, Cincinnati, Ohio 45267-0560, and Veterans Affairs Hospital, Cincinnati, Ohio 48229

Received 8 October 1997/Returned for modification 4 December 1997/Accepted 2 January 1998

    ABSTRACT
Top
Abstract
Introduction
Materials & Methods
Results
Discussion
References

Histoplasma capsulatum induces a cell-mediated immune response in the lungs and lymphoid organs of mammals. In this study, we analyzed the progression of the cytokine and inflammatory reactions in the lungs of mice infected intranasally with H. capsulatum. We measured cytokine mRNA levels and determined the inflammatory cell populations during the active phase of infection (<3 weeks). Transcription of genes encoding interleukin-2 (IL-2), IL-4, and IL-12 and gamma interferon (IFN-gamma ) was detectable as early as day 3 of infection, whereas a signal for IL-10 was never observed. Competitive PCR analysis demonstrated that enhanced expression of IL-12 mRNA was observed by day 3 and that expression of mRNA for IL-2 and IFN-gamma progressively increased from day 5 to day 10. All levels declined by day 14. Analysis of the inflammatory response revealed an initial elevation in myeloid cells (Mac-1+) and natural killer (NK) cells followed by a rise in T cells, predominantly CD4+ cells. Since IFN-gamma is a key factor in host defense, we performed cytoplasmic staining to determine the cell populations that produced this cytokine. The hierarchy of synthesis was CD4+ > CD8+ > NK cells. Thus, H. capsulatum provokes an orderly modulation of the inflammatory and cytokine responses in murine lungs.

    INTRODUCTION
Top
Abstract
Introduction
Materials & Methods
Results
Discussion
References

Resistance to Histoplasma capsulatum infection in mammals is primarily dependent on a cellular immune response mediated by T cells and mononuclear phagocytes (8). The initial site of infection is the lung, where yeast cells produced from inhaled microconidia are ingested by alveolar macrophages (Mphi ) via an interaction between the CD11/CD18 family of adhesion molecules and yeast cell wall components (6). Phagocytosis of H. capsulatum by Mphi results in a permissive environment for survival and replication of yeast cells until host resistance mechanisms induce clearance (22). Resolution of infection in mice correlates with the production of cytokines, especially gamma interferon (IFN-gamma ), which has been shown to induce fungistasis in peritoneal Mphi and in splenic Mphi in combination with lipopolysaccharide (LPS) (20, 31).

Two critical determinants of the course of infection are the cytokines released upon host-pathogen interaction and the inflammatory response evoked in response to invasion. Therefore, the inability to produce the appropriate cytokines that activate the antimicrobial properties of phagocytes often leads to disease progression.

To understand the perturbations of immunity that lead to progressive histoplasmosis, it is vitally important to gain knowledge concerning the cytokine profile and inflammatory response during the course of an infection that resolves without therapeutic intervention. This information can be useful not only in the development of immunotherapeutic targets but also for utilization of pharmaceutical agents that may modify the potential inimical effects of certain cytokines or an inappropriate inflammatory response. The purpose of the present study was to define the evolution of the primary immune response to H. capsulatum in mouse lungs by (i) determining the pattern of cytokine-specific mRNA upregulation during the first 6 weeks of infection and measuring these changes by competitive PCR analysis, (ii) characterizing the changes in lineage-specific cell populations in the lung during infection, and (iii) measuring cytoplasmic levels of IFN-gamma protein and determining the phenotype of cells producing this cytokine.

    MATERIALS AND METHODS
Top
Abstract
Introduction
Materials & Methods
Results
Discussion
References

Mice. Male C57BL/6 mice were purchased from Jackson Laboratory (Bar Harbor, Maine) and maintained in the animal facility at the University of Cincinnati. All experiments employed animals that were 6 to 12 weeks of age. Control and infected mice were housed in laminar-flow units.

Preparation of yeast cultures and intranasal infection of mice. H. capsulatum yeast cells (strain G217B) were grown for 48 h at 37°C in 50 ml of Ham's F-12 medium supplemented with glucose (18.2 g/liter), glutamic acid (1 g/liter), HEPES (6 g/liter), and cysteine (8.4 mg/liter). Cell suspensions were prepared by washing the cells three times with Hanks' balanced salt solution containing 0.2 M HEPES and 0.5% bovine serum albumin (BSA), with the third wash being done at 100 × g. The final volume was adjusted to equal 2.5 × 106 yeast cells per 50 µl of buffer. Mice anesthetized with Metophane (Pitman-Moore, Mundelein, Ill.) were infected with 2.5 × 106 yeast cells by pipetting the 50-µl volume into the nasal cavity with a micropipettor. Control animals were given an equal volume of buffer.

Antibodies and immunofluorescent reagents. The following reagents were purchased from Pharmingen (San Diego, Calif.): fluorescein isothiocyanate (FITC)-conjugated monoclonal antibodies (MAbs) to CD45 (clone 30F11.1), CD45R/B220 (clone RA3-6B2), CD90.2 (Thy-1, clone 30-H12), CD4 (clone RM4-5), and Ly-6G/Gr-1 (clone RB6-8C5); phycoerythrin-conjugated MAbs to NK1.1 (clone PK136), IFN-gamma (clone XMG1.2), and interleukin-2 (IL-2) (clone S4B6); and biotinylated NK1.1 and streptavidin-FITC (SAv-FITC). Antibodies manufactured by the hybridoma that produces anti-CD8 (clone 53.6.72; American Type Culture Collection) and by the anti-Mac-1 hybridoma (anti-CR3; clone M1/70) were purified from tissue culture supernatants by protein G affinity column (Pharmacia, Piscataway, N.J.) and conjugated to FITC as previously reported (15).

RNA and cDNA preparations. At various times after intranasal infection, lungs and spleens were removed from animals following perfusion with 30 ml of Hanks' balanced salt solution. Total RNA was isolated from tissues by using RNAzol (Tel-Test, Inc., Friendswood, Tex.) in accordance with the manufacturer's instructions. The total yield of RNA was quantified by measuring the optical density at 260 nm (OD260), and the purity, monitored by determining OD260/OD280 ratios, was >1.9 for all samples.

Oligo(dT)-primed cDNA was prepared by using the Reverse Transcriptase System (Promega, Madison, Wis.). Single-stranded cDNA was synthesized, using 1 µg of RNA as the template, by incubation at 42°C for 1 h in a total volume of 20 µl.

PCR primers and competitors. Sense and antisense primers to cytokines (IL-2, IL-4, IL-10, IFN-gamma , IL-12 p35, and IL-12 p40) and hypoxanthine phosphoribosyltransferase (HPRT) were synthesized in accordance with published sequences (23, 24).

Competitor DNA sequences for HPRT, IL-2, IL-4, IL-10, and IFN-gamma were from the previously described polycompetitor vector pPQRS (kindly provided by Richard M. Locksley, University of California, San Francisco) (23). The competitor was linearized from the vector DNA by digestion with SfiI and NotI restriction enzymes (New England Biolabs, Beverly, Mass.) and gel purified.

To construct polycompetitors for murine IL-12 p40 and p35, we amplified gene fragments from oligo(dT)-primed cDNA synthesized from RNA that was harvested from mouse Mphi stimulated with LPS. For IL-12 p40, the primer sequences were as follows: sense (5'-3'), CGGGATCCCTGGAGAAAGACGTTTATGT; and antisense (5'-3'), CGGAATTCGGGAGTGCTCGAGGAGTCAG. For IL-12 p35, the primer sequences were as follows: sense (5'-3'), ATAAGAATGCGGCCGCAAGAGACACAGTCCTGGG; and antisense (5'-3'), GGAATTCTGCATCAGCTCATCGATGGC. The gene products were amplified, gel purified, and checked for fidelity by restriction mapping. The IL-12 p40 gene fragment was digested with BamHI and EcoRI, and IL-12 p35 was digested with EcoRI and NotI; both were cloned into pBluescript SK(-) (Stratagene, La Jolla, Calif.). A 259-bp fragment from pGAD4 (Clontech, Palo Alto, Calif.) was isolated by digestion with SalI and HindIII and then cloned into the XhoI-HindIII site of plasmid pIL1240. A 200-bp SpeI fragment from pYX213 (Novagen, Madison, Wis.) was cloned into the XhoI site of pIL1235.

PCR analysis. One microliter of cDNA was incubated in a reaction mixture containing 50 mM KCl, 10 mM Tris-HCl (pH 9.0), 2.5 mM MgCl2, 0.1% Triton X-100, 0.2 mM each deoxynucleoside triphosphate, 1 µM each primer, and 0.625 U of Taq DNA polymerase (Promega) in a final volume of 25 µl. For HPRT-, IFN-gamma -, IL-2-, IL-10-, and IL-4-specific primers, the PCRs consisted of 35 cycles of 40 s at 94°C, 20 s at 60°C, and 40 s at 72°C followed by a 10-min extension. For IL-12-specific primers, the PCR consisted of 35 cycles of 1 min at 94°C, 1 min at 63°C (p35 chain) or 67°C (p40 chain), and 1 min at 72°C followed by a 10-min extension at 72°C.

For competitive PCR analysis, serial twofold dilutions of competitor DNA of a known concentration were added to the same amplification reaction mixtures as cDNA synthesized from lung RNA samples. The relative densities of ethidium bromide-stained PCR products separated on a 3% agarose gel were measured with an IS-1000 digital imaging system (Alpha-Innotech, San Leandro, Calif.). Quantitation of cDNA was accomplished by plotting the log of the lung sample/competitor density ratio versus the log of the competitor concentration. The equivalence point, defined as the point at which the density ratio equals zero, was determined by linear regression analysis and solving for y = 0. HPRT-specific cDNA was quantified as the amount of mRNA in each sample. To normalize the amount of primable mRNA among the samples, the data were analyzed as cytokine/HPRT concentration ratios.

Preparation of single-cell suspensions from lung tissue. The lungs of infected animals were removed on one of several specified days after infection, teased apart with forceps, and suspended in RPMI medium containing glutamine (0.29 mg/ml), penicillin-streptomycin (100 U/ml and 100 mg/ml, respectively), and 10% fetal bovine serum (FBS). The organs were homogenized into single-cell suspensions by sequential passage through 16-, 18-, and 20-gauge needles. The mononuclear fraction was isolated by separation on 40 to 70% Percoll gradients (Pharmacia). For surface phenotyping, cells were resuspended in phosphate-buffered saline (PBS; pH 7.3) containing 1% BSA and 0.1% azide (PBS-BSA). For sorting experiments, adherent cells were removed from lung preparations by incubation at 37°C in 7% CO2 for 1 h. Nonadherent cells were removed, washed, and resuspended in PBS-BSA.

Cell surface phenotype. Cells isolated from lungs were pelleted (1 × 105 to 5 × 105) at 350 × g and incubated with a saturating amount of antibody in a 20-µl volume for 15 min at 4°C. The cells were washed twice with PBS-BSA before addition of SAv-FITC (for biotinylated reagents) followed by incubation and washing as before. All samples were resuspended in a 1% paraformaldehyde solution before analysis on a Coulter Epics XL flow cytometer (Coulter Corp., Miami, Fla.). Flow cytometry data, reported as the percentage of positive cells and mean fluorescence intensity (MFI), were determined with Coulter XL-2 analysis software, using a log scale of 0.1 to 1,000 for fluorescence intensity. The absolute number of cells expressing each surface marker was calculated by multiplying the percentage of positive cells of each phenotype by the total number of cells derived from the Percoll gradients. Since cell types other than blood lineage cells were present within the analysis gates, the data were normalized to represent hemopoietic lineage cells within the gate by multiplying by the percentage of CD45+ cells. This antibody (clone 30F11.1) recognizes all blood cells except erythrocytes (25).

Cell sorting. The nonadherent population of cells isolated from the lungs of animals on day 9 or 10 of infection were stained as described above with CD4-FITC, CD8-FITC, or NK1.1-biotin followed by SAv-FITC, and the positive and negative populations were separated on a Coulter EPICS 753 instrument and collected into FBS.

Cytoplasmic expression of cytokines. The detection procedure for intracellular IFN-gamma protein was derived partially from a previous method (3). Purified populations of lung cells at densities of 2.0 × 106 per ml in 24-well tissue culture dishes were suspended in RPMI medium containing penicillin G (100 U/ml), streptomycin sulfate (100 µg/ml), glutamine (0.29 mg/ml), nonessential amino acids, minimal essential medium amino acid solution, sodium pyruvate (0.1 mM), 2-mercaptoethanol (0.5 mM), sodium bicarbonate (0.75%), serine (2 µg/ml), asparagine (16 µg/ml), and 10% FBS and exposed to phorbol myristate acetate (10 ng/ml; Sigma, St. Louis, Mo.), calcium ionomycin (250 ng/ml; Calbiochem, La Jolla, Calif.), and Brefeldin A (200 ng/ml; Calbiochem) for 4 h at 37°C in 7% CO2. This step was necessary for detection of cytoplasmic IFN-gamma . Cells from naive animals incubated with this cocktail never demonstrated intracellular cytokine. Cells were washed in PBS, fixed in 4% paraformaldehyde for 20 min at 22°C, pelleted, and washed in PBS-BSA before being resuspended in fresh PBS-BSA.

For cytoplasmic staining, cells were incubated in PBS-BSA containing 0.5% saponin (Calbiochem) for 30 min at 22°C before being stained with phycoerythrin-conjugated anticytokine antibodies for 30 min. The cells were washed twice with saponin buffer and then once with PBS-BSA. Control samples were either permeabilized and stained with an irrelevant MAb or were not saponin treated and stained with anticytokine MAbs; in either case, they were subsequently washed with PBS-BSA and saponin buffer. Samples were resuspended in PBS-BSA and analyzed as described above.

Statistics. Student's t test or analysis of variance was used to analyze differences between groups. Statistical significance is indicated either in the text or in the figure legends.

    RESULTS
Top
Abstract
Introduction
Materials & Methods
Results
Discussion
References

Total numbers of cells and organ weights during infection. An increase in the total number of mononuclear cells purified by Percoll gradient centrifugation was observed during infection with H. capsulatum (Table 1). On day 5 of infection, a threefold increase in cell numbers was observed over that for control lungs. The peak number of cells isolated from infected lungs on days 7 to 10 was seven- to ninefold larger than control values. Subsequently, the number of cells declined. This pattern of cell influx correlates with the CFU in lungs of mice exposed intranasally to yeasts (9).

                              
View this table:
[in this window]
[in a new window]
 
TABLE 1.   Absolute number of cells infiltrating lung tissue during infection

The mean lung weight of control animals ± standard error was 280 ± 2.3 mg (n = 8). During infection, the mean weights on day 3 (290 ± 2.6 mg [n = 3]) and day 5 (363 ± 4.5 mg [n = 3]) did not differ significantly (P > 0.05) from those of naive animals. In contrast, mean lung weights determined on day 7 (458 ± 2.6 mg [n = 5]), day 10 (486 ± 4.2 mg [n = 5]), day 14 (512 ± 2.7 mg [n = 5]), day 22 (447 ± 2.2 mg [n = 3]), and day 28 (413 ± 2.7 mg [n = 3]) of infection exceeded (P < 0.01) those of controls. Organ weights had declined after day 14 and were similar to control values by day 36 (313 ± 3.8 [n = 3]).

Phenotype of lineage-specific cells from infected lungs. Single-cell suspensions prepared from lungs of infected animals during infection with H. capsulatum were analyzed by flow cytometry for cell surface markers that define specific cell lineages. Myeloid lineage cells express the cell surface molecule recognized by anti-Mac-1 (CR3, CD11b); therefore, this phenotype is shared by the monocyte/Mphi as well as polymorphonuclear neutrophils (PMN) (21). The MAb Gr-1 (RB-6), which is specific for granulocytes located in tissues other than bone marrow (12), was used to distinguish between these two major myeloid populations of the lung. In addition, CD45 (B220 isoform, specific for B cells), Thy-1 (specific for T cells), and the natural killer (NK) cell marker NK1.1 also were used in this analysis. Percentages and absolute numbers of cells within each subpopulation were determined during infection. The relative contribution of each lineage within the lung microenvironment was reflected in percentage values.

Representative profiles for control and infected lungs on days 5, 7, 10, 12, and 14 of infection with H. capsulatum are illustrated in Fig. 1. The percentage of Mac-1+ cells increased threefold over that observed in lungs from naive animals on day 5 of infection, was fivefold greater than the control value on day 7, and then declined. The PMN population increased, as did Mphi , and represented 50 to 80% of the Mac-1+ cells throughout the time period analyzed. The variation in percentages of NK cells was twofold greater than that of control values on days 5 and 7 of infection, and the pattern of fluctuation of the NK cell population correlated with the influx of Mac-1+ cells. T-cell percentages increased from days 5 to 12 of infection, but a decreased percentage was evident on day 14. Percentages for B cells decreased during the course of infection to a level fourfold lower than that for control lungs by day 7 of infection and increased to control levels thereafter.


View larger version (58K):
[in this window]
[in a new window]
 
FIG. 1.   Analysis of lineage-specific cells in lungs of mice during H. capsulatum infection. Single-cell suspensions from lungs of naive and infected animals, obtained on days 5, 7, 10, 12, and 14 of infection, were stained with lineage-specific MAbs. The numbers in the upper right corners of the panels are the percentages of positive cells. The data represent one of three experiments performed per day of analysis. Naive animals (n = 5) were assayed concomitantly with infected animals.

Since percentages do not always reveal the true variation in cell populations during infection, the data were also analyzed as total numbers of lineage-specific cells in control and infected lungs during infection. The analysis revealed an initial increase in the total numbers of cells expressing markers for all lineages by day 5 of infection (Fig. 2). Peak levels of absolute numbers of myeloid lineage and NK cells were observed on day 7 of infection, prior to the T-cell peak on day 10. The timing of observed increases in percentages and absolute numbers of cells correlated in all lineages analyzed except B cells. Although this population declined as a percentage of the total cell population during infection, the actual number of B cells in infected lungs increased.


View larger version (56K):
[in this window]
[in a new window]
 
FIG. 2.   Total number of lung cells expressing lineage-specific markers during infection. Flow cytometry data for the percentages of positive cells were corrected for the percentage of CD45+ cells within the analysis gate. The data are expressed as the means ± standard error of values for five control (C) animals or three infected animals at each time point analyzed. The P value for numbers of B220+ cells on day (D) 5 of infection was <= 0.03. All other data have significance values of <= 0.009.

Two populations of Mac-1+ cells that differed in fluorescence intensity (a low-MFI population [Mac-1lo] and a high-MFI population [Mac-1hi]) were observed in lungs from naive and infected mice (Table 2). Among Mac-1+ cells in uninfected animals, the Mac-1lo population represented approximately 75% of the total cells and had an MFI of 14.5. The Mac-1hi population manifested an MFI of 69.5. By contrast, the Mac-1hi population (MFI = 97.3) had escalated to 51% on day 5 of infection. In addition, on day 7, when the percentage of Mac-1+ cells was the highest (>50% of total cells), it was difficult to distinguish two populations since one broad peak with an MFI value of 43.6 that falls between the control and day 5 values was observed. On days 10 and 14 of infection, the proportions of both populations of Mac-1+ cells were similar to those of uninfected mice, although the Mac-1hi population exhibited a much higher MFI.

                              
View this table:
[in this window]
[in a new window]
 
TABLE 2.   Myeloid lineage cells upregulate surface CR3 early in the course of histoplasmosisa

CD4 and CD8 subset analysis. Because of the established roles of both CD4+ and CD8+ T cells in protective immunity against H. capsulatum (7, 16, 29), we analyzed these subsets in lungs during the course of infection. The absolute numbers of CD4+ and CD8+ cells increased up to day 10 of infection and then declined (Fig. 3). To determine the relative increase of the two populations, the CD4/CD8 cell ratio during infection was calculated. During the first week of infection, the CD4+-to-CD8+ cell ratio observed in infected lungs (1.7) was essentially the same as the ratio observed in lungs from naive animals (1.8). During the second week of infection, the CD4/CD8 ratio increased to approximately three times the control level on day 10 of infection and remained elevated through day 14, reflecting a greater increase in CD4+ T cells at the time when the total T-cell population dramatically increased.


View larger version (26K):
[in this window]
[in a new window]
 
FIG. 3.   Fluctuations in CD4/CD8 cell ratios during infection. The total number of CD4+ and CD8+ cells from murine lungs was analyzed by flow cytometry. The data from five naive animals (C) or three infected animals at each time point analyzed are expressed as means ± standard error of the total number of cells.

Analysis of cytokine-specific mRNA. To determine the kinetics of cytokine induction during pulmonary infection with H. capsulatum, oligo(dT)-primed cDNA prepared from RNA isolated from the lungs of control and infected mice was analyzed by PCR for the presence of cytokine-specific products. IFN-gamma -, IL-2-, IL-4-, and IL-12 p35- and p40-specific PCR products amplified from the lungs of H. capsulatum-infected mice were observed, but IL-10 message was never seen (Fig. 4). IFN-gamma , IL-2, and IL-4 transcripts were not detectable in the lungs of naive animals but were evident as early as day 1 of infection and were observed for up to 5 weeks after infection. PCR products for both chains of IL-12 (p35 and p40) were amplified from lung RNA isolated from both control and infected animals during the time period analyzed.


View larger version (48K):
[in this window]
[in a new window]
 
FIG. 4.   PCR analysis of cytokine-specific cDNA from infected lung tissue. PCR products generated by amplification of 1 µl of cDNA with primers specific for HPRT, IFN-gamma , IL-12 p40, or IL-10 or of 2 µl of cDNA with IL-2-, IL-12 p35-, or IL-4-specific primers were separated by electrophoresis on a 1.5% agarose gel. The positive-control cDNA for IL-12 p35 and p40 (+) was made from RNA isolated from LPS-stimulated peritoneal exudate cells. Control cDNA for HPRT and lymphokines (C) was from concanavalin A-stimulated splenocytes.

Competitive PCR analysis of cytokine mRNA. To quantify the transcripts observed during the course of infection, a competitive PCR analysis was performed, using the previously described pPQRS polycompetitor (23). A typical experiment (Fig. 5), consisting of six PCR analyses, included tubes containing no pPQRS insert and other tubes with twofold dilutions of the competitor DNA. The concentration of competitor DNA was adjusted so that each analysis showed a linear response.


View larger version (44K):
[in this window]
[in a new window]
 
FIG. 5.   Protocol for analysis of competitive PCRs. Shown are representative examples of ethidium bromide-stained gels of competition reactions between the pPQRS competitor DNA and lung tissue cDNA for IFN-gamma on days (D) 5, 7, 10, and 14 of infection. The values below the six lanes in each analysis are the dilutions of competitor added to the reaction tubes. Lanes marked with 0 received no pPQRS.

Competitive PCR analyses were conducted for HPRT, IFN-gamma , IL-2, IL-4, and the p35 and p40 chains of IL-12 (Fig. 6). Specific PCR products for IFN-gamma , IL-2, and IL-4 from lungs of uninfected control animals were either not detected or too low in concentration and therefore could not be quantified. In infected animals, IFN-gamma and IL-2 mRNAs were detectable starting on day 1 of infection; however, only for IFN-gamma , on days 7 and 10, was the level statistically significant (P <=  0.02). IL-4-specific transcripts, although evident on days 1, 3, and 5 of infection, were not at levels significantly different (P > 0.05) from those of the controls. Values for the IL-12 p35 and p40 transcripts were significantly increased compared to those of naive animals after day 5 of infection. The values determined for the p40 chain on days 7, 10, and 14 were significantly different from those of the controls (P <=  0.05). In contrast, only on day 7 was the IL-12 p35 chain data significantly different from that of the controls (P <=  0.001).


View larger version (29K):
[in this window]
[in a new window]
 
FIG. 6.   Competitive PCR analysis for IL-12 p40 and p35, IFN-gamma , IL-2, and IL-4. Densitometry measurements for specific PCR products amplified from lung cDNA and pPQRS DNA were analyzed as described in Materials and Methods for determination of equivalent concentrations for standard (pPQRS) and experimental (lung) DNA. The data are presented as ratios of cytokine values to HPRT values. Each point is the mean ± standard error of data from three to five mice. Asterisks indicate data that are significantly different from the values for naive controls as determined by Student's t test (P <=  0.05).

Cytoplasmic expression of IFN-gamma by lung cells. IFN-gamma is the only murine lymphokine that is known to be involved in the clearance of H. capsulatum in vivo (32). To determine the level of production of the IFN-gamma protein during primary infection, single-cell suspensions prepared from the lungs of naive and infected animals were examined for cytoplasmic expression of IFN-gamma at several time points after infection. Cytoplasmic staining for IFN-gamma was not detected in lung cells from noninfected animals. In infected mice, the percentage of Thy-1+ cells that express IFN-gamma intracellularly was increased over that of naive controls during the time period analyzed (Table 3). The MFI values revealed that a relatively large amount of IFN-gamma was produced by Thy-1+ cells on day 3 (19.6-fold increase). On day 5, the increase was less (8.9-fold); however, the values subsequently increased through day 14 of infection. In some samples analyzed, particularly on day 3, a fraction of IFN-gamma -producing cells that did not bear Thy-1 was evident.

                              
View this table:
[in this window]
[in a new window]
 
TABLE 3.   Cytoplasmic expression of IFN-gamma by lung T cells during histoplasmosisa

Since IFN-gamma can be produced by T cells and NK cells (17, 19), we determined the phenotype of cells producing this cytokine during primary infection. CD4, CD8, and NK cells were isolated on day 9 or 10 of infection by cell sorting to >96% purity before cytoplasmic staining for IFN-gamma . The day 9-10 time point was chosen because this was when peak levels of T cells were observed, NK cells also were numerous, and a high level of cytoplasmic IFN-gamma was detected in the total lung cell population. The results of this analysis (Fig. 7A) demonstrated that all three subsets produced IFN-gamma , but not at the same levels. Analysis of the total numbers of IFN-gamma + cells in each group revealed that CD4+ and CD8+ cell numbers were similar (3.6 × 105 and 3.5 × 105 cells, respectively) whereas 4.9 × 104 NK cells coexpressed IFN-gamma .


View larger version (35K):
[in this window]
[in a new window]
 
FIG. 7.   Phenotype of cells expressing cytoplasmic IFN-gamma . (A) Sorted populations of cells isolated from infected mice on days 9 to 10 of infection were analyzed for cytoplasmic expression of IFN-gamma as described in Materials and Methods. The profiles shown are from one of two similar experiments. (B) The total cell population isolated from the lung was analyzed by two-color immunofluorescence analysis of IFN-gamma versus an irrelevant MAb (control), CD4, or B220. Fluorescence intensity is measured on a log scale of 0.1 to 1,000.

To determine the relative amounts of protein produced, the MFIs of cells expressing this cytokine were compared. The hierarchy of synthesis on days 9 to 10 of infection was CD4+ cells (MFI = 6.75) > CD8+ cells (MFI = 5.14), and the lowest level of protein was produced by the NK cell population (MFI = 4.43). To establish the specificity of expression of IFN-gamma , lung cell suspensions were stained in a two-color analysis with MAbs recognizing B cells or CD4+ T cells and IFN-gamma (Fig. 7B). This analysis demonstrated that the IFN-gamma MAb does not react nonspecifically, since this cytokine was not detectable in B cells that do not produce IFN-gamma but was detectable in CD4+ T cells, which are known IFN-gamma producers.

    DISCUSSION
Top
Abstract
Introduction
Materials & Methods
Results
Discussion
References

Early studies of the primary immune response to H. capsulatum in mice have utilized a model of disseminated disease by infecting animals intravenously and examining fungal burden, cellular infiltration, or cytokines produced in the spleen after infection (2, 29, 32). In the present study, we used the intranasal route of delivering yeast cells to mimic the natural route of infection rather than intravenous inoculation and concentrated on the primary site of infection, the lung. The intent of this study was to identify changes in the inflammatory and cytokine responses induced by H. capsulatum infection in murine lungs over time.

The influx of hemopoietic cells into infected lungs after day 4 of infection correlated with a large increase in the percentage and total numbers of myeloid lineage cells. On day 7 of infection, these phagocytic cells represented the most numerous population in the lung, with >13 million cells. The myeloid population was composed of Mphi and PMN, and the latter represented 50 to 80% of the myeloid cell population on all days analyzed. Both types of phagocytic cells ingest H. capsulatum yeast cells, yet they have disparate functions. Mphi provide an environment for replication of the yeast cells and release monokines that amplify the immune response. Upon activation, Mphi are induced to restrict the growth of H. capsulatum. PMN, in contrast, limit growth in the absence of activation. Subsequently, this pathogen is cleared spontaneously in immunocompetent hosts (22).

Since CR3 is a receptor used for the binding and ingestion of unopsonized H. capsulatum yeast cells by Mphi and PMN (6), and expression of this molecule is upregulated when myeloid cells are stimulated in vitro (21) and at sites of inflammation (1, 18), we measured Mac-1 (CR3) expression by myeloid lineage cells during H. capsulatum infection. On day 5 of infection, approximately 50% of the Mac-1+ cells were Mac-1hi, compared to 25% in naive mice and 15 to 25% on days 10 and 14 of infection. Thus, by day 5 of infection, there was a dramatic upregulation of surface CR3. It is likely that both Mphi and PMN are included in the Mac-1hi population. This elevated expression may serve as a mechanism by which phagocytes augment ingestion of yeast cells and increase egress into sites of inflammation.

We determined the changes in the cellular composition of lungs during the course of the disease. In addition to measuring myeloid lineage cells, T, B, and NK cells were monitored. The data demonstrated an initial increase in the percentage and absolute cell number of myeloid lineage cells early in infection (day 5). Peak levels of Mphi -PMN and NK cells were observed on day 7, before the major increase in T cells on day 10. The delay in T-cell expansion is not surprising since signals from myeloid lineage cells are necessary for T-cell activation (11). The elevation of the T-cell population probably occurs too rapidly to be explained by in situ expansion of antigen-specific T cells, and the increased cell number is more likely a result of influx. The decline in the percentage of B cells during the first 10 days of infection correlated with a modest increase in total cell numbers. This finding indicated that the rate of increase of B cells early during infection is slow compared to those of the other lineages. The total number of B-lineage cells increased as the influx of Mphi -PMN and T cells subsided. Therefore, there was an initial wave of myeloid and NK cells infiltrating infected lungs. As their numbers diminished, the T-cell population and, subsequently, the B-cell population increased. As late as 2 weeks after infection, the cellular composition of lung tissue differed from that observed in lungs from naive animals.

Previous reports have described the cellular composition of either bronchoalveolar lavage (BAL) fluid or lymph nodes during infection. Examination of BAL fluid cells from infected mice demonstrates a large increase in the PMN population over that of naive animals on day 7 followed by a lymphocyte peak on day 10, but no differences in the numbers of Mphi are observed (5). These data from cells isolated by BAL represent only a fraction of lung cells and neither reflect the dramatic change in myeloid cells that we observed early in infection nor distinguish the types of lymphocytes enumerated. Phenotypic analysis of lung-associated lymph nodes revealed that expansion of the B-cell population is dominant in this tissue 7 days after infection whereas T-cell increases are modest and Mphi numbers remain constant (13). In contrast, in the current study, B cells were not the dominant cell type in infected lungs. These differences indicate that the inflammatory response may vary depending on the tissue microenvironment. Since lymph nodes are not the initial site of infection and therefore are not the first line of defense against H. capsulatum, expansion of phagocytic cells there is not necessary. In contrast to the lung, lymph node tissue functions in the expansion of antigen-specific B cells in germinal centers. Therefore, an increase in the B-cell population would be expected after antigens carried by the lymphatic system arrive in the lymph nodes and activate the selection and expansion of antibody-secreting cells.

Since secretion of monokines and cytokines is necessary for resolution of an infection, the patterns of upregulation of cytokine-specific mRNA were determined by competitive PCR analysis to confirm the order of induction and the relative amounts of cytokine transcripts observed during infection. The first transcripts to be detected were specific for IL-12 and IL-4, and they were followed by IL-2 and IFN-gamma . The observation that IL-12-specific transcripts were detected before those of IL-2 and IFN-gamma supports and extends published data indicating that IL-12 is one of the first cytokines induced after infection by intracellular parasites and that secretion of IL-12 is necessary for IFN-gamma production (14, 28). The generation of p35 transcripts was influenced by the infectious process less than that of the p40 chain transcripts, since significance was evident only on day 7 of infection for the p35 chain. The disparity in the levels of the two chains at certain time points supports the contention that synthesis of the p35 chain determines the amount of functional IL-12 that is eventually generated (27).

Quantitatively, the increase in IFN-gamma transcripts during the course of infection was 2 logs higher than those of IL-2 and IL-4. The elevated mRNA levels of IFN-gamma imply that this lymphokine may contribute to host defense against H. capsulatum. Indeed, this postulate is true since IFN-gamma is necessary for the control of infection (31, 32).

On the other hand, the small quantities of IL-2 and IL-4 produced suggest that these cytokines do not play a prominent regulatory role in controlling infection in hosts challenged with a sublethal dose. This argument is supported by the finding that neither treatment with recombinant IL-2 nor administration of anti-IL-4 MAb influences the course of a sublethal infection (9, 10). Conversely, in vivo treatment with anti-IL-4 MAb protects mice upon challenge with a lethal dose of yeast cells (32). Taken together, these findings indicate that there appears to be a correlation in sublethal histoplasmosis between the transcript level and the functional importance of that transcript.

Since the presence of transcript does not guarantee that protein is produced, relative levels of IFN-gamma protein were measured by cytoplasmic staining during the first 2 weeks of infection. The percentage of Thy-1+ cells that produced IFN-gamma and the levels of protein as measured by MFI values were approximately the same at each time point examined except day 5 of infection, when fewer cells were producing a smaller amount of cytokine than on day 3. The relatively large amounts of IFN-gamma produced on day 3 were not expected since the transcript levels for IFN-gamma were only slightly elevated. These data indicate a disparity between quantities of mRNA and protein production. In addition, the pattern of protein expression was not expected since increased levels of NK and T cells, the principal producers of IFN-gamma (17, 19), were observed later, on days 5 and 7, respectively. A possible explanation is that resident lung cells, especially NK cells, that do not require specific antigen recognition produce an initial burst of IFN-gamma after being stimulated by IL-12 or other regulatory molecules, and then a subsequent wave of protein is induced when the T-cell population expands on days 7 to 10. Two-color analyses of lung cells with MAbs to Thy-1 and IFN-gamma demonstrated that in several assays there was a small population of IFN-gamma + cells that were not T cells. Although it may be assumed that these were NK cells, efforts to detect IFN-gamma -producing NK cells were not successful because of the small numbers of cells in total lung suspensions.

Another observation from the cytoplasmic staining data was that although it is possible that most Thy-1+ cells are producing IFN-gamma at levels too low to detect by cytoplasmic staining, a small population of cells at all time points examined produced a relatively large amount of protein. The data did not reveal whether the same subset of cells is responsible for increased IFN-gamma production throughout infection, but the cells producing the most cytokine during the adaptive immune response after day 7 of infection may be responding to an antigen and therefore may display a limited T-cell receptor repertoire. Populations of IFN-gamma -producing cells observed as early as day 3 could be NK cells or T cells bearing low-affinity receptors that nonetheless react to H. capsulatum antigens.

Although CD4+ T cells are necessary for clearance of organisms during H. capsulatum infection (16, 29, 30), CD8+ cells also contribute to host protection (7). Measurement of T-cell numbers in infected lungs revealed that the absolute numbers of CD8+ cells increased as did the CD4+ population, but to a lesser extent. IFN-gamma can be produced by NK cells as well as CD4+ and CD8+ T cells (4, 17, 19, 26), and all three cell types were elevated in number after infection. Since previous studies have not determined the cell lineages responsible for producing IFN-gamma in the lungs of mice infected with H. capsulatum, the phenotype of cells producing this cytokine was determined after isolating each population by cell sorting. This analysis revealed that all three cell populations produced IFN-gamma on days 9 to 10 of infection but at different levels. Approximately the same number of CD4+ and CD8+ cells produce IFN-gamma , yet the MFI values were greater for the CD4 subset, indicating that this is the dominant producer of IFN-gamma . Although the hierarchy of IFN-gamma expression was CD4+ > CD8+ > NK cells, it is interesting that all cell types are involved in cytokine production relatively late in infection, when T cells are dominant.

In this study, we determined the order of influx of hemopoietic lineage cells into the infected lungs of immunocompetent hosts and correlated this inflammatory response with the production of cytokines during the primary immune response to H. capsulatum infection in mice. Knowledge about the sequence of events during the primary immune response of an immunocompetent host infected with H. capsulatum is necessary to understand how and when immunocompromised hosts fail to resolve the infection. The recognition of deficiencies that result in deviations from the normal immune response can direct the development of methods for therapeutic intervention.

    ACKNOWLEDGMENTS

This work was supported by grants AI-34361 and AI-42747 and by a Merit Review Award from the Department of Veterans Affairs.

We thank Reta Gibbons for her excellent technical assistance and Simon L. Newman for his critical review of the manuscript.

    FOOTNOTES

* Corresponding author. Mailing address: Department of Internal Medicine, Division of Infectious Diseases, University of Cincinnati Medical Center, P.O. Box 670560, Cincinnati, OH 45267-0560. Phone: (513) 558-4704. Fax: (513) 558-2089. E-mail: deepegs{at}email.uc.edu.

Editor:  T. R. Kozel

    REFERENCES
Top
Abstract
Introduction
Materials & Methods
Results
Discussion
References

1. Allen, C. A., J. Highton, and D. G. Palmer. 1989. Increased expression of p150,95 and CR3 leukocyte adhesion molecules by mononuclear phagocytes in rheumatoid synovial membranes. Arthritis Rheum. 32:947-954[Medline].
2. Artz, R. P., and W. E. Bullock. 1979. Immunoregulatory responses in experimental disseminated histoplasmosis: lymphoid organ histopathology and serological studies. Infect. Immun. 23:884-892[Abstract/Free Full Text].
3. Assenmacher, M., J. Schmitz, and A. Radbruch. 1994. Flow cytometric determination of cytokines in activated murine T helper lymphocytes: expression of interleukin-10 in interferon-gamma - and in interleukin-4-expressing cells. Eur. J. Immunol. 24:1097-1101[Medline].
4. Bancroft, G. J., R. D. Schreiber, and E. R. Unanue. 1991. Natural immunity: a T-cell-independent pathway of macrophage activation, defined in the scid mouse. Immunol. Rev. 124:5-24[Medline].
5. Baughman, R. P., C. K. Kim, A. Vinegar, D. E. Hendricks, D. J. Schmidt, and W. E. Bullock. 1986. The pathogenesis of experimental pulmonary histoplasmosis. Correlative studies of histopathology, bronchoalveolar lavage, and respiratory function. Am. Rev. Respir. Dis. 134:771-776[Medline].
6. Bullock, W. E., and S. D. Wright. 1987. Role of the adherence-promoting receptors, CR3, LFA-1, and p150,95, in binding of Histoplasma capsulatum by human macrophages. J. Exp. Med. 165:195-210[Abstract/Free Full Text].
7. Deepe, G. S., Jr. 1994. Role of CD8+ T cells in host resistance to systemic infection with Histoplasma capsulatum in mice. J. Immunol. 152:3491-3500[Abstract].
8. Deepe, G. S., Jr. 1994. The immune response to Histoplasma capsulatum: unearthing its secrets. J. Lab. Clin. Med. 123:201-205[Medline].
9. Deepe, G. S., Jr. Unpublished data.
10. Deepe, G. S., Jr., C. L. Taylor, J. E. Harris, and W. E. Bullock. 1986. Modulation of cellular immune responses in mice with disseminated histoplasmosis by recombinant interleukin-2. Infect. Immun. 53:6-12[Abstract/Free Full Text].
11. Doherty, T. M. 1995. T-cell regulation of macrophage function. Curr. Opin. Immunol. 7:400-404[Medline].
12. Fleming, T. J., M. L. Fleming, and T. R. Malek. 1993. Selective expression of Ly-6G on myeloid lineage cells in mouse bone marrow. J. Immunol. 151:2399-2408[Abstract].
13. Fojtasek, M. F., M. R. Sherman, T. Garringer, R. Blair, L. J. Wheat, and C. T. Schnizlein-Bick. 1993. Local immunity in lung-associated lymph nodes in a murine model of pulmonary histoplasmosis. Infect. Immun. 61:4607-4614[Abstract/Free Full Text].
14. Gazzinelli, R. T., S. Hieny, T. A. Wynn, S. Wolf, and A. Sher. 1993. Interleukin 12 is required for the T-lymphocyte-independent induction of interferon gamma  by an intracellular parasite and induces resistance in T-cell-deficient hosts. Proc. Natl. Acad. Sci. USA 90:6115-6119[Abstract/Free Full Text].
15. Goding, J. W. 1976. Conjugation of antibodies with fluorochromes: modification to the standard methods. J. Immunol. Methods 13:215-226[Medline].
16. Gomez, A. M., W. E. Bullock, C. L. Taylor, and G. S. Deepe, Jr. 1988. Role of L3T4+ T cells in host defense against Histoplasma capsulatum. Infect. Immun. 56:1685-1691[Abstract/Free Full Text].
17. Handa, K., R. Suzuki, H. Matsui, Y. Shimizu, and K. Kumagai. 1983. Natural killer (NK) cells as a responder to interleukin 2 (IL 2). II. IL 2-induced interferon gamma  production. J. Immunol. 130:988-992[Abstract].
18. Highton, J., B. Carlisle, and D. G. Palmer. 1995. Changes in the phenotype of monocytes/macrophages and expression of cytokine mRNA in peripheral blood and synovial fluid of patients with rheumatoid arthritis. Clin. Exp. Immunol. 102:541-546[Medline].
19. Kasahara, T., J. J. Hooks, S. F. Dougherty, and J. J. Oppenheim. 1983. Interleukin 2-mediated immune interferon (IFN-gamma) production by human T cells and T cell subsets. J. Immunol. 130:1784-1789[Abstract].
20. Lane, T. E., B. A. Wu-Hsieh, and D. H. Howard. 1993. Gamma interferon cooperates with liposaccharide to activate mouse splenic macrophages to an antihistoplasma state. Infect. Immun. 61:1468-1473[Abstract/Free Full Text].
21. Miller, L. J., D. F. Bainton, N. Borregaard, and T. A. Springer. 1987. Stimulated mobilization of monocyte Mac-1 and p150,95 adhesion proteins from an intracellular vesicular compartment to the cell surface. J. Clin. Invest. 80:535-544.
22. Newman, S. L., and W. E. Bullock. 1993. Interaction of Histoplasma capsulatum yeasts and conidia with human and animal macrophages, p. 517-532. In B. S. Zwilling, and T. K. Eisenstein (ed.), Macrophage-pathogen interactions. Marcel Dekker, Inc., New York, N.Y.
23. Reiner, S. L., S. Zheng, D. B. Corry, and R. M. Locksley. 1993. Constructing polycompetitor cDNAs for quantitative PCR. J. Immunol. Methods 165:37-46[Medline].
24. Romani, L., A. M. Mencacci, L. Tonnetti, R. Spaccapelo, E. Cenci, P. Puccetti, S. F. Wolf, and F. Bistoni. 1994. IL-12 is both required and prognostic in vivo for T helper type 1 differentiation in murine candidiasis. J. Immunol. 152:5167-5175.
25. Scheid, M. P., and D. Triglia. 1979. Further description of the Ly-5 system. Immunogenetics 9:423-433.
26. Seder, R. A., R. Gazzinelli, A. Sher, and W. P. Paul. 1993. Interleukin 12 acts directly on CD4+ T cells to enhance priming for interferon gamma  production and diminishes interleukin 4 inhibition of such priming. Proc. Natl. Acad. Sci. USA 90:10188-10192[Abstract/Free Full Text].
27. Trinchieri, G. 1995. Interleukin-12: a proinflammatory cytokine with immunoregulatory functions that bridge innate resistance and antigen-specific adaptive immunity. Annu. Rev. Immunol. 13:251-276[Medline].
28. Trinchieri, G. 1997. Cytokines acting on or secreted by macrophages during intracellular infection (IL-10, IL-12, IFN-gamma ). Curr. Opin. Immunol. 9:17-23[Medline].
29. Wu-Hsieh, B. 1989. Relative susceptibilities of inbred mouse strains C57BL/6 and A/J to infection with Histoplasma capsulatum. Infect. Immun. 57:3788-3792[Abstract/Free Full Text].
30. Wu-Hsieh, B. A. 1993. Resistance mechanisms in murine experimental histoplasmosis. Arch. Med. Res. 24:233-238[Medline].
31. Wu-Hsieh, B. A., and D. H. Howard. 1987. Inhibition of the intracellular growth of Histoplasma capsulatum by recombinant murine gamma interferon. Infect. Immun. 55:1014-1016[Abstract/Free Full Text].
32. Zhou, P., M. C. Sieve, J. Bennett, K. J. Kwon-Chung, R. P. Tewari, R. T. Gazzinelli, A. Sher, and R. A. Seder. 1995. IL-12 prevents mortality in mice infected with Histoplasma capsulatum through induction of IFN-gamma . J. Immunol. 155:785-795[Abstract].


Infect Immun, April 1998, p. 1473-1481, Vol. 66, No. 4
0019-9567/98/$04.00+0
Copyright © 1998, American Society for Microbiology. All rights reserved.



This article has been cited by other articles:

  • Takamiya, R., Hung, C.-C., Hall, S. R., Fukunaga, K., Nagaishi, T., Maeno, T., Owen, C., Macias, A. A., Fredenburgh, L. E., Ishizaka, A., Blumberg, R. S., Baron, R. M., Perrella, M. A. (2009). High-Mobility Group Box 1 Contributes to Lethality of Endotoxemia in Heme Oxygenase-1-Deficient Mice. Am. J. Respir. Cell Mol. Bio. 41: 129-135 [Abstract] [Full Text]  
  • Szymczak, W. A., Deepe, G. S. Jr (2009). The CCL7-CCL2-CCR2 Axis Regulates IL-4 Production in Lungs and Fungal Immunity. J. Immunol. 183: 1964-1974 [Abstract] [Full Text]  
  • Guimaraes, A. J., Frases, S., Gomez, F. J., Zancope-Oliveira, R. M., Nosanchuk, J. D. (2009). Monoclonal Antibodies to Heat Shock Protein 60 Alter the Pathogenesis of Histoplasma capsulatum. Infect. Immun. 77: 1357-1367 [Abstract] [Full Text]  
  • Deepe, G. S. Jr, Gibbons, R. S., Smulian, A. G. (2008). Histoplasma capsulatum manifests preferential invasion of phagocytic subpopulations in murine lungs. J. Leukoc. Biol. 84: 669-678 [Abstract] [Full Text]  
  • Lazar-Molnar, E., Gacser, A., Freeman, G. J., Almo, S. C., Nathenson, S. G., Nosanchuk, J. D. (2008). The PD-1/PD-L costimulatory pathway critically affects host resistance to the pathogenic fungus Histoplasma capsulatum. Proc. Natl. Acad. Sci. USA 105: 2658-2663 [Abstract] [Full Text]  
  • Deepe, G. S. Jr., Gibbons, R. S. (2008). TNF-{alpha} Antagonism Generates a Population of Antigen-Specific CD4+CD25+ T Cells That Inhibit Protective Immunity in Murine Histoplasmosis. J. Immunol. 180: 1088-1097 [Abstract] [Full Text]  
  • Allen, H. L., Deepe, G. S. Jr. (2006). B Cells and CD4-CD8- T Cells Are Key Regulators of the Severity of Reactivation Histoplasmosis. J. Immunol. 177: 1763-1771 [Abstract] [Full Text]  
  • Lin, J.-S., Wu-Hsieh, B. A. (2004). Functional T cells in primary immune response to histoplasmosis. Int Immunol 16: 1663-1673 [Abstract] [Full Text]  
  • Barton, L. F., Runnels, H. A., Schell, T. D., Cho, Y., Gibbons, R., Tevethia, S. S., Deepe, G. S. Jr., Monaco, J. J. (2004). Immune Defects in 28-kDa Proteasome Activator {gamma}-Deficient Mice. J. Immunol. 172: 3948-3954 [Abstract] [Full Text]  
  • Deepe, G. S. Jr., Gibbons, R. S. (2003). Protective and Memory Immunity to Histoplasma capsulatum in the Absence of IL-10. J. Immunol. 171: 5353-5362 [Abstract] [Full Text]  
  • McCormack, F. X., Gibbons, R., Ward, S. R., Kuzmenko, A., Wu, H., Deepe, G. S. Jr. (2003). Macrophage-independent Fungicidal Action of the Pulmonary Collectins. J. Biol. Chem. 278: 36250-36256 [Abstract] [Full Text]  
  • Barton, L. F., Cruz, M., Rangwala, R., Deepe, G. S. Jr., Monaco, J. J. (2002). Regulation of Immunoproteasome Subunit Expression In Vivo Following Pathogenic Fungal Infection. J. Immunol. 169: 3046-3052 [Abstract] [Full Text]  
  • Deepe, Jr.,, G. S., Gibbons, R. S. (2002). Cellular and Molecular Regulation of Vaccination with Heat Shock Protein 60 from Histoplasma capsulatum. Infect. Immun. 70: 3759-3767 [Abstract] [Full Text]  
  • Wu-Hsieh, B. A., Whitmire, J. K., de Fries, R., Lin, J.-S., Matloubian, M., Ahmed, R. (2001). Distinct CD8 T Cell Functions Mediate Susceptibility to Histoplasmosis During Chronic Viral Infection. J. Immunol. 167: 4566-4573 [Abstract] [Full Text]  
  • Gomez, F. J., Woodward, E. O., Pilcher-Roberts, R., Gibbons, R. S., Deepe, G. S. Jr. (2001). V{{beta}}6+ and V{{beta}}4+ T Cells Exert Cooperative Activity in Clearance of Secondary Infection with Histoplasma capsulatum. J. Immunol. 166: 2855-2862 [Abstract] [Full Text]  
  • Deepe, G. S. Jr., Gibbons, R. (2000). Recombinant Murine Granulocyte-Macrophage Colony-Stimulating Factor Modulates the Course of Pulmonary Histoplasmosis in Immunocompetent and Immunodeficient Mice. Antimicrob. Agents Chemother. 44: 3328-3336 [Abstract] [Full Text]  
  • Allendoerfer, R., Deepe, G. S. Jr. (2000). Regulation of Infection with Histoplasma capsulatum by TNFR1 and -2. J. Immunol. 165: 2657-2664 [Abstract] [Full Text]  
  • Cain, J. A., Deepe, G. S. Jr. (2000). Interleukin-12 Neutralization Alters Lung Inflammation and Leukocyte Expression of CD80, CD86, and Major Histocompatibility Complex Class II in Mice Infected with Histoplasma capsulatum. Infect. Immun. 68: 2069-2076 [Abstract] [Full Text]  
  • Deepe, G. S. Jr., Gibbons, R., Woodward, E. (1999). Neutralization of Endogenous Granulocyte-Macrophage Colony-Stimulating Factor Subverts the Protective Immune Response to Histoplasma capsulatum. J. Immunol. 163: 4985-4993 [Abstract] [Full Text]  

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow E-mail this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in ASM journals
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowReprints and Permissions
Right arrow Copyright Information
Right arrow Books from ASM Press
Right arrow MicrobeWorld
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Cain, J. A.
Right arrow Articles by Deepe, G. S.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Cain, J. A.
Right arrow Articles by Deepe, G. S., Jr.