TEXT

Top Abstract Text References

Bacteroides fragilis inhabits the colons of humans and animals and in humans comprises about 1% of the normal gut flora (23). Although abundant, at approximately 10⁹ organisms/g of human feces, it is less prevalent than a number of other anaerobes in the intestine, some of which are present at more than 10¹⁰ organisms/g of feces. B. fragilis is, however, by far the anaerobe most commonly isolated from clinical specimens and has been associated with a number of diseases, including soft tissue infections, abscesses, and bacteremias (14, 36). Its prevalence in infections caused by anaerobic organisms has been attributed in large part to its complex carbohydrate capsule, which has been shown to cause abscesses in the absence of the organism itself (43). An outer membrane protein involved in heme uptake has also been implicated in virulence (33). Little else, however, is known about factors contributing to B. fragilis infections.

In 1984 Myers et al. implicated strains of B. fragilis as a cause of diarrhea in newborn lambs (24). They showed that the supernatant of these strains caused a fluid response in lamb ligated intestinal loops, suggesting the presence of an enterotoxin. These strains, termed enterotoxigenic B. fragilis strains, were also found to cause intestinal disease in calves, piglets, foals, and rabbits (4, 5, 7, 25, 26, 28-30). More recently, enterotoxigenic B. fragilis has been implicated in human diarrheal disease (27, 34, 36, 38, 41). In 1992, Weikel et al. showed that supernatants of enterotoxigenic B. fragilis caused rapid morphological changes in human colon carcinoma cell lines, particularly HT-29 cells (45; see also references 6 and 39). Our laboratory used the cytopathic effect to assay for toxin activity and purified a single 20-kDa polypeptide which induced rounding of HT-29 cells and caused fluid secretion in intestinal-loop assays (44). We subsequently cloned a portion of the enterotoxin gene using single-specific-primer PCR with a degenerate primer based on the N-terminal sequence of the secreted enterotoxin (22). Sequencing revealed the toxin contained a zinc-binding motif (HEXXHXXGXXH) characteristic of metalloproteases from the metzincin family (3, 42). Biochemical analysis confirmed that the enterotoxin was indeed a zinc metalloprotease. Furthermore, specific inhibitors of metalloproteases inhibited cytotoxicity and prevented fluid secretion and tissue damage caused by the toxin in vivo, suggesting that its toxic properties are due to the protease activity (32). We also showed that the toxin (now termed fragilysin) disrupts the paracellular barrier of cultured epithelial cell monolayers (31). Monolayers treated with fragilysin showed a time- and dose-dependent loss of the tight-junction protein ZO-1 and a concomitant decrease in electrical resistance. Furthermore, the effect appeared to be dependent on proteolytic activity outside the cell, as inhibitors of cell-mediated endocytosis did not prevent the toxin's effect. Together, these data suggest that the enterotoxic activity of fragilysin is due to disruption of the paracellular barrier of the intestinal epithelium, possibly by proteolytic degradation of the tight-junction proteins.

We recently reported cloning and sequencing of the fragilysin toxin gene from a cosmid library of enterotoxigenic B. fragilis strain VPI 13784 (18). The toxin gene encodes a preprotoxin of 44 kDa. The preprotoxin contains a potential N-terminal signal peptide characteristic of bacterial lipoproteins and a 22-kDa prosequence (46). The protoxin is cleaved at an Arg-Ala site to release the 20-kDa extracellular metalloprotease.

In recent years it has emerged that virulence genes of pathogenic bacteria are often clustered within definable genetic elements termed pathogenicity islands (8, 10-12, 19). We were, therefore, interested in whether the fragilysin gene is associated with other virulence genes in a pathogenicity island.

Definition of the pathogenicity islet and analysis of the site of integration. In order to determine if the fragilysin gene of enterotoxigenic B. fragilis strain VPI 13784 was contained on a pathogenicity island, we began sequencing DNA flanking the gene in cosmid clone 2c1, which we isolated in our previous study (18). To determine if we were still using DNA found only in enterotoxigenic strains, we periodically performed PCRs on the nontoxigenic B. fragilis strain VPI 2553 with primers facing inward with respect to the fragilysin gene. Eventually, with primers LO1 (5' CCACCGTGCCAATGTCAGATA) and RO1 (5' CTGAAGAACGAGGCGGTATC) we observed a PCR product of approximately 350 bp, suggesting we had sequenced past the ends of an element. From this analysis we were able to predict that the fragilysin gene was contained in an element of approximately 6 kb, which we termed the fragilysin pathogenicity islet (Fig. 1).

View larger version (5K): [in this window] [in a new window]   FIG. 1.   Schematic of the fragilysin pathogenicity islet. ORFs are represented by thick arrows. Small arrows at the ends represent direct repeats. Open boxes at the ends represent DNA outside the islet, which is also present in nontoxigenic B. fragilis. Restriction sites are BamHI (B), EcoRI (E), PstI (P), SacI (Sc), SmaI (Sm), XmnI (X), HindIII (H), and NdeI (N).

View larger version (11K): [in this window] [in a new window]   FIG. 2.   Nucleotide sequences used to define the ends of the fragilysin pathogenicity islet. The nontoxigenic sequence was from B. fragilis VPI 2553. Toxigenic sequences across the left and right ends of the pathogenicity islet were from enterotoxigenic B. fragilis strain VPI 13784. Lowercase letters represent where the sequence from the nontoxigenic strain varied from the sequence flanking the ends of the islet. A 17-bp sequence present only in DNA from the nontoxigenic strain is boxed. Arrows indicate the ends of the islet and corresponding nucleotide number. Direct repeats (DR) are underlined.

Sequence of a putative second metalloprotease (MP II) and comparison to fragilysin. An open reading frame (ORF) of 1,188 bp encoding a predicted protein of 396 amino acids was located 1,676 bp upstream of the fragilysin gene (Fig. 3). The predicted protein had a calculated molecular weight of 44,396 and a pI of 5.26, compared to a calculated molecular weight of 44,402 and pI of 5.08 for fragilysin. Furthermore, the deduced amino acid sequence contained a zinc-binding motif and methionine-turn characteristic of the metzincins (3). The N terminus contained an 18-amino-acid hydrophobic sequence similar to signal peptides found in bacterial lipoproteins, a feature also observed for fragilysin (9, 18, 46). An Arg-Ala site was located near the middle of the predicted protein, in a position similar to the processing site of fragilysin. If processed at this site the released product would be a 183-residue protein (M_r, 20,446) with a pI of 5.49; by comparison, extracellular fragilysin is a 186-residue protein (M_r, 20,680) with a pI of 4.71. 

View larger version (37K): [in this window] [in a new window]   FIG. 3.   Alignment of the predicted amino acid sequences of MP II and fragilysin. |, identical residues; *, conserved substitutions.

Nucleotide sequence accession numbers. The GenBank accession numbers of the B. fragilis VPI 13784 pathogenicity islet sequence and the integration site of nontoxigenic VPI 2553 are AF038459 and AF038460, respectively.