Previous Article | Next Article 
Infect Immun, April 1998, p. 1513-1520, Vol. 66, No. 4
0019-9567/98/$04.00+0
Copyright © 1998, American Society for Microbiology. All rights reserved.
Enhanced Protective Antibody Responses to PspA after
Intranasal or Subcutaneous Injections of PspA Genetically Fused
to Granulocyte-Macrophage Colony-Stimulating Factor or
Interleukin-2
Charles
Wortham,1
Luba
Grinberg,1
David C.
Kaslow,2
David E.
Briles,3
Larry S.
McDaniel,4
Andrew
Lees,1
Michael
Flora,5
Clifford M.
Snapper,6 and
James J.
Mond1,*
Departments of Medicine1 and
Pathology6 and
Biomedical
Instrumentation Center,5 Uniformed Services
University of the Health Sciences, Bethesda, Maryland 20814-4799;
Laboratory of Parasitic Diseases, National Institute of
Allergy and Infectious Diseases, National Institutes of Health,
Bethesda, Maryland 208922;
Department of Microbiology, University of Alabama at
Birmingham, Birmingham, Alabama 35294-21703;
and
Departments of Surgery and Microbiology, University of
Mississippi Medical Center, Jackson, Mississippi
392164
Received 27 May 1997/Returned for modification 7 July 1997/Accepted 2 December 1997
 |
ABSTRACT |
Antibody to pneumococcal surface protein A (PspA) has been shown to
be protective for Streptococcus pneumoniae infections in mice. In an attempt to define a model for inducing protective antibody to PspA in the absence of adjuvant, we designed two genetic fusions, PspA-interleukin-2 [IL-2]) and
PspA-granulocyte-macrophage colony-stimulating factor (GM-CSF).
These constructs maintained high cytokine function in vitro, as tested
by their activity on IL-2 or GM-CSF-dependent cell lines. While
intranasal immunization with PspA induced no detectable anti-PspA
response, both PspA-IL-2 and PspA-GM-CSF stimulated high
immunoglobulin G1 (IgG1) antibody responses. Interestingly, only the
PspA-IL-2, not the PspA-GM-CSF, construct stimulated IgG2a antibody
responses, suggesting that this construct directed the response along a
TH1-dependent pathway. Comparable enhancement of the
anti-PspA response with similar isotype profiles was observed
after subcutaneous immunization as well. The enhancement observed with
PspA-IL-2 was dependent on IL-2 activity in that it was not seen in
IL-2 receptor knockout mice, while PspA in alum induced high-titer
antibody in these mice. The antibody was tested for its protective
activity in a mouse lethality model using S. pneumoniae WU-R2. Passive transfer of 1:90 dilutions of sera from
mice immunized with PspA-IL-2 and PspA-GM-CSF elicited protection of
CBA/N mice against intravenous challenge with over 170 50% lethal
doses of capsular type 3 strain WU2. Only 0.17 µg or less of IgG
antibody to PspA was able to provide passive protection
against otherwise fatal challenge with S. pneumoniae. The
data demonstrate that designing protein-cytokine fusions may be a
useful approach for mucosal immunization and can induce high-titer
systemic protective antibody responses.
 |
INTRODUCTION |
The use of cytokines as agents to
enhance both humoral and cell-mediated responses has been proven to be
effective in many different experimental systems. Whether these
stimulatory molecules operate specifically at the level of the
antigen-specific T or B cell and/or whether they act in a more
nonspecific way by activating other cell types which may themselves
enhance immune responses is unresolved. A number of investigators have
demonstrated that the injection of cytokines when simply admixed with
antigen results in enhanced immune responses (8, 19, 27,
30). In addition to their role as enhancers of immune responses,
cytokines can also influence the isotype of antibody that is induced by
influencing the balance of TH1- and TH2-mediated help (5,
20). One could thus specifically tailor the profile of the immune
response that is stimulated depending on the cytokine that is used.
More recently, it has been shown that coinjection of a plasmid encoding
granulocyte-macrophage colony-stimulating factor (GM-CSF), interleukin-2 (IL-2), or IL-12 can enhance humoral as well as cell-mediated responses to a simultaneously injected plasmid encoding a
soluble protein (10, 31, 34). Other investigators have shown
that for cytokines to be effective, they must be physically linked to
the antigen. Thus, Tao and Levy (29) and Chen et al. (4) demonstrated that coinjection of IL-2 or GM-CSF with
antigens had little, if any, enhancing effect on the immune response,
and enhancement was observed only after direct linkage of the cytokine to the antigen. Another possible advantage of directly linking cytokine
to protein is that it can extend the half-life of the cytokine in the
circulation and thus prolong its stimulatory effect (11).
We wished to explore a role for protein-cytokine fusion in stimulating
humoral antibody responses when administered mucosally as well as their
role in inducing protective antibody responses for subsequent bacterial
challenge. These two avenues have not yet been examined by others. To
this end, we used pneumococcal surface protein (PspA) as a model
antigen. This protein is a surface-exposed virulence factor of
Streptococcus pneumoniae that can elicit protective antibody
in mice (15, 17). PspA is approximately 590 amino acids in
size (65 kDa). The N-terminal, approximately 290 amino acids are
surface exposed and predict an
-helical coiled structure. The
protection eliciting epitopes of PspA map to this
-helical domain. C
terminal to the
-helical region is a proline-rich region and a
choline-binding domain. The latter is responsible for the binding of
PspA to the pneumococcal surface (16, 28, 31, 33). While
native PspA is highly immunogenic in the absence of adjuvant
(2), it is difficult to prepare in large quantities in
purified form. The 245-amino-acid fragment of PspA induces protection
but only when administered with an adjuvant such as complete Freund
adjuvant or cholera toxin (CT) (33). When mice are immunized
intranasally (i.n.) or orally with moderate doses of native PspA,
little or no anti-PspA antibody response is stimulated unless it is
coadministered with CT, or the B subunit of CT. When given with CT, the
majority of total immunoglobulin (Ig) that is secreted is directed to
the CT rather than to PspA. It would be useful to find ways to enhance
anti-PspA responses without diverting a significant part of the
antibody response to an antigen that is merely a bystander. We have
found that in vitro, both IL-2 and GM-CSF can enhance Ig secretion by
purified B cells over 100-fold (26). We therefore made
constructs of IL-2 and GM-CSF with PspA and studied both the magnitude
and isotype of antibody responses stimulated after i.n. and
subcutaneous (s.c.) injection, as well as their protective efficacy
after challenge with a lethal strain of S. pneumoniae. These
studies indicate that protein-cytokine fusions can rapidly enhance
antiprotein responses after both i.n. and s.c. injections and influence
the isotype of antibody that is made and that this antibody is
extremely protective. This is the first report of cytokine fusions
being administered i.n. and inducing protective antibody responses.
 |
MATERIALS AND METHODS |
Mice.
Six- to eight-week-old DBA/2, C3H/HEJ, and C3H/HEN
mice were housed in the pathogen-free facilities at the Uniformed
Services University of the Health Sciences. CBA/CAHN-XID/J (CBA/N) mice were purchased from Jackson Laboratory, Bar Harbor, Maine.
Cell lines.
The IL-2-dependent CTEV cell line and the
IL-3-dependent line 32DGR2 (Jacalyn H. Pierce, National Institutes of
Health) were used to measure the cytokine activity of the recombinant
proteins. 32DGR2 cells were converted to GM-CSF dependence by the
gradual reduction of IL-3 in the media and the addition of GM-CSF (data not shown). Cells were cultured in RPMI 1640 medium (RPMI 1640, L-glutamine, 10% fetal calf serum, penicillin-streptomycin
[100 U/ml], sodium pyruvate [1 mM], and 2-mercaptoethanol (50 µM]) with the addition of 20 U of recombinant human IL-2 or
recombinant murine GM-CSF per ml to the respective cell lines. Cells
were cultured at 37°C and 5% CO2.
Bacteria.
Escherichia coli DH10B (Gibco/BRL,
Gaithersburg, Md.) was used for plasmid construction. Cells were
cultured in Terrific Broth (12 g of Bacto Tryptone, 24 g of Bacto
Yeast Extract, 4 ml of glycerol, and 100 ml of 0.17 M
KH2PO4-0.7 M K2HPO4
per liter). S. pneumoniae virulent capsular type 3 strain
WU2 was grown in Todd-Hewitt broth containing 5% yeast extract (Difco,
Detroit, Mich.).
Yeast.
Saccharomyces cerevisiae BJ3505 provided with
the Kodak YEpFLAG1 expression kit was used for the expression of
recombinant proteins. Frozen stocks of transformed clones were prepared
by growing the yeast in selective expansion medium (SEM; 8% dextrose, 0.67% yeast nitrogen base without amino acids, and 0.075%
CSM-tryptophan, plus 1.5% agar for SEM plates) to stationary phase in
an incubator shaker at 32°C and 175 rpm. The yeast was centrifuged at
5,000 × g, resuspended in 80% SEM plus 20% glycerol,
aliquoted into 1-ml tubes, and frozen at
70°C.
Plasmid construction.
The YEpFLAG-1 expression vector
(Kodak Scientific Imaging Systems, New Haven, Conn.), used for cloning
and expression of the proteins, contains origin of replication in
E. coli, gene for ampicillin resistance in E. coli, 2µm DNA for replication in S. cerevisiae,
tryptophan marker for selection in yeast, regulated promoter, and
-factor sequence for leader peptide, providing secretion from yeast
cells.
To construct the IL-2- and GM-CSF-containing plasmids, the following
primer pairs with KpnI and SmaI restriction sites
and specific for IL-2 and GM-CSF genes were used in the PCR:
5'ggggtacctttggataaaagagcacctacttcaagttct3'-5'gaccccgggaccaccaccagttagtgttgagatgat3' and
5'ggggtacctttggataaaagagctccgacgcgtagcccg3'-5'gaccccgggaccaccacctttttggactggttttttgc3', respectively. Plasmids carrying cDNA for human IL-2 (provided by
Howard A. Young, Laboratory of Experimental Immunology,
NCI-FCRDC) and murine GM-CSF (R&D Systems Europe Ltd.) were used as
templates. PCR products were digested with restriction
endonucleases KpnI and SmaI and ligated to the
appropriate sites in YEpFLAG1. A few codons of the
-factor sequence (downstream of the KpnI site in YEpFLAG1) were eliminated by KpnI/SmaI
cleavage of YEpFLAG1. They were restored by inclusion into 5'
primers. 3' Primers contained three glycine codons for
generation of a polyglycine linker between fused proteins. The
resulting plasmids were named pYIL2 and pYGM, respectively.
Genomic DNA from S. pneumoniae Rx1 was used as template in
PCR with a primer pair containing SmaI and BamHI
sites and specific to pspA gene. The 5'-primer contains
three glycine codons, as part of the linker between fusion protein
subunits (5'gtccccgggggtggtcccgtagccagtcagtctaaa3'). The 3'
primer contains translation stop codon downstream of six histidine
codons (5'gacggatccttagtggtggtggtggtggtgtggagtttctggagctggagc3'). The six histidine codons generate a His tail at the C terminus of
the protein molecule for purification purposes. The PCR product was
digested with restriction endonucleases SmaI and
BamHI and cloned between the appropriate sites of pYIL2 and
pYGM. The new plasmids, called pIL2PA and pGMPA, contain an
-factor
sequence followed by full coding regions for IL-2 and GM-CSF,
respectively, glycine linker codons, truncated gene for PspA (coding
for amino acid residues 4 through 299 of mature PspA), and six
histidine codons at the end upstream of the translation stop codon
(Fig. 1).
To construct a plasmid expressing only truncated PspA, the
KpnI-SmaI fragment of pIL2PA was replaced by a
synthetic linker with a KpnI cohesive end on the 5' termini,
a blunt SmaI end on the 3' termini, and the codons for
-factor, removed by KpnI-SmaI cleavage of
pIL2PA in between. This plasmid was named pPAF1.
Yeast electroporation.
A 100-ml culture of S. cerevisiae BJ3505 was grown in YPD medium (1% yeast extract, 2%
peptone, 2% dextrose) until the optical density at 600 nm
(OD600) was 1.3 to 1.5. The yeast was centrifuged at 2,000 rpm, the supernatant was removed, and the yeast was resuspended in 25 ml of sterile ice-cold 1 M sorbitol. After this wash step was performed
three additional times, the yeast was centrifuged and as much sorbitol
as possible was removed from the pellet. The yeast was vortexed, and 40 µl of the cells was transferred to an ice-cooled 0.2-cm
electroporation cuvette. Then 2.5 µl of sheared salmon sperm DNA and
100 ng of plasmid DNA in a volume of 2.5 µl were mixed with the
yeast, and the mixture was kept on ice for 30 min before
electroporation. Cells were electroporated in a gene pulser (Bio-Rad)
set at 1.5 kV, 200
, and 25 µF. Immediately after electroporation,
0.4 ml of cold 1 M sorbitol was added to the cuvette. Transformed
clones were selected by plating the cells onto SEM plates.
Protein production and purification.
Starter cultures of
transformed yeast were prepared from frozen aliquots that were thawed
and grown to saturation in SEM in an incubator shaker at 30°C and 175 rpm. Fifty milliliters of starter culture was added to 1 liter of YPHSF
expression medium (1% dextrose, 3% glycerol, 1% yeast extract, 8%
peptone, 20 mM CaCl2) and incubated for 72 h. The
yeast was removed from the fusion protein containing medium by
centrifugation at 6,000 rpm in an ultracentrifuge and filtration of the
supernatant through a 0.45-µm-pore-size filter. The fusion protein
supernatant was concentrated and dialyzed against 1×
phosphate-buffered saline (PBS; pH 7.4) using a spiral membrane
ultrafiltration cartridge (Amicon, Beverly, Mass.) with a molecular
size cutoff of 30 kDa.
Recombinant proteins were purified with the QIAexpressionist system
(Qiagen, Chatsworth, Calif.). This system uses Ni-nitrilotriacetic acid
(NTA) agarose, which has a strong affinity for the six-His tail
incorporated into the C-termini of the fusion proteins. Ni-agarose is
added to the concentrated, dialyzed supernatant and mixed overnight at
4°C. The Ni-agarose is applied to a column and washed with 0.2 M
sodium acetate (pH 6.5) until the OD280 is less than 0.01. Proteins were eluted with 0.2 M sodium acetate (pH 4.5) and collected as fractions. The OD280 of the fractions was measured, and
samples with an OD280 of >0.05 were pooled and dialyzed
against 1× PBS (pH 7.4). The purified proteins were then tested for
cytokine activity and antibody reactivity.
SDS-PAGE and immunoblot analyses.
Proteins were subjected to
sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE)
and stained with Coomassie blue or transferred to nitrocellulose for
immunoblotting. Proteins were transferred to nitrocellulose by using a
semidry transfer apparatus (Pharmacia). Membranes were probed with
either mouse anti-PspA IgG1 monoclonal antibody (MAb) XIR278, anti-IL-2
IgG1 mouse MAb 5B1, or rat anti-GM-CSF MAb. Membranes were probed with rabbit anti-mouse IgG or rabbit anti-rat IgG followed by goat anti-rabbit alkaline phosphatase-labeled antibody. The immunoblots were
developed with 5-bromo-4-chloro-3-indolylphosphate-nitroblue tetrazolium phosphatase substrate system (Kirkegaard & Perry, Gaithersburg, Md.).
Cytokine proliferation assays.
The biological activity of
the fusion proteins was assayed by their ability to support the
proliferation of the IL-2- and GM-CSF-dependent cell lines. In 96-well
plates, 100 µl of cells at 5 × 104 cells/ml were
added to 100 µl of protein-cytokine samples that were titered in
10-fold dilutions beginning at a dilution of 1:10. Cells were pulsed on
day 2 with 1 µCi of [3H]thymidine in a volume of 10 µl of Hanks balanced saline solution plus HEPES and incubated for
6 h at 37°C. Cells were harvested with a cell harvester (LKB
Wallac, Turku, Finland) onto glass fiber filters (LKB Wallac).
Thymidine incorporation was measured with a liquid scintillation
counter (1205 Betaplate; LKB Wallac). All samples were run in
duplicate, and recombinant IL-2 (rIL-2) and rGM-CSF were used as
controls.
Immunization.
Mice were immunized s.c. with various doses of
protein-cytokine fusion prepared in PBS in a final volume of 0.2 ml/mouse or antigen in alhydrogel (Superfos Biosector, Vedbaek,
Denmark). Mice were boosted 14 days after the first injection, and
blood was collected from the tail vein on days 14 and 28 after
boosting. Other groups of mice were immunized i.n. with various amounts of fusion protein in a total volume of 20 µl in PBS. Mice were anesthetized with dry ice, and DNA gel loading tips were used to apply
antigen to each of the nares. Mice were boosted on days 7 and 14 after
the initial immunization. Serum was collected from the mice 14, 21, and
28 days after the primary immunization.
ELISA.
Titers in mouse sera were determined for IgG1, IgG2a,
and IgG3 anti-PspA and anti-IL-2 antibody by enzyme-linked
immunosorbent assay (ELISA). Wells were coated with 10 µg of
recombinant PspA per ml or with 1 µg of rIL-2 (National Cancer
Institute) per ml. IgG1 mouse anti-human IL-2 MAb 5BI was used as the
positive control for IL-2-coated plates. Rabbit anti-mouse IgG1
(Advanced ChemTech, Louisville, Ky.) or IgG2a or IgG3 (Serotec Ltd.,
Oxford, England) was used as the primary antibody, and alkaline
phosphatase-conjugated goat anti-rabbit IgG (Calbiochem, La Jolla,
Calif.) was used as the secondary antibody. The plates were developed
with alkaline phosphatase substrate (p-nitrophenyl
phosphate, disodium; Sigma) read at A405 with a
Titertek Multiskan ELISA reader. Assays for IgG, IgA, and IgM antibody
to PspA were done as described previously (25).
Mouse protection assay.
CBA/N mice were injected
intraperitoneally with a 1:5, 1:10, 1:30, or 1:90 dilution of pooled
immune serum in Ringer's solution. Other mice received Ringer's
solution in place of diluted mouse serum. Pooled immune serum was
obtained from mice immunized with the recombinant 245-amino-acid
N-terminal fragment of PspA, PspA-IL-2, or PspA-GM-CSF. One hour
after receiving serum from immunized mice, all mice were challenged
intravenously with 1,700 CFU of strain WU2 in 0.2 ml. The lethal
intravenous dose of WU2 in CBA/N mice is between 10 and 100 CFU. Deaths
were monitored for a period of 21 days postchallenge. Strain WU2 was
grown in 100 ml of THY medium until late log phase, adjusted to 3%
glycerol, and frozen in 1-ml aliquots containing about 107
CFU/ml. CFU were predetermined by plating pneumococci from one of the
thawed aliquots. For inoculation, a fresh aliquot was thawed and
appropriately diluted (about 1,000-fold) for injection. The actual
number of CFU injected was confirmed by plating.
 |
RESULTS |
Characterization of protein-cytokine fusions.
To test that the
stability of PspA and that its antigenic integrity was not altered
after fusion with cytokine, we analyzed the purified protein-cytokine
by SDS-PAGE and Western blotting (immunoblotting) with anti-PspA and
anti-IL-2 antibodies (Fig. 2). The
protein-cytokine product showed a single major band at 47 kDa, and this
pattern was not altered in a sample that had been stored for 4 months.
On Western immunoblotting with anti-PspA, anti-IL-2 or anti-GM-CSF
showed a major band at the predicted molecular weight region of the
gel. This result demonstrates that the protein-cytokine was purified to
relative homogeneity, was relatively stable, and interacted with
anti-PspA to a degree comparable to the reactivity of unconjugated
PspA.

View larger version (64K):
[in this window]
[in a new window]
|
FIG. 2.
Coomassie blue-stained SDS-4 to 20% polyacrylamide gel
(A) and Western blot (B) of Ni-NTA-purified proteins. Filtered yeast
supernatants containing His-tailed fusion proteins were concentrated,
dialyzed, and purified by Ni-NTA affinity chromatography; 5-µl
samples of purified proteins and a molecular mass marker (MWM) standard
were size fractionated on an SDS-4 to 20% denaturing polyacrylamide
gel. Membranes were probed with an MAb against either IL-2 or GM-CSF.
|
|
To test that the cytokine activity was intact, we cultured the
IL-2-dependent cytotoxic T-lymphocyte cell line CTEV with the PspA-IL-2 and the GM-CSF-dependent cell line 32DGR2 with PspA-GM-CSF. The activity of the IL-2 and GM-CSF fusions was comparable to that of
the unconjugated cytokine (Fig. 3). There
was minimal variation in cytokine activity between the different
batches of PspA-cytokine that were prepared. In general, 1 µg of
protein was associated with 2,200 U of IL-2 activity or 1,300 U of
GM-CSF activity.

View larger version (21K):
[in this window]
[in a new window]
|
FIG. 3.
Proliferation assay to measure cytokine activity of
recombinant proteins. (A) 1:10 serial dilutions of Ni-NTA-purified
proteins were added to CTEV IL-2-dependent cells at 5 × 104 cells/well with an rIL2 control at a starting
concentration of 1,000 U/ml. (B) 32D6RZ GM-CSF-dependent cells at
5 × 104 cells/well were incubated for 48 h, then
pulsed with 1 µCi of [3H]thymidine for 6 h, and
harvested.
|
|
Immunogenicity of PspA cytokines after i.n. immunization.
Mice
were immunized i.n. with 10 µg of PspA, PspA-IL-2, or PspA-GM-CSF,
boosted on days 7 and 14, and bled 7 and 14 days after the last boost
(Table 1). In five of five experiments,
PspA failed to stimulate a detectable antibody response, while the
protein-cytokine fusions always stimulated significant antibody titers.
This response was dependent on IL-2 binding activity in that
immunization of IL-2 receptor knockout mice did not stimulate
significant antibody responses with PspA-IL-2 but did with PspA given
in adjuvants (data not shown). This response was dose dependent, and
i.n. administration of less than 10 µg did not stimulate a detectable
response (Table 2). To demonstrate that
this enhanced response did not reflect the activity of small amounts of
immunoadjuvanting endotoxin that could potentially be present in our
preparations, we examined the activity of PspA-IL-2 in
lipopolysaccharide nonresponder C3H/HeJ mice (Table
3). Equivalent anti-PspA responses were
observed in C3H/HeJ and control C3H/HeN mice, demonstrating that
enhanced responses did not reflect lipopolysaccharide activity.
Pathologic examination of the lungs 2 weeks after three i.n.
inoculations showed no abnormal pathology (not shown). These results
demonstrate that protein-cytokine fusions may provide a practical
approach to inducing immunity via the i.n. route.
Isotype profile of antibody stimulated after i.n.
immunization.
IL-2 has been shown to be instrumental in
stimulating TH1 cells and consequently a gamma interferon-dominated
response (5, 20). Gamma interferon is the critical cytokine
in influencing the pattern from one that is predominantly IgG1 to one
that is predominantly IgG2a (25). To test whether this
predicted pattern is observed after injection of PspA-IL-2, we tested
the isotype profile of anti-PspA after i.n. injection with the
PspA-cytokine fusions. We compared these responses to that which is
seen after PspA is given s.c. in alhydrogel (Table
4). Both GM-CSF and IL-2 constructs
stimulated high levels of IgG1 anti-PspA antibody, but only the
IL-2-containing construct stimulated IgG2a antibody. Both constructs
stimulated lower but significant levels of IgG3 and nondetectable
levels of IgA. To determine whether the isotype profile or
magnitude of the response may have been influenced by the fraction of
antigen that was introduced by aspiration into the pulmonary tree
compared to that which remained in the local nasal lymphoid tissue
after placement in the nares, we compared the responses of anesthetized
and nonanesthetized mice. The expectation was that with
anesthetization, a greater fraction of the antigen would reach the
pulmonary tissues after deeper inspiration and less would be eliminated
by swallowing. The responses of the two groups of mice were
quantitatively and qualitatively comparable (Table
5).
Enhanced antibody responses after s.c. administration of
protein-cytokine fusions.
We wished to test whether comparable
enhancement and similar isotype profiles would be stimulated after s.c.
injection. Mice were injected on days 0 and 14 and bled 14 days later.
In contrast to i.n. immunizations, which failed to stimulate anti-PspA
responses, s.c. immunization with PspA often stimulated antibody
responses even in the absence of adjuvants or cytokines. This response
was dramatically enhanced when IL-2 or GM-CSF was fused to the protein (Table 6). Enhanced antibody responses to
s.c.-injected antigen were seen after two injections, while optimal
responses induced by intranasal administration required three
injections (data not shown). The profile of IgG isotypes was similar to
that seen with the i.n. immunization. There was a predominance of IgG1,
with the appearance of IgG2a after injection of PspA-IL-2 but not
PspA-GM-CSF (Table 7).
View this table:
[in this window]
[in a new window]
|
TABLE 6.
Anti-PspA responses in mice stimulated by s.c. injection
of different doses of PspA-IL-2 or PspA-GM-CSFa
|
|
Enhanced antipolysaccharide responses with
PspA-IL-2-polysaccharide conjugates.
To test whether cytokine
could also enhance antipolysaccharide responses, we conjugated
PspA-IL-2 or PspA only to pneumococcal polysaccharide type 14 (Pn14).
Mice were immunized with either PspA-Pn14 or PspA-IL-2-Pn14,
boosted on day 14, and bled 14 days later (Fig.
4). As was observed in previous
experiments, anti-PspA responses were enhanced in mice immunized with
the protein-cytokine fusion. Likewise, anti-Pn14 antibody responses
were higher in mice given PspA-IL-2-Pn14 than in those given
PspA-Pn14 only (Fig. 4).

View larger version (10K):
[in this window]
[in a new window]
|
FIG. 4.
Effect of IL-2 on anti-Pn14 responses to PspA-Pn14.
Groups of five DBA/2 mice were immunized s.c. with either PspA-Pn14 (5 µg) or PspA-IL-2-Pn14 (5 µg), boosted on day 14, and bled 14 days
later.
|
|
Protective efficacy of antibody elicited by PspA-IL-2 and
PspA-GM-CSF.
To evaluate the ability of antibody elicited by
PspA-IL-2 and PspA-GM-CSF against pneumococcal infection, pooled sera
from immunized DBA/2 mice were used to passively protect CBA/N mice from infection with encapsulated type 3 strain WU2. As in past studies,
the recombinant
-helical fragment of PspA was not able to elicit
protection when injected without adjuvant (reference 2 and Table 8). Sera
from mice immunized with PspA-IL-2 or PspA-GM-CSF, however, were able
to protect mice from fatal infection even when diluted 1:90 (Table 8).
In the case of antibody elicited by PspA-GM-CSF, no more than 0.17 µg of antibody per mouse was required for protection. This was about
roughly 1/1,800 of the amount of antibody in the blood volume of each
mouse contributing to the serum pool.
View this table:
[in this window]
[in a new window]
|
TABLE 8.
Protective efficacy of sera from mice immunized with
PspA-cytokine fusions after challenge with capsular type 3 strain WU2a
|
|
 |
DISCUSSION |
Cytokines have been shown to be important regulators of antibody
responses to both T-cell-dependent (TD) (19, 30) and T-cell-independent (TI) antigens (18). In the recent past,
many groups have exploited this property and demonstrated that the humoral and cell-mediated responses of mice to both TD and TI antigens
can be enhanced by the coadministration of cytokines. An early
demonstration of this phenomenon was reported by Reed et al.
(23), who showed that IL-1 enhanced the antibody response to
coadministered bovine serum albumin. The adjuvanticity of IL-1 was not
dependent on the presence of T cells and could also enhance responses
to the TI antigen pneumococcal polysaccharide (1, 21).
GM-CSF has also been shown to enhance humoral antibody responses to
soluble and particulate antigens as well as to peptide antigens
(9, 32).
More recently, a number of investigators have improved this system by
directly linking the cytokine to the experimental antigen via genetic
engineering (4, 12, 22, 29). This offers the advantage of
specifically targeting the cytokine to the antigen-specific B cell as
well as prolonging the in vivo half-life of the cytokine (11). Using this approach of fusing cytokine to protein,
Chen et al. demonstrated that an antibody response to an Ig idiotype could be enhanced when GM-CSF or IL-2 was fused to the idiotype, and
this provided a model vaccine system for B-cell lymphoma
(4). Hinuma et al. created a genetic fusion of the herpes
simplex virus glycoprotein D with IL-2 and found that it stimulated
high humoral and cell-mediated responses (13). Furthermore,
mice immunized with these constructs were protected against herpes
simplex virus type 1 infection. Cytokine fusions can also be
constructed by using only the biological active relevant portion of the
cytokine molecule. Thus, Rao and Nayak chemically coupled the
immunostimulatory nonapeptide sequence of IL-1
to amino acids 12 to
32 of hepatitis B surface antigen. This construct also stimulated
enhanced antibody responses to the experimental antigen
(22).
We have extended these studies in a number of ways to show that an
E. coli-expressed protein, PspA (15), when
genetically fused with GM-CSF or IL-2, can induce enhanced anti-PspA
responses. This protein has been shown by McDaniel et al. to elicit
protection, in a mouse model, to lethal challenge with various
serotypes of S. pneumoniae (17). In these
studies, protection against the truncated PspA could be elicited by
immunization of mice with PspA in adjuvant but not in the absence of
adjuvant (2, 3). In this study, we show that serum from
PspA-cytokine-immunized mice, when passively transferred to recipient
mice, was protective even at serum dilutions of 1:90, a serum dilution
larger than has been used successfully with other PspA immunization
procedures. This is the first demonstration that protective
antibacterial antibody responses can be induced by this approach.
We show that when this protein-cytokine conjugate is covalently linked
to pneumococcal polysaccharide, one can induce high-titer antibodies to
both the protein and polysaccharide components. This result suggests
that IL-2 can be targeted to the polysaccharide-specific B cell by
using this approach and that this results in enhanced antibody
responses as well. While the mechanism of action of the GM-CSF and IL-2
fusions is unresolved, the data suggest that they stimulate B cells via
different pathways. Thus, the IL-2 fusion stimulated high IgG1 and
IgG2a antibody titers, while the GM-CSF fusion stimulated predominantly
IgG1 antibody, with extremely low levels of IgG2a. This result suggests
that the GM-CSF fusion stimulated a predominant TH2-dominated response
and the IL-2 fusion stimulated a response reflecting a TH1
component as well. This observation supports the idea that the
cytokines were not merely functioning as carrier molecules for PspA
independent of their cytokine activity. In other studies, we injected
PspA into IL-2 receptor knockout mice and found that PspA in
alhydrogel stimulated a significant anti-PspA response; PspA-IL2
stimulated no detectable response (not shown).
The data presented here are also the first to demonstrate that
protein-cytokine fusions can stimulate enhanced systemic responses even
when administered i.n. Under these conditions, the TH1-versus-TH2 profile of the response followed the same pattern as when the antigens
were given s.c. While for i.n. immunizations 10 µg of antigen was
placed on the nares, the fraction that was actually delivered to an
immune response-relevant site is unknown. In an attempt to enhance
intrapulmonary localization, we anesthetized mice, and we found no
obvious difference in the antibody titers stimulated in anesthetized
versus nonanesthetized mice. We were able to detect only extremely low
levels of serum, or salivary IgA (not shown), suggesting either that
this specific protein may be unable to stimulate IgA+
antigen-specific B cells or that the attached cytokines may not be the
appropriate ones for stimulating a mucosal IgA response. We are
attempting to determine whether the described IgA switch factor with
transforming growth factor
might be a better fusion partner to
induce this isotype.
Immunizations by the i.n. route have been demonstrated by many groups
to provide an effective mode of antigen delivery. In all of the
published reports, however, antigens had to be administered either daily or in an adjuvanted form to be effective (6, 7, 8,
14, 24). Liposomes, proteasomes, CT, and E. coli labile toxin have all been used to enhance the magnitude of
the antibody responses when antigens are given i.n. The use of
adjuvants has the disadvantage that after they induce unwanted
polyclonal Ig secretion, undesired inflammatory responses are unstable.
The use of cytokines as the mucosal adjuvant provides the benefit that
it is a physiologic immune modulator that is being targeted to an
antigen-specific cell. The use of protein-cytokine fusions provides a
way of inducing rapid immunity while being able to modulate the isotype
being produced without diverting the immune response to producing
antibody to the administered adjuvant. Thus, for example, when CT is
used as the adjuvant for i.n. immunization, more than 50% of the
antibody that is made has specificity for CT. Exactly how this may
affect subsequent immunizations with CT is not yet known.
Since cytokines are both immune system stimulatory and proinflammatory,
we examined pathological specimens of pulmonary tissue from mice given
three to four i.n. immunizations with protein-cytokine. No difference
from control lung specimens was noted (not shown). Furthermore,
since we were injecting the cytokines in an altered, potentially
immunogenic presentation, we tested for the presence of anticytokine
antibody. In an assay so sensitive that we could detect as little as
0.1 ng of anti-IL-2 antibody per ml, we detected no anti-IL-2 in mice
given three to four injections of PspA-IL-2 even when administered in
complete Freund adjuvant (not shown).
Taken together, these data suggest that protective immunity can be
induced to bacterial challenge by proteins fused to GM-CSF as well as
IL-2 and that protection can be achieved even after i.n. immunizations.
 |
ACKNOWLEDGMENTS |
The first two authors contributed equally to this work.
This work was supported by NIH grant 1RO1-A136588. We gratefully
acknowledge the financial and scientific support of SmithKline Beecham,
Rixensart, Belgium.
We are particularly grateful to Jean Paul Prieels, SmithKline Beecham,
for continuing support and sage advice.
 |
FOOTNOTES |
*
Corresponding author. Mailing address: Department of
Medicine, Uniformed Services University of the Health Sciences, 4301 Jones Bridge Rd., Bethesda, MD 20814-4799. Phone: (301) 295-3620. Fax:
(301) 295-3557. E-mail: usuhs{at}netvision.net.il.
Editor: V. A. Fischetti
 |
REFERENCES |
| 1.
|
Boraschi, D.,
L. Nencioni,
L. Villa,
S. Censini,
P. Bossù,
P. Ghiara,
R. Presentini,
F. Perin,
D. Frasca,
G. Doria,
G. Forni,
T. Musso,
M. Giovarelli,
P. Ghezzi,
R. Bertini,
H. O. Besedovsky,
A. Del Ray,
J. D. Sipe,
G. Antoni,
S. Silvestri, and A. Tagliabue.
1988.
In vivo stimulation and restoration of the immune response by the noninflammatory fragment 163-171 of human interleukin 1 .
J. Exp. Med.
168:675-686[Abstract/Free Full Text].
|
| 2.
|
Briles, D. E.,
J. D. King,
M. A. Gray,
L. S. McDaniel,
E. Swiatlo, and K. A. Benton.
1996.
PspA, a protection-eliciting pneumococcal protein: immunogenicity of isolated native PspA in mice.
Vaccine
14:858-867[Medline].
|
| 3.
|
Briles, D. E.,
R. C. Tart,
H.-Y. Wu,
B. A. Ralph,
M. W. Russell, and L. S. McDaniel.
1996.
Systemic and mucosal protective immunity to pneumococcal surface protein A.
N. Y. Acad. Sci.
797:118-126.
[Abstract] |
| 4.
|
Chen, T. T.,
M.-H. Tao, and R. Levy.
1994.
Idiotype-cytokine fusion proteins as cancer vaccines. Relative efficacy of IL-2, IL-4, and granulocyte-macrophage colony-stimulating factor.
J. Immunol.
153:4775-4787[Abstract].
|
| 5.
|
Constant, S. L., and K. Bottomly.
1997.
Induction of Th1 and Th2 CD4+ T cell responses: the alternative approaches.
Annu. Rev. Immunol.
15:297-322[Medline].
|
| 6.
|
Dale, J. B., and E. C. Chiang.
1995.
Intranasal immunization with recombinant group A streptococcal M protein fragment fused to the B subunit of Escherichia coli labile toxin protects mice against systemic challenge infections.
J. Infect. Dis.
171:1038-1041[Medline].
|
| 7.
|
Debard, N.,
D. Buzoni-Gatel, and D. Bout.
1996.
Intranasal immunization with SAG1 protein of Toxoplasma gondii in association with cholera toxin dramatically reduces development of cerebral cysts after oral infection.
Infect. Immun.
64:2158-2166[Abstract].
|
| 8.
|
de Haan, A.,
J. F. Tomee,
J. P. Huchshorn, and J. Wilschut.
1995.
Liposomes as an immunoadjuvant system for stimulation of mucosal and systemic antibody responses against inactivated measles virus administered intranasally to mice.
Vaccine
13:1320-1324[Medline].
|
| 9.
|
Disis, M. L.,
H. Bernhard,
F. M. Shiota,
S. L. Hand,
J. R. Grolow,
E. S. Huseby,
S. Gillis, and M. A. Cheever.
1996.
Granulocyte-macrophage colony-stimulating factor: an effective adjuvant for protein and peptide-based vaccines.
Blood
88:202-210[Abstract/Free Full Text].
|
| 10.
|
Geissler, M.,
A. Gesien,
K. Tokushige, and J. R. Wands.
1997.
Enhancement of cellular and humoral immune responses to hepatitis C virus core protein using DNA-based vaccines augmented with cytokine-expressing plasmids.
J. Immunol.
158:1231-1237[Abstract].
|
| 11.
|
Harvill, E. T.,
J. M. Fleming, and S. L. Morrison.
1996.
In vivo properties of an IgG3-IL-2 fusion protein. A general strategy for immune potentiation.
J. Immunol.
157:3165-3170[Abstract].
|
| 12.
|
Hazama, M.,
A. Mayumi-Aono,
N. Asakawa,
S. Kuroda,
S. Hinuma, and Y. Fujisawa.
1993.
Adjuvant-independent enhanced immune responses to recombinant herpes simplex virus type 1 glycoprotein D by fusion with biologically active interleukin-2.
Vaccine
11:629-637[Medline].
|
| 13.
|
Hinuma, S.,
M. Hazama,
A. Mayumi, and Y. Fujisawa.
1991.
A novel strategy for converting recombinant viral protein into high immunogenic antigen.
FEBS Lett.
288:138-142[Medline].
|
| 14.
|
Lowell, G. H.,
R. W. Kaminski,
S. Grate,
R. E. Hunt,
C. Charney,
S. Zimmer, and C. Colleton.
1996.
Intranasal and intramuscular proteosome-staphylococcal enterotoxin B (SEB) toxoid vaccines: immunogenicity and efficacy against lethal SEB intoxication in mice.
Infect. Immun.
64:1706-1713[Abstract].
|
| 15.
|
McDaniel, L. S.,
G. Scott,
K. Widenhofer,
J. M. Carroll, and D. E. Briles.
1986.
Analysis of a surface protein of Streptococcus pneumoniae recognized by protective monoclonal antibodies.
Microb. Pathog.
1:519-531[Medline].
|
| 16.
|
McDaniel, L. S.,
B. A. Ralph,
D. O. McDaniel, and D. E. Briles.
1994.
Localization of protection-eliciting epitopes on PspA of Streptococcus pneumoniae between amino acid residues 192 and 260.
Microb. Pathog.
17:323-337[Medline].
|
| 17.
|
McDaniel, L. S.,
J. S. Sheffield,
P. Delucchi, and D. E. Briles.
1991.
PspA, a surface protein of Streptococcus pneumoniae, is capable of eliciting protection against pneumococci of more than one capsular type.
Infect. Immun.
59:222-228[Abstract/Free Full Text].
|
| 18.
|
Mond, J. J.,
A. Lees, and C. M. Snapper.
1995.
T cell-independent antigens type 2.
Annu. Rev. Immunol.
13:655-692[Medline].
|
| 19.
|
Morrissey, P. J.,
L. Bressler,
L. S. Park,
A. Alpert, and S. Gillis.
1987.
Granulocyte-macrophage colony-stimulating factor augments the primary antibody response by enhancing the function of antigen presenting cells.
J. Immunol.
139:1113-1119[Abstract].
|
| 20.
|
Mosmann, T. R., and S. Sad.
1996.
The expanding universe of T-cell subsets: Th1, Th2 and more.
Immunol. Today
17:138-146[Medline].
|
| 21.
|
Nencioni, L.,
L. Villa,
A. Tagliabue,
G. Antoni,
R. Presentini,
F. Perin,
S. Silvestri, and D. Boraschi.
1987.
In vivo immunostimulating activity of the 163-171 peptide of human IL-1 .
J. Immunol.
139:800-804[Abstract].
|
| 22.
|
Rao, K. V. S., and A. R. Nayak.
1990.
Enhanced immunogenicity of a sequence derived from hepatitis B virus surface antigen in a composite peptide that includes the immunostimulatory region from human interleukin 1.
Proc. Natl. Acad. Sci. USA
87:5519-5522[Abstract/Free Full Text].
|
| 23.
|
Reed, S. G.,
D. L. Pihl,
P. J. Conlon, and K. H. Grabstein.
1989.
IL-1 as adjuvant: role of T cells in the augmentation of specific antibody production by recombinant human IL-1 .
J. Immunol.
142:3129[Abstract].
|
| 24.
|
Russell, M. W.,
Z. Moldoveanu,
P. L. White,
G. J. Sibert,
J. Mestecky, and S. M. Michalek.
1996.
Salivary, nasal, genital, and systemic antibody responses in monkeys immunized intranasally with a bacterial protein antigen and the cholera toxin B subunit.
Infect. Immun.
64:1272-1283[Abstract].
|
| 25.
|
Snapper, C. M., and W. E. Paul.
1987.
Interferon- and B cell stimulatory factor-1 reciprocally regulate Ig isotype production.
Science
236:944-947[Abstract/Free Full Text].
|
| 26.
|
Snapper, C. M.,
M. A. Moorman,
F. R. Rosas,
M. R. Kehry,
C. R. Maliszewski, and J. J. Mond.
1995.
IL-3 and granulocyte-macrophage colony-stimulating factor strongly induce Ig secretion by sort-purified murine B cells activated through the membrane Ig, but not the CD40, signaling pathway.
J. Immunol.
154:5842-5850[Abstract].
|
| 27.
|
Tagliabue, A., and D. Boraschi.
1993.
Cytokines as vaccine adjuvants: interleukin 1 and its synthetic peptide 163-171.
Vaccine
11:594-595[Medline].
|
| 28.
|
Talkington, D. F.,
D. C. Voellinger,
L. S. McDaniel, and D. E. Briles.
1992.
Analysis of pneumococcal PspA microheterogeneity in SDS polyacrylamide gels and the association of PspA with the cell membrane.
Microb. Pathog.
13:343-355[Medline].
|
| 29.
|
Tao, M.-H., and R. Levy.
1993.
Idiotype/granulocyte-macrophage colony-stimulating factor fusion protein as a vaccine for B-cell lymphoma.
Nature
362:755-758[Medline].
|
| 30.
|
Weinberg, A., and T. C. Merigan.
1988.
Recombinant interleukin 2 as an adjuvant for vaccine-induced protection: immunization of guinea pigs with herpes simplex virus subunit vaccines.
J. Immunol.
140:294-299[Abstract].
|
| 31.
|
Xiang, Z., and H. C. J. Ertl.
1995.
Manipulation of the immune response to a plasmid-encoded viral antigen by coinoculation with plasmids expressing cytokines.
Immunity
2:129-135[Medline].
|
| 32.
|
Yother, J., and D. E. Briles.
1992.
Structural properties and evolutionary relationships of PspA, a surface protein of Streptococcus pneumoniae, as revealed by sequence analysis.
J. Bacteriol.
174:601-609[Abstract/Free Full Text].
|
| 33.
|
Yother, J.,
G. L. Handsome, and D. E. Briles.
1992.
Truncated forms of PspA that are secreted from Streptococcus pneumoniae and their use in functional studies and cloning of the PspA gene.
J. Bacteriol.
174:610-618[Abstract/Free Full Text].
|
| 34.
|
Yother, J., and J. M. White.
1994.
Novel surface attachment mechanism for the Streptococcus pneumoniae protein PspA.
J. Bacteriol.
176:2976-2985[Abstract/Free Full Text].
|
Infect Immun, April 1998, p. 1513-1520, Vol. 66, No. 4
0019-9567/98/$04.00+0
Copyright © 1998, American Society for Microbiology. All rights reserved.
This article has been cited by other articles:
-
Thomas-Rudolph, D., Du Clos, T. W., Snapper, C. M., Mold, C.
(2007). C-Reactive Protein Enhances Immunity to Streptococcus pneumoniae by Targeting Uptake to Fc{gamma}R on Dendritic Cells. J. Immunol.
178: 7283-7291
[Abstract]
[Full Text]
-
Mannie, M. D., Clayson, B. A., Buskirk, E. J., DeVine, J. L., Hernandez, J. J., Abbott, D. J.
(2007). IL-2/Neuroantigen Fusion Proteins as Antigen-Specific Tolerogens in Experimental Autoimmune Encephalomyelitis (EAE): Correlation of T Cell-Mediated Antigen Presentation and Tolerance Induction. J. Immunol.
178: 2835-2843
[Abstract]
[Full Text]
-
Li, Y., Martinez, G., Gottschalk, M., Lacouture, S., Willson, P., Dubreuil, J. D., Jacques, M., Harel, J.
(2006). Identification of a Surface Protein of Streptococcus suis and Evaluation of Its Immunogenic and Protective Capacity in Pigs. Infect. Immun.
74: 305-312
[Abstract]
[Full Text]
-
Gor, D. O., Ding, X., Briles, D. E., Jacobs, M. R., Greenspan, N. S.
(2005). Relationship between Surface Accessibility for PpmA, PsaA, and PspA and Antibody-Mediated Immunity to Systemic Infection by Streptococcus pneumoniae. Infect. Immun.
73: 1304-1312
[Abstract]
[Full Text]
-
Colino, J., Snapper, C. M.
(2003). Opposing Signals from Pathogen-Associated Molecular Patterns and IL-10 Are Critical for Optimal Dendritic Cell Induction of In Vivo Humoral Immunity to Streptococcus pneumoniae. J. Immunol.
171: 3508-3519
[Abstract]
[Full Text]
-
Gor, D. O., Ding, X., Li, Q., Schreiber, J. R., Dubinsky, M., Greenspan, N. S.
(2002). Enhanced Immunogenicity of Pneumococcal Surface Adhesin A by Genetic Fusion to Cytokines and Evaluation of Protective Immunity in Mice. Infect. Immun.
70: 5589-5595
[Abstract]
[Full Text]
-
Khan, A. Q., Shen, Y., Wu, Z.-Q., Wynn, T. A., Snapper, C. M.
(2002). Endogenous Pro- and Anti-Inflammatory Cytokines Differentially Regulate an In Vivo Humoral Response to Streptococcus pneumoniae. Infect. Immun.
70: 749-761
[Abstract]
[Full Text]
-
Colino, J., Shen, Y., Snapper, C. M.
(2001). Dendritic Cells Pulsed with Intact Streptococcus pneumoniae Elicit both Protein- and Polysaccharide-specific Immunoglobulin Isotype Responses In Vivo through Distinct Mechanisms. J. Exp. Med.
195: 1-14
[Abstract]
[Full Text]
-
Bosarge, J. R., Watt, J. M., McDaniel, D. O., Swiatlo, E., McDaniel, L. S.
(2001). Genetic Immunization with the Region Encoding the {alpha}-Helical Domain of PspA Elicits Protective Immunity against Streptococcus pneumoniae. Infect. Immun.
69: 5456-5463
[Abstract]
[Full Text]
-
Faulkner, L., Buchan, G., Lockhart, E., Slobbe, L., Wilson, M., Baird, M.
(2001). IL-2 linked to a peptide from influenza hemagglutinin enhances T cell activation by affecting the antigen-presentation function of bone marrow-derived dendritic cells. Int Immunol
13: 713-721
[Abstract]
[Full Text]
-
Christ, O., Matzku, S., Burger, C., Zöller, M.
(2001). Interleukin 2-Antibody and Tumor Necrosis Factor-Antibody Fusion Proteins Induce Different Antitumor Immune Responses in Vivo. Clin. Cancer Res.
7: 1385-1397
[Abstract]
[Full Text]
-
Wu, Z.-Q., Khan, A. Q., Shen, Y., Schartman, J., Peach, R., Lees, A., Mond, J. J., Gause, W. C., Snapper, C. M.
(2000). B7 Requirements for Primary and Secondary Protein- and Polysaccharide-Specific Ig Isotype Responses to Streptococcus pneumoniae. J. Immunol.
165: 6840-6848
[Abstract]
[Full Text]
-
Wu, Z.-Q., Vos, Q., Shen, Y., Lees, A., Wilson, S. R., Briles, D. E., Gause, W. C., Mond, J. J., Snapper, C. M.
(1999). In Vivo Polysaccharide-Specific IgG Isotype Responses to Intact Streptococcus pneumoniae Are T Cell Dependent and Require CD40- and B7-Ligand Interactions. J. Immunol.
163: 659-667
[Abstract]
[Full Text]
-
McNeel, D. G., Schiffman, K., Disis, M. L.
(1999). Immunization With Recombinant Human Granulocyte-Macrophage Colony-Stimulating Factor as a Vaccine Adjuvant Elicits Both a Cellular and Humoral Response to Recombinant Human Granulocyte-Macrophage Colony-Stimulating Factor. Blood
93: 2653-2659
[Abstract]
[Full Text]
-
Briles, D. E., Tart, R. C., Swiatlo, E., Dillard, J. P., Smith, P., Benton, K. A., Ralph, B. A., Brooks-Walter, A., Crain, M. J., Hollingshead, S. K., McDaniel, L. S.
(1998). Pneumococcal Diversity: Considerations for New Vaccine Strategies with Emphasis on Pneumococcal Surface Protein A (PspA). Clin. Microbiol. Rev.
11: 645-657
[Abstract]
[Full Text]