Previous Article | Next Article 
Infect Immun, May 1998, p. 1910-1917, Vol. 66, No. 5
0019-9567/98/$04.00+0
Copyright © 1998, American Society for Microbiology. All rights reserved.
Genetic Control of Immune Response to Recombinant
Antigens Carried by an Attenuated Salmonella typhimurium
Vaccine Strain: Nramp1 Influences T-Helper Subset Responses
and Protection against Leishmanial Challenge
Shiu-Shing
Soo,1,2
Bernardo
Villarreal-Ramos,3
C. M. Anjam
Khan,4
Carlos E.
Hormaeche,4 and
Jenefer M.
Blackwell1,2,*
Department of Pathology, University of
Cambridge, Cambridge CB2 1QP,1
Institute
of Animal Health, Compton Near Newbury RG16
0NN,3
Department of Microbiology, The
Medical School, University of Newcastle, Newcastle upon Type NE2
4HH,4 and
Department of Medicine,
University of Cambridge Clinical School, Cambridge CB2
2QQ,2 United Kingdom
Received 1 July 1997/Returned for modification 9 September
1997/Accepted 23 January 1998
 |
ABSTRACT |
Attenuated strains of Salmonella typhimurium have been
widely used as vehicles for delivery and expression of vaccine antigens in murine models of infectious disease. In mice, early bacterial replication following infection with S. typhimurium is
controlled by the gene (Nramp1, formerly
Ity/Lsh/Bcg) encoding the natural-resistance-associated macrophage protein (Nramp1). Nramp1 regulates macrophage activation and
has multiple pleiotropic effects, including regulation of tumor
necrosis factor alpha, interleukin 1
(IL-1
), and major histocompatibility complex class II molecules, all of which influence antigen processing and presentation. Nramp1 also has a direct effect on
antigen processing, possibly by regulating the activity of proteases in
the late endosomal compartment. Hence, there are multiple ways
(regulation of bacterial load or recombinant antigen dose, class II
molecule expression, costimulatory or adjuvant activity, and antigen
processing) that Nramp1 might influence responses to recombinant
salmonella vaccines. To test the hypothesis that Nramp1 influences
responses to vaccination, congenic mouse strains have been used to
analyze immune responses to recombinant antigens (tetanus toxoid
antigen and leishmanial gp63) carried by live attenuated S. typhimurium aroA aroD mutants. Results show that congenic mice
carrying the wild-type (S. typhimurium resistance) Nramp1 allele mount a predominantly T-helper-1 (IL-2 and
gamma interferon) response to vaccination and show enhanced resolution of lesions following challenge infection with Leishmania
major. In contrast, mice carrying mutant (S. typhimurium susceptibility) Nramp1 mount a T-helper-2
(immunoglobulin E and IL-4) response and show exacerbated lesion growth
upon challenge.
 |
INTRODUCTION |
Attenuated strains of
Salmonella have been widely used as vehicles for delivery
and expression of a heterogeneous range of antigens (Ag) from other
pathogens (for a review, see reference 18). In
murine models of infectious disease, genetically engineered Salmonella typhimurium has been used to induce immunity to
viral (influenza virus A [40]), bacterial (tetanus
toxin [10], Streptococcus pyogenes M1
protein [31], and Francisella tularensis
[36]), protozoan (Leishmania major
[44, 45] and Plasmodium yoelii circumsporozoite protein [33]), and helminth
(schistosomiasis [22, 23]) Ag. Since a similar vaccine
strategy (e.g., attenuated Salmonella typhi aro mutants in
human trials [16, 39]) might ultimately be adopted for
use in genetically diverse human populations, it is important to
investigate the influence that host genetics might have on the ability
to induce protective immune responses to recombinant salmonella
vaccines. While major histocompatibility complex (MHC) class I and
class II molecule genes with polymorphisms will be obvious candidate
genes because of their ability to restrict vaccine responses to certain
antigenic epitopes, a role for non-MHC genes acting independently of Ag
specificity should also be considered.
In mice, early bacterial replication following infection with S. typhimurium is regulated by the gene (Nramp1, formerly
Ity/Lsh/Bcg) encoding the natural-resistance-associated
macrophage protein (Nramp1) (for reviews, see references 4,
6, and 37). Nramp1 was
identified by positional cloning (42). Gene knockout was then used (41) to formally demonstrate that the gene
(renamed Nramp1) mediated resistance to all three
intramacrophage pathogens S. typhimurium (Ity),
Leishmania donovani (Lsh), and
Mycobacterium bovis (Bcg). The protein (Nramp1)
encoded by Nramp1 regulates the cascade of gene-inductive
events which follow interaction of macrophages with bacterial
lipopolysaccharide (LPS) and/or natural killer- or T-cell-derived gamma
interferon (IFN-
). The gene has multiple pleiotropic effects,
including regulation of tumor necrosis factor alpha (TNF-
),
interleukin 1
(IL-1
), and MHC class II molecules. All of these
influence Ag processing and presentation, either directly (class II) or
indirectly through their costimulatory or adjuvant (IL-1
and
TNF-
) activity. Recent studies also demonstrate that Nramp1 has a
more direct effect on Ag processing, possibly by regulating the
activity of proteases in the late endosomal compartment
(26). Hence, there are multiple ways (regulation of
bacterial load or recombinant Ag dose, class II molecule expression,
costimulatory or adjuvant activity, and Ag processing) that Nramp1
might influence responses to recombinant salmonella vaccines.
To test the hypothesis that Nramp1 influences responses to vaccination,
congenic mouse strains have been used to analyze immune responses to
recombinant Ag (tetanus toxoid Ag and leishmanial gp63) carried by live
attenuated S. typhimurium aroA aroD mutants. Results show
that congenic mice carrying the wild-type (S. typhimurium resistance) Nramp1 allele mount a predominantly T-helper-1
(IL-2 and IFN-
) response to vaccination and show enhanced resolution of lesions following challenge infection with L. major. In
contrast, mice carrying mutant (S. typhimurium
susceptibility) Nramp1 mount a T-helper-2 (immunoglobulin E
[IgE] and IL-4) response and show exacerbated lesion growth upon
challenge.
 |
MATERIALS AND METHODS |
Construction of salmonella vaccines.
The attenuated S. typhimurium BRD847 aroA aroD double mutant vaccine
strain carrying the expression plasmid pTETnir15
containing DNA sequence encoding fragment C of the tetanus toxoid Ag
(TetC) was kindly provided by S. N. Chatfield (Medeva Group
Research, Imperial College of Science and Technology, London, England). For preparation of the leishmanial gp63-salmonella vaccine, primers (GAGGATCCGTGCGCGACGTGAACTGG and
AAACTAGTACCACGACGACCAGCCGC, engineered to provide
BamHI restriction enzyme sites at either end of the PCR
product) were designed to PCR (Pfu polymerase; New England Biolabs, Beverly, Mass.) amplify the gp63 gene (excluding the region
containing the signal sequence for addition of the
glycosylphosphatidylinositol anchor) from L. major
expression clone pBS10Rb.1, in which codon usage had been corrected for
bacterial expression (kindly provided by Robert McMaster, Department of
Medical Genetics, University of British Columbia, Vancouver, British
Columbia, Canada). One or two copies of the gp63 gene were cloned in
tandem with the TetC gene into the salmonella expression vector pTECH2
(22, 23), a derivative of pTETnir15. Plasmids
(pTECH2 alone or carrying genes encoding gp631TetC or
gp632TetC; see below) were transfected into the single
aroA mutant vaccine strain S. typhimurium SL3261
(kindly provided by B. A. D. Stocker, Department of
Microbiology and Immunology, Stanford University School of Medicine,
Stanford, Calif.). Expression of gp63 was checked by sodium dodecyl
sulfate-polyacrylamide gel electrophoresis and Western blotting.
Briefly, cells growing at mid-log phase under ampicillin selection were
harvested by centrifugation and the proteins were fractionated by
sodium dodecyl sulfate-10% polyacrylamide gel electrophoresis.
Proteins were transferred to nitrocellulose membranes by
electroblotting, and the presence of gp63TetC was detected with the
mouse anti-gp63 monoclonal antibody (MAb) CP3.235 also kindly provided
by Robert McMaster or with rabbit polyclonal anti-TetC prepared
in-house. Appropriate-size bands were seen for clones bearing one
(gp631TetC = 100 kDa) or two
(gp632TetC = 150 kDa) copies of the gp63 gene.
S. typhimurium SL3261 was used as the salmonella-only
control where appropriate.
Salmonella Ag preparation.
To prepare salmonella Ag, a
stationary overnight culture of S. typhimurium C5 was
sedimented by centrifugation and cells were washed and resuspended in
sterile phosphate-buffered saline (PBS). Bacteria were lysed by
sonication (Soniprep 150; Fisher Scientific UK, Loughborough, England)
and cell debris was removed by centrifugation. The lysate was filter
sterilized through 0.22-µm-pore-size filters, and the protein content
was estimated with the bicinochoninic acid kit (Pierce Biochemicals,
Rockford, Ill.).
Mice.
Female CBA/Ca (Nramp1 wild-type) and BALB/c
(Nramp1 mutant) mice and male and female C57BL/10ScSn (B10;
Nramp1 mutant) mice were purchased from Harlan Olac
(Blackthorn, Bicester, England) or were bred in-house from original
breeding stock obtained from Harlan Olac. Male and female
B10.L-Lshr (N20; Nramp1 wild-type)
congenic mice (7) were bred in-house in a conventional
facility. All mice were cohoused in this facility prior to experimental
use.
Vaccination protocol.
Salmonella vaccine strains were grown
in Luria-Bertani broth supplemented with 50 µg of ampicillin per ml
and incubated overnight aerobically at 37°C. Cultures were aliquoted
(0.5 ml) and cryopreserved in liquid nitrogen. Cryopreserved aliquots
were thawed in a water bath at 45°C and 200 µl was diluted in
sterile PBS to 1 in 10
6. A 200-µl portion was further
diluted in 20 ml of molten Luria-Bertani agar (45°C) and plated with
or without 50 µg of ampicillin per ml. Plates were incubated at
37°C overnight, and the bacterial concentration was established by
colony counting (CFU). The original cryopreserved bacterial culture
aliquots could then be diluted in sterile PBS as required for
consistent provision of the appropriate concentration of bacteria for
vaccination in different experiments. Mice were vaccinated at the age
of 8 to 10 or 10 to 12 weeks (age matched within experiments). Mice
were inoculated intravenously with 1 × 106 to 2 × 106 CFU in sterile PBS. Viable counts in the livers and
spleens of mice sacrificed at intervals from weeks 1 to 6 postvaccination were determined as described previously
(17).
Spleen cell assays.
Spleens from three mice per vaccine
group sacrificed at weeks 1 to 6 were pooled, and cell suspensions were
prepared in RPMI 1640 (Sigma, Poole, Dorset, England) by sieving.
Erythrocytes were lysed by incubation in Gey's solution
(28) at 4°C for 4 min. Cells were washed by centrifugation
at 260 × g for 7 min and finally resuspended in CRPMI
(RPMI 1640 supplemented with 10% fetal calf serum [FCS] [Sigma],
0.02 M HEPES buffer, 0.5 mM 2-mercaptoethanol, 100 U each of penicillin
and streptomycin per ml, and 0.2 mM glutamine. Cells were dispensed in
triplicate to round-bottomed 96-well plates at 4 × 105 cells per well in 200 µl of CRPMI. Salmonella Ag or
TetC (Boehringer Mannheim, Lewes, Sussex, England) was diluted in CRPMI
and added in 10- to 20-µl volumes to obtain final concentrations as
indicated below. Cell culture supernatants were collected at 48 h
for IL-2 detection and 72 h for IFN-
detection and stored at
80°C. For IL-4 detection in culture supernatants, cells were
incubated with TetC for 120 h prior to addition of 50 ng of
phorbol myristate acetate (PMA) per ml and 1 µM ionophore
(Calbiochem, La Jolla, Calif.). Supernatants were collected 15 h
after stimulation with PMA-ionophore.
Cytokine detection.
Cytokines were detected by enzyme-linked
immunosorbent assay (ELISA). Flat-bottomed 96-well plates (Maxisorb,
Nunclon; GIBCO BRL, Life Technologies Ltd., Paisley, Scotland) were
coated with one of the following capture MAbs in 0.1 M
NaHCO3: anti-IL-2 JES6-1A12, anti-IFN-
XMG1.2, and
anti-IL-4 11B11 (Pharmingen, San Diego, Calif.). Nonspecific binding
sites were blocked with CRPMI. Plates were washed with PBS-0.05%
Tween. Supernatants and standards (Pharmingen) were diluted with CRPMI.
Capture Abs (biotinylated anti-IL-2 JES6-5H4, anti-IFN-
18112D, or
anti-IL-4 18191D) were diluted according to the manufacturer's
instructions in PBS-10% FCS. Second-layer detection was done with
avidin peroxidase (0.0025 mg/ml in PBS-10% FCS), followed by
orthophenylenediamine-H2O2 as a substrate.
Plates were read at 490 nm on a microtiter plate reader (Biotek
Instruments Inc., ANACHEM, Luton, England).
Anti-TetC Ab detection.
Anti-TetC Abs were measured by ELISA
with sera prepared from weekly tail bleeds of immunized mice and stored
at
20°C. Plates were coated with 0.1 µg of recombinant TetC
(Boehringer Mannheim) per well and washed with PBS-0.05% Tween. For
total anti-TetC Ig, sera were diluted 1:25 in 2% casein in PBS and Ig
levels were determined by direct second-layer incubation with a 1:1,000
dilution of goat anti-mouse total Ig horseradish peroxidase (HRP)
conjugate (Dako Ltd., High Wycombe, Buckinghamshire, England). Subclass Ab levels were determined by using rat anti-mouse IgE or rabbit anti-mouse IgG1, IgG2a, or IgM (Zymed Laboratories Inc., Cambridge BioScience, Cambridge, England) at a dilution of 1:5,000. Third-layer detection was done with a 1:500 dilution of rabbit anti-rat HRP conjugate or a 1:500 dilution of swine anti-rabbit HRP conjugate (Dako), as appropriate. Sera and second- and third-layer Abs were diluted in 1% bovine serum albumin in PBS. Plates were developed with
orthophenylenediamine-H2O2. The reaction was
stopped with 3 M sulfuric acid. Plates were read at 490 nm.
Antisalmonella Ab detection.
Non-O-Ag-specific
antisalmonella Abs were detected by ELISA. Plates were coated with
lysate of a rough derivative of S. typhimurium C5 in
Reggiardo's buffer (0.01 M glycine, 0.02 M NaCl, 0.2 mM EDTA [pH
8.0], 0.01 M NaF, 0.1% sodium deoxycholate). Sera were diluted 1:400
in 1% bovine serum albumin (Sigma) in PBS. Total Ig and subclass Ab
levels were detected as before.
Challenge infection.
Mice were challenged by subcutaneous
inoculation of 5 × 106 metacyclic L. major
LV39 promastigotes in the right hind footpad. Infection was monitored
at weekly intervals by measurement of footpad depth with a vernier dial
caliper (Manostat; CP Instrument Co., Bishop Stortford, Hertfordshire,
England).
Statistics.
Unpaired two-tailed Student's t
tests were used to compare groups of mice at each time point.
 |
RESULTS |
Bacterial loads postvaccination.
To test the hypothesis that
Nramp1 wild-type (S. typhimurium-resistant) and
mutant (S. typhimurium-susceptible) mice would respond
differently to foreign Ag presented to the immune system in the context
of a salmonella vaccine vehicle, experiments were performed initially
using the live attenuated aroA aroD mutant S. typhimurium BRD847 strain expressing TetC alone. As expected, Nramp1 wild-type CBA/Ca mice showed lower bacterial loads in
liver and spleen at day 4 after infection than did Nramp1
mutant BALB/c mice and an enhanced rate of clearance of the vaccine
strain thereafter (Fig. 1a and b). The
early (days 1 to 7) Nramp1-regulated differences in
bacterial growth and clearance were not as dramatic as those observed
with the more virulent S. typhimurium C5 strain (17, 30) and were barely detectable in experiments using the pair of
B10 congenic mouse strains (B10 and N20 [Fig. 1c to f]). We did,
however, observe an unexpected 33% mortality in B10 mice, in contrast
to 14% in N20 male mice, over the first 14 days postvaccination. Bacterial loads in dead mice were not determined and hence do not
contribute to the bacterial loads provided in Fig. 1. Only 1 of 36 female mice of each strain died during this time period. In subsequent
experiments, female mice were used in conjunction with a lower
bacterial inoculum. In the initial experiment, there was no subsequent
mortality, and the B10 congenic mouse strains showed equivalent rates
of bacterial clearance after day 10 postvaccination (Fig. 1c to f),
suggesting that other genes might influence the later course of
infection in BALB/c and CBA/Ca mice (Fig. 1a and b). For our purposes,
it was preferable that there were not large differences in bacterial
loads between Nramp1 wild-type and Nramp1 mutant
mouse strains, since the resulting difference in vaccine Ag load could
complicate the interpretation of results. Hence, using the B10 congenic
mice, we could be more confident that any differences in immune
response to TetC observed between strains would be attributable to
Nramp1-regulated differences in Ag handling and presentation
to the immune system, rather than simply to Ag dose.

View larger version (20K):
[in this window]
[in a new window]
|
FIG. 1.
Recovery of S. typhimurium BRD847 carrying
pTETnir15 (mean log10CFU ± standard
deviation/organ; three mice per time point) from the spleens (a, c, and
e) and livers (b, d, and f) of vaccinated mice. Results of two separate
experiments are shown; one compared BALB/c Nramp1 mutant and
CBA/Ca wild-type mice (a and b), and one compared male (c and d) or
female (e and f) B10 and N20 congenic mice. Closed symbols,
Nramp1 wild-type strains; open symbols, Nramp1
mutant strains. Where error bars are not visible, the standard error
was within the area occupied by the symbol. Significance levels
determined by t tests are indicated as follows: *,
P < 0.05, and ***, P < 0.001. Similar results were obtained in two subsequent experiments in which
B10 mice were injected with S. typhimurium SL3261 carrying
pTECH2.
|
|
Ab responses to TetC.
No significant differences in total
anti-TetC Ig levels (or total antisalmonella Ig levels [data not
shown]) were observed between BALB/c and CBA/Ca mice (data not shown)
or between B10 and N20 male (Fig. 2a) or
female (Fig. 2b) mice. In striking contrast, the B10 congenic mouse
strains showed dramatic differences in anti-TetC IgE levels from weeks
1 through 5 postvaccination for male mice (Fig. 2c) and weeks 2 through
6 for female mice (Fig. 2d), indicative of a strong T-helper-2-driven
response in the B10 Nramp1 mutant strain. Because of the
unexpected mortality in male B10 mice, immune response measurements
were taken only up to 5 weeks postvaccination. As indicated above,
female mice were used in all subsequent experiments to avoid this
problem. BALB/c mice also showed a significantly (P < 0.05) higher anti-TetC IgE response at 20 days postvaccination than did
CBA/Ca mice (data not shown). There were, however, no consistent
differences in IgM responses, or in T-helper-1-driven IgG2a versus
T-helper-2-driven IgG1 responses, to TetC between mouse strains (data
not shown). Nevertheless, given the very strong evidence for linkage
between IgE responses and the IL-4-IL-9 T-helper-2 cytokine gene
cluster (11, 27), this very dramatic difference in IgE
responses is strongly indicative of a bias in the T-helper-2 arm of the
immune response in Nramp1 mutant mice.

View larger version (18K):
[in this window]
[in a new window]
|
FIG. 2.
Anti-TetC total Ig (a and b) or IgE (c and d) antibody
levels (means ± standard errors; three mice per time point) in
postvaccination sera from male (a and c) or female (b and d) B10 (open
symbols) and N20 (closed symbols) mice. Where error bars are not
visible, the standard error was within the area occupied by the symbol.
Significance levels determined by t tests are indicated as
follows: *, P < 0.05; **, P < 0.01; and ***, P < 0.001. Results are from the
same B10 experiment as presented in Fig. 1. Similar results were
obtained in a repeat experiment in which S. typhimurium
SL3261 carrying pTECH2 was injected into female B10 mice. OD, optical
density.
|
|
Cytokine responses to TetC.
To determine whether a divergence
in T-helper-1 and T-helper-2 responses between Nramp1
wild-type and mutant congenic mouse strains could also be detected at
the cytokine level, IL-2 and IFN-
responses to TetC were measured
following restimulation of spleen cells in vitro. Figure
3 demonstrates that following clearance
of the bacterial load in liver and spleen (Fig. 1), a strong recall
memory T-cell response was established for both IL-2 (Fig. 3a and b)
and IFN-
(Fig. 3c and d) production. For both of these
T-helper-1-associated cytokine responses, N20 congenic Nramp1 wild-type mice showed an enhanced response compared
to B10 Nramp1 mutant mice at weeks 5 (male mice) and/or 6 (female mice) postvaccination. A very similar pattern of responses
between the strains was observed in experiments examining the response to restimulation with whole crude salmonella lysates (data not shown),
suggesting that there is a generally enhanced ability to show a
T-helper-1 CD4 response to all salmonella-derived Ag in congenic
Nramp1 wild-type mice. Attempts to measure IL-4 cytokine responses in supernatants from this experiment were not successful. In
follow-up experiments, IL-4 was measured in spleen cell populations expanded by TetC stimulation for 120 h prior to being triggered with PMA plus ionophore. Supernatants were collected 15 h after the PMA-ionophore trigger. The rationale for this experiment is that
the PMA and ionophore act together as a potent trigger for rapid IL-4
production by this expanded cell population. This was used as a measure
of whether a bias towards a committed T-helper-2 population has
occurred. Figure 4 demonstrates that, as
would be predicted from the anti-TetC IgE data, B10 mice showed an
enhanced PMA-ionophore-elicited IL-4 response in this TetC-expanded
population compared to that of N20 mice. In these experiments,
stimulation with TetC alone did not lead to significant IL-4 release,
presumably because IL-4 produced is consumed within the culture system.
Interestingly, the spleen cell population from vaccinated B10 mice
which had not been expanded in vitro on TetC also showed a higher
PMA-ionophore-elicited IL-4 response than the parallel cell population
from N20 mice, indicating that the cells ex vivo also showed a bias
towards a T-helper-2 response at 6 weeks after salmonella TetC
vaccination. Spleen cells from naive B10 and N20 mice did not show this
difference in baseline response to PMA-ionophore (data not shown).

View larger version (19K):
[in this window]
[in a new window]
|
FIG. 3.
TetC-stimulated IL-2 (a and b) or IFN- (c and d)
production (means ± standard errors; three mice per time point)
in spleen cells isolated from male (a and c) or female (b and d) B10
(open symbols) and N20 congenic (closed symbols) mice after vaccination
with S. typhimurium BRD847. Where error bars are not
visible, the standard error was within the area occupied by the symbol.
Significance levels determined by t tests are indicated as
follows: *, P < 0.05; **, P < 0.01; and ***, P < 0.001. Background IL-2 and
IFN- production in wells without Ag were subtracted from the
TetC-stimulated response. The background IFN- levels were highest
(12 to 24 ng/ml) at weeks 1 and 2 postvaccination, suggesting that
endogenous salmonellae were stimulating a natural killer cell response.
Backgrounds for IL-2 were <0.02 ng/ml throughout. Results are from the
same B10 experiment as presented in Fig. 1. Similar results were
obtained in three repeat experiments in which S. typhimurium
SL3261 carrying pTECH2 was injected in female B10 congenic mice.
|
|

View larger version (21K):
[in this window]
[in a new window]
|
FIG. 4.
PMA-ionophore (P/I)-triggered IL-4 production
(means ± standard errors; three mice per group) in TetC-expanded
spleen cells isolated from B10 (open bars) and N20 congenic (filled
bars) female mice 6 weeks after vaccination with S. typhimurium SL3261 carrying pTECH2. The differences between mouse
strains for P/I-elicited IL-4 production were significant with or
without restimulation with TetC in vitro, indicating that the
splenocyte population ex vivo was also biased towards a
T-helper-2-committed population in the B10 strain. No differences were
observed for P/I-elicited IL-4 production in splenocytes from naive B10
and N20 mice (data not shown). Similar results were obtained in a
repeat experiment for S. typhimurium SL3261 carrying pTECH2
in female B10 congenic mice. Significance levels determined by
t tests are indicated as follows: *, P < 0.05, and **, P < 0.01.
|
|
Response to challenge infection.
To determine whether the
strong bias in T-helper-1 versus T-helper-2 responses in
Nramp1 congenic mouse strains would influence their
responses to challenge infection in a model disease system, an
attenuated salmonella vaccine was engineered to incorporate leishmanial
gp63 in tandem with TetC. Previous studies (22, 23) had
demonstrated that TetC enhances the response to vaccine Ag in this
cloning strategy. Two types of construct were prepared in which one or
two copies of the gp63 gene were cloned in tandem with one copy of the
TetC gene. To ensure complete bacterial clearance before challenge
infection, mice were challenged with L. major 12 weeks after
vaccination. Monitoring infection in control mice, either in naive
infected mice (Fig. 5a) or in mice
receiving the S. typhimurium SL3261 pTECH2 control
vaccination (Fig. 5b), demonstrated that as shown previously (5,
19), Nramp1 does not have a dramatic influence over
the course of L. major infection in the footpad. Among mice
vaccinated with S. typhimurium SL3261 transfected with
expression plasmids containing one (Fig. 5c) or two (Fig. 5d) copies of
the gp63 gene in tandem with the TetC gene, resolution of lesion size
was moderately enhanced in N20 mice and moderately exacerbated in B10
mice. When footpad measurements for B10 pTECH2 control-vaccinated mice
were compared to those for the B10 gp63-vaccinated mice, it was found
that the mean footpad depth for the gp63-vaccinated mice was higher
than for mice vaccinated with pTECH2 alone at every time point.
Similarly, when the footpad measurements for N20 pTECH2
control-vaccinated mice were compared to those for the N20
gp63-vaccinated mice, it was found that the mean footpad depth for the
gp63-vaccinated mice was lower than that for mice vaccinated with
pTECH2 alone at every time point. Hence, although the between-group
differences within mouse strains do not achieve statistical
significance, the sum of these two effects produces highly
statistically significant differences in lesion size in B10
gp63-vaccinated and N20 gp63-vaccinated mice over 17 weeks of infection
(Fig. 5c and d). Two copies of the gp63 gene did not significantly
alter this response to vaccination, in terms of either protection in
the Nramp1 wild-type mice or disease exacerbation in mutant
mice. The results are consistent with the hypothesis that an enhanced
T-helper-1 response in congenic Nramp1 wild-type mice is
protective, while the T-helper-2 response of Nramp1 mutant mice leads to exacerbated disease. The latter did not, however, overcome the overall genetic resistance of the B10 background to
L. major infection (19), because all groups of
mice ultimately resolved their footpad lesions.

View larger version (26K):
[in this window]
[in a new window]
|
FIG. 5.
Course of L. major infection (means ± standard errors) in B10 (open symbols) and N20 congenic (closed
symbols) mice. (a) Naive control mice; (b) mice vaccinated with
S. typhimurium SL3261 carrying control vector (pTECH2) only;
(c) mice vaccinated with S. typhimurium SL3261 carrying
pTECH2 containing one copy of the leishmanial gp63 gene; (d) mice
vaccinated with S. typhimurium SL3261 carrying pTECH2
containing two copies of the leishmanial gp63 gene. Where error bars
are not visible, the standard error was within the area occupied by the
symbol. Significance levels determined by t tests are
indicated as follows: *, P < 0.05; **,
P < 0.01; and ***, P < 0.001. Similar results were obtained in two repeats of this experiment.
|
|
 |
DISCUSSION |
Few studies have examined the influence of host genetics on immune
responses to vaccination. We knew that one of the consequences of the
influence of Nramp1 on macrophage activation is enhanced induction and long-term maintenance of a T-helper-1 response in congenic Nramp1 wild-type versus mutant mice following both
L. donovani (20) and Mycobacterium
bovis (24) infections. Hence, we hypothesized that
recombinant Ag delivered to the immune system by using salmonella or
M. bovis BCG as a vaccine vehicle might also elicit enhanced
T-helper-1 responses in Nramp1 wild-type mice. Such
differences in vivo may reflect the influence of Nramp1 on
upregulation of MHC class II molecule expression (21, 46), as well as the enhanced ability of Nramp1 wild-type
macrophages to process and present protein epitopes to CD4 T cells
(26). Alternatively, when virulent organisms like L. donovani and M. bovis are used, there are also large
Nramp1-regulated differences in parasite load which might
influence subsequent induction of T-cell responses in vivo. It is well
known, for example, that high Ag load is associated with a suppressed
T-helper-1 response (8). In a recent study Pie and
colleagues (29) specifically examined the role of IL-10 in
inhibiting IFN-
responses during the first 5 days after S. typhimurium C5 infection. IL-10 mRNA expression and serum IL-10
levels were high in Nramp1 mutant compared to congenic
wild-type mice. However, the use of neutralizing anti-IL-10 and
attenuated S. typhimurium strains demonstrated that the
level of IL-10 expression correlated with bacterial load and was
secondary to, rather than functionally related to, the action of the
Nramp1 gene. In contrast, our studies using attenuated
S. typhimurium aroA aroD mutant strains have demonstrated a
dramatic polarization of T-cell responses in Nramp1 congenic
mouse strains in the presence of equivalent bacterial loads. Congenic
mice carrying the wild-type Nramp1 allele mounted a
predominantly T-helper-1 (IL-2 and IFN-
) response to recombinant
TetC synthesized by the salmonellae, as well as more generally to
salmonella Ag. On the other hand, Nramp1 mutant mice mounted
a T-helper-2 (IgE and IL-4) response. Hence, in contrast to the results
of the study by Pie et al. (29), it seems likely that
differences in the abilities of Nramp1 wild-type and mutant
macrophages to process and present Ag are directly and functionally
responsible for polarization of the T-cell response in this vaccine
model.
Many previous studies (21, 26, 46) have demonstrated that
IFN-
induces differences in MHC class II molecule expression in
macrophages carrying wild-type and mutant Nramp1 alleles. In the early phases of salmonella infection, bacterial LPS provides a
potent trigger for macrophage IL-12 production, which in turn triggers
IFN-
release from natural killer cells. Hence, even in the early
postvaccination phase there is likely to be a source of endogenously
produced IFN-
inducing MHC class II molecule expression. Indeed, we
observed a small burst of IFN-
at weeks 1 and 2 postvaccination in
unstimulated spleen cells, which may have resulted from natural killer
cell activity driven by endogenous salmonellae. However, there were no
differences in TetC-induced IFN-
production by spleen cells from
Nramp1 wild-type and mutant mice at this time. The recall
memory T-cell response to TetC and salmonella Ag was not evident until
week 5 postvaccination, and it was then that differences between
Nramp1 congenic mouse strains became apparent.
In a recent study (26) using Nramp1-transfected
macrophage clones, it was observed that LPS can also induce enhanced
processing of recombinant protein Ag in transfectants bearing wild-type
Nramp1 compared to that in transfected and parental
macrophages bearing the Nramp1 mutant allele. In the vaccine
model described here, where recombinant Ag is synthesized by live
attenuated salmonella, this LPS-dependent enhanced Ag processing may be
a significant component of the enhanced T-helper-1 response observed in
Nramp1 wild-type mice. The environment in which Ag
presentation occurs might also be important in determining whether the
CD4 T-cell response biases towards T-helper-1 or T-helper-2 responses.
Nramp1 wild-type macrophages stimulated with LPS also show
enhanced TNF-
release (13, 32) and IL-1
expression
(34), factors which bias towards stimulation of a T-helper-1
response. Hence, the vaccine vehicle itself might be important in
determining the bias of the CD4 T-cell response.
The influence of Nramp1 on Ag processing and presentation
may be directly related to its localization and function. The
Nramp1 gene was identified by positional cloning
(42), and the full-length cDNA sequence was obtained
(3). Computer-assisted analysis of the deduced amino acid
sequence shows that Nramp1 encodes a 53-kDa protein with
homology to bacterial and lower-eukaryotic membrane-bound transporter
proteins (42). Further structural analysis (9)
suggests that it functions as an ion channel/transporter. Confocal and
electron microscope studies demonstrate that Nramp1 localizes to the
late endosomal/lysosomal compartment and can be seen around the
leishmanial parasitophorous vacuole (2, 35a). This vacuole
also contains MHC class II molecules without the invariant chain Ii
(25), i.e., ready for loading with processed foreign Ag
epitopes. Class II molecules generally accumulate in a specialized
endosomal compartment, referred to as the MHC class II compartment or
the compartment for peptide loading, during their transport from the
trans-Golgi network to the cell surface. In this compartment, foreign
peptides acquired through the endocytic or phagocytic pathways displace
self-peptides on class II molecules and are thus transported to the
cell surface for presentation to CD4+ T cells. Salmonella
also occupies a similar acidified receptor-mediated phagocytic
compartment (1). Processing of salmonella-derived Ag may
thus be directly affected by Nramp1 function. One hypothesis (26) is that Nramp1 regulates ion uptake to the late
endosome, where Ag processing occurs, perhaps influencing ion-dependent peptidase activity. In yeast, the homologous SMF1 protein has been
shown to play a role in manganese uptake to the cell (38). The SMF1 gene was first identified for its ability to complement a
defect in protein import into the mitochondria (43). Its
ability to complement this function was due to the mangenese-dependent peptidase activity required to cleave proteins being imported into the
mitochondria (38). The mammalian homolog Nramp2 has now also
been shown to be a metal ion channel (14), transporting a
wide variety of metal ions, including Fe2+,
Zn2+, Mn2+, Cu2+, Co2+,
and Cd2+, with equivalent efficiencies and by a
pH-dependent electrogenic process. Nramp1 could play a parallel role in
providing an essential ion for peptidase activity required for Ag
processing or in regulating peptidase activity by controlling pH in the
late endosomal compartment. Whatever its role, pinpointing the
processing defect in Nramp1 mutant macrophages has important
implications for further analysis of genetic regulation of response to
vaccination, particularly for recombinant vaccines delivered by using
viable salmonella or BCG.
As a corollary of the polarization of the CD4 T-cell response, we
hypothesised that mice bearing Nramp1 wild-type allele and mutant mice would behave differently following vaccination and challenge infection with an organism for which protective immunity is T
helper 1 dependent. We decided to test this hypothesis using the
L. major infection model (15, 35), in which
T-helper-1 responses are vital to development of a protective immune
response while T-helper-2 responses are associated with exacerbated
disease. We demonstrated that Nramp1 wild-type mice showed
enhanced protection against challenge infection following immunization
with a gp63 salmonella vaccine, while Nramp1 mutant mice
show exacerbated disease. Although these experiments were carried out
with congenic mice with a genetic background (B10) where self-healing
L. major infection occurs, we were able to demonstrate
significant alterations in the rates of healing in vaccinated
Nramp1 wild-type and mutant mice. A more rigorous test for
recombinant leishmanial Ag vaccines would be to test their efficacies
in a BALB/c genetic background where a polarized T-helper-2 response to
L. major infection (under separate genetic control from
Nramp1) leads to extreme susceptibility (15, 35).
Previous studies have shown (12) that Nramp1
mutant BALB/c mice produce significantly higher titers of total serum Ab against salmonella-carried recombinant E. coli MalE
protein than do their congenic wild-type C.D2
[Idh1bPep3b-(N7)F12] and C.CB
[Ityr(N9)F5] counterparts, but subclass
differences and T-cell responses were not examined. Whether the
enhanced protective T-helper-1 response we have observed here in
Nramp1 wild-type mice is sufficient to mediate strong
protection in an L. major-susceptible BALB genetic background is the subject of our continuing research. We are also examining whether recombinant Ag delivered to Nramp1
congenic mice via DNA vaccines engineered for endogenous versus
secretory protein trafficking pathways also elicit polarized CD4 T-cell responses. Such studies should allow us to determine the importance of
Nramp1 in regulating the Ag-presenting-cell environment in response to the adjuvant activity of the salmonella vehicle, as opposed
to a more direct role in regulating Ag processing, in determining
T-cell subset expansion. In either case, it is clear that the mutation
in murine Nramp1 has a major impact on response to
vaccination, supporting the concept that host genetic variation may be
an important factor in determining vaccine efficacy.
 |
ACKNOWLEDGMENTS |
This work was funded by The Wellcome Trust.
We thank Sandra Toole for her technical assistance during this project
and Raquel Demarco De Hormaeche for helpful advice on Ab and cytokine
assays.
 |
FOOTNOTES |
*
Corresponding author. Mailing address: Department of
Medicine, University of Cambridge Clinical School, Level 5, Addenbrooke's Hospital, Cambridge CB2 2QQ, United Kingdom. Phone:
01223 336947. Fax: 01223 336846. E-mail: JMB37{at}CUS.CAM.AC.UK.
Editor: S. H. E. Kaufmann
 |
REFERENCES |
| 1.
|
Alpuche-Aranda, C. M.,
E. L. Racoosin,
J. A. Swanson, and S. I. Miller.
1994.
Salmonella stimulate macrophage macropinocytosis and persist within spacious phagosomes.
J. Exp. Med.
179:601-608[Abstract/Free Full Text].
|
| 2.
|
Atkinson, P. G. P.,
J. M. Blackwell, and C. H. Barton.
1997.
The Nramp1 locus encodes 65kD IFN -inducible protein in murine macrophages.
Biochem. J.
325:779-786.
|
| 3.
|
Barton, C. H.,
J. K. White,
T. I. A. Roach, and J. M. Blackwell.
1994.
NH2-terminal sequence of macrophage-expressed natural resistance-associated macrophage protein (Nramp) encodes a proline/serine-rich putative Src homology 3-binding domain.
J. Exp. Med.
179:1683-1687[Abstract/Free Full Text].
|
| 4.
|
Blackwell, J. M.
1996.
Structure and function of the natural-resistance-associated macrophage protein (Nramp1), a candidate protein for infectious and autoimmune disease susceptibility.
Mol. Med. Today
2:205-211.
[Medline] |
| 5.
|
Blackwell, J. M., and J. Alexander.
1986.
Different host genes recognise and control infection with taxonomically distinct Leishmania species, p. 211-219.
In
J. A. Rioux, and W. Peters (ed.), Leishmania. Taxonomie et phylogenèse. Applications éco-épidémiologiques. IMEEE, Montpellier, France.
|
| 6.
|
Blackwell, J. M.,
C. H. Barton,
J. K. White,
T. I. A. Roach,
M.-A. Shaw,
S. H. Whitehead,
B. A. Mock,
S. Searle,
H. Williams, and A.-M. Baker.
1994.
Genetic regulation of leishmanial and mycobacterial infections: the Lsh/Ity/Bcg gene story continues.
Immunol. Lett.
43:99-107[Medline].
|
| 7.
|
Blackwell, J. M.,
S. Toole,
M. King,
P. Dawda,
T. I. Roach, and A. Cooper.
1988.
Analysis of Lsh gene expression in congenic B10.L-Lshr mice.
Curr. Top. Microbiol. Immunol.
137:301-309[Medline].
|
| 8.
|
Bretscher, P. A.,
G. Wei,
J. N. Menon, and H. Bielefeldt-Ohmann.
1992.
Establishment of stable, cell-mediated immunity that makes "susceptible" mice resistant to Leishmania major.
Science
257:539-542[Abstract/Free Full Text].
|
| 9.
|
Cellier, M.,
A. Belouchi, and P. Gros.
1996.
Resistance to intracellular infections: comparative genomic analysis of Nramp.
Trends Genet.
12:201-204[Medline].
|
| 10.
|
Chatfield, S. N.,
I. G. Charles,
A. J. Makoff,
M. D. Oxer,
G. Dougan,
D. Pickard,
D. Slater, and N. F. Fairweather.
1992.
Use of the nirB promoter to direct the stable expression of heterologous antigens in Salmonella oral vaccine strains: development of a single-dose oral tetanus vaccine.
Biotechnol. N. Y.
10:888-892.
|
| 11.
|
Doull, I. J. M.,
S. Lawrence,
M. Watson,
T. Begishvili,
R. W. Beasley,
F. Lampe,
S. T. Holgate, and N. E. Morton.
1996.
Allelic association of gene markers on chromosomes 5q and 11q with atopy and bronchial hyperresponsiveness.
Am. J. Respir. Crit. Care Med.
153:1280-1284[Abstract].
|
| 12.
|
Fayolle, C.,
D. O'Callaghan,
P. Martineau,
A. Charbit,
J. M. Clément,
M. Hofnung, and C. Leclerc.
1994.
Genetic control of antibody responses induced against an antigen delivered by recombinant attenuated Salmonella typhimurium.
Infect. Immun.
62:4310-4319[Abstract/Free Full Text].
|
| 13.
|
Formica, S.,
T. I. A. Roach, and J. M. Blackwell.
1994.
Interaction with extracellular matrix proteins influences Lsh/Ity/Bcg (candidate Nramp) gene regulation of macrophage priming/activation for tumour necrosis factor and nitrite release.
Immunology
82:42-50[Medline].
|
| 14.
|
Gunshin, H.,
B. Mackenzie,
U. V. Berger,
Y. Gunshin,
M. F. Romero,
W. F. Boron,
S. Nussberger,
J. L. Gollan, and M. A. Hediger.
1997.
Cloning and characterization of a mammalian proton-coupled metal-ion transporter.
Nature
388:482-488[Medline].
|
| 15.
|
Heinzel, F. P.,
M. D. Sadick,
B. J. Holaday,
R. L. Coffman, and R. M. Locksley.
1989.
Reciprocal expression of interferon gamma or interleukin 4 during the resolution or progression of murine leishmaniasis. Evidence for expansion of distinct helper T cell subsets.
J. Exp. Med.
169:59-72[Abstract/Free Full Text].
|
| 16.
|
Hone, D. M.,
A. M. Harris,
S. Chatfield,
G. Dougan, and M. M. Levine.
1991.
Construction of genetically defined double aro mutants of Salmonella typhi.
Vaccine
9:810-816[Medline].
|
| 17.
|
Hormaeche, C. E.
1979.
Natural resistance to Salmonella typhimurium in different inbred mouse strains.
Immunology
37:311-318[Medline].
|
| 18.
|
Hormaeche, C. E.
1991.
Live attenuated Salmonella vaccines and their potential as oral combined vaccines carrying heterologous antigens.
J. Immunol. Methods
142:113-120[Medline].
|
| 19.
|
Howard, J. G.,
C. Hale, and W. L. Chan-Liew.
1980.
Immunological regulation of experimental cutaneous leishmaniasis. I. Immunogenetic aspects of susceptibility to Leishmania tropica in mice.
Parasite Immunol.
2:303-314[Medline].
|
| 20.
|
Kaye, P. M., and J. M. Blackwell.
1989.
Lsh, antigen presentation and the development of CMI.
Res. Immunol.
140:810-815[Medline].
|
| 21.
|
Kaye, P. M.,
N. K. Patel, and J. M. Blackwell.
1988.
Acquisition of cell-mediated immunity to Leishmania. II. Lsh gene regulation of accessory cell function.
Immunology
65:17-22[Medline].
|
| 22.
|
Khan, C. M. A.,
B. Villarreal Ramos,
R. J. Pierce,
R. Demarco de Hormaeche,
H. McNeill,
T. Ali,
S. Chatfield,
A. Capron,
G. Dougan, and C. E. Hormaeche.
1994.
Construction, expression and immunogenicity of multiple tandem copies of the Schistosoma mansoni peptide 115-131 of the P28 glutathione S-transferase expressed as C-terminal fusions to tetanus toxin fragment C in a live aro-attenuated vaccine of Salmonella.
J. Immunol.
153:5634-5642[Abstract].
|
| 23.
|
Khan, C. M. A.,
B. Villarreal Ramos,
R. J. Pierce,
G. Riveau,
R. Demarco de Hormaeche,
H. McNeill,
T. Ali,
N. Fairweather,
S. Chatfield,
A. Capron, et al.
1994.
Construction, expression and immunogenicity of the Schistosoma mansoni P28 glutathione S-transferase as a genetic fusion to tetanus toxin fragment C in a live Aro attenuated vaccine strain of Salmonella.
Proc. Natl. Acad. Sci. USA
91:11261-11265[Abstract/Free Full Text].
|
| 24.
|
Kramnik, I.,
D. Radzioch, and E. Skamene.
1994.
T-helper 1-like subset selection in Mycobacterium bovis bacillus Calmette-Guérin-infected resistant and susceptible mice.
Immunology
81:618-625[Medline].
|
| 25.
|
Lang, T.,
R. Hellio,
P. M. Kaye, and J. Antoine.
1994.
Leishmania donovani-infected macrophages: characterization of the parasitophorous vacuole and potential role of this organelle in antigen presentation.
J. Cell Sci.
107:2137-2150[Abstract].
|
| 26.
|
Lang, T.,
E. Prina,
D. Sibthorpe, and J. M. Blackwell.
1997.
Nramp1 transfection transfers Ity/Lsh/Bcg-related pleiotropic effects on macrophage activation: influence on antigen processing and presentation.
Infect. Immun.
65:380-386[Abstract].
|
| 27.
|
Marsh, D. G.,
J. D. Neely,
D. R. Breazeale,
B. Ghosh,
L. R. Friedhoff,
E. Ehrlich-Kautzky,
C. Schou,
G. Krishnaswamy, and T. H. Beaty.
1994.
Linkage analysis of IL4 and other chromosome 5q31.1 markers and total serum immunoglobulin E concentrations.
Science
264:1152-1156[Abstract/Free Full Text].
|
| 28.
|
Mishell, B. B., and S. M. Shiigi.
1980.
In
Selected methods in cellular immunology, p. 23-24.
W. H. Freeman and Company, San Francisco, Calif.
|
| 29.
|
Pie, S.,
P. Matsiota-Bernard,
P. Truffa-Bachi, and C. Nauciel.
1996.
Gamma interferon and interleukin-10 gene expression in innately susceptible and resistant mice during the early phase of Salmonella typhimurium infection.
Infect. Immun.
64:849-854[Abstract].
|
| 30.
|
Plant, J., and A. A. Glynn.
1976.
Genetics of resistance to infection with Salmonella typhimurium in mice.
J. Infect. Dis.
133:72-78[Medline].
|
| 31.
|
Poirier, T. P.,
M. A. Kehoe, and E. H. Beachey.
1988.
Protective immunity evoked by oral administration of attenuated aroA Salmonella typhimurium expressing cloned streptococcal M protein.
J. Exp. Med.
168:25-32[Abstract/Free Full Text].
|
| 32.
|
Roach, T. I. A.,
A. F. Kiderlen, and J. M. Blackwell.
1991.
Role of inorganic nitrogen oxides and tumor necrosis factor alpha in killing Leishmania donovani amastigotes in gamma interferon-lipopolysaccharide-activated macrophages from Lshs and Lshr congenic mouse strains.
Infect. Immun.
59:3935-3944[Abstract/Free Full Text].
|
| 33.
|
Sadoff, J. C.,
W. R. Ballou,
L. S. Baron,
W. R. Majarian,
R. N. Brey,
W. T. Hockmeyer,
J. F. Young,
S. J. Cryz,
J. Ou,
G. H. Lowell, et al.
1988.
Oral Salmonella typhimurium vaccine expressing circumsporozoite protein protects against malaria.
Science
240:336-338[Abstract/Free Full Text].
|
| 34.
|
Schurr, E.,
D. Radzioch,
D. Malo,
P. Gros, and E. Skamene.
1991.
Molecular genetics of inherited susceptibility to intracellular parasites.
Behring Inst. Mitt.
88:1-12.
|
| 35.
|
Scott, P.,
P. Natovitz,
R. L. Coffman,
E. Pearce, and A. Sher.
1988.
Immunoregulation of cutaneous leishmaniasis. T cell lines that transfer protective immunity or exacerbation belong to different T helper subsets and respond to distinct parasite antigens.
J. Exp. Med.
168:1675-1684[Abstract/Free Full Text].
|
| 35a.
| Searle, S., N. Bright, P. Atkinson, C. H. Barton,
and J. M. Blackwell. Submitted for publication.
|
| 36.
|
Sjostedt, A.,
G. Sandstrom, and A. Tarnvik.
1990.
Immunization of mice with an attenuated Salmonella typhimurium strain expressing a membrane protein of Francisella tularensis. A model for identification of bacterial determinants relevant to the host defence against tularemia.
Res. Microbiol.
141:887-891[Medline].
|
| 37.
|
Skamene, E.
1994.
The Bcg gene story.
Immunobiology
191:451-460[Medline].
|
| 38.
|
Supeck, F.,
L. Supekova,
H. Nelson, and N. Nelson.
1996.
A yeast manganese transporter related to the macrophage protein involved in conferring resistance to mycobacteria.
Proc. Natl. Acad. Sci. USA
93:5105-5110[Abstract/Free Full Text].
|
| 39.
|
Tacket, C. O.,
D. M. Hone,
G. A. Losonsky,
L. Guers,
R. Edelman, and M. M. Levine.
1992.
Clinical acceptability and immunogenicity of CVD 908 Salmonella typhi vaccine strain.
Vaccine
10:443-446[Medline].
|
| 40.
|
Tite, J. P.,
X. M. Gao,
C. M. Hughes Jenkins,
M. Lipscombe,
D. O'Callaghan,
G. Dougan, and F. Y. Liew.
1990.
Anti-viral immunity induced by recombinant nucleoprotein of influenza A virus. III. Delivery of recombinant nucleoprotein to the immune system using attenuated Salmonella typhimurium as a live carrier.
Immunology
70:540-546[Medline].
|
| 41.
|
Vidal, S.,
M. L. Tremblay,
G. Govoni,
S. Gauthier,
G. Sebastiani,
D. Malo,
E. Skamene,
M. Olivier,
S. Jothy, and P. Gros.
1995.
The Ity/Lsh/Bcg locus: natural resistance to infection with intracellular parasites is abrogated by disruption of the Nramp1 gene.
J. Exp. Med.
182:655-666[Abstract/Free Full Text].
|
| 42.
|
Vidal, S. M.,
D. Malo,
K. Vogan,
E. Skamene, and P. Gros.
1993.
Natural resistance to infection with intracellular parasites: isolation of a candidate for Bcg.
Cell
73:469-485[Medline].
|
| 43.
|
West, A. H.,
D. J. Clark,
J. Martin,
W. Neupert,
F. U. Hartl, and A. L. Horwich.
1992.
Two related genes encoding extremely hydrophobic proteins suppress a lethal mutation in the yeast mitochondrial processing enhancing protein.
J. Biol. Chem.
267:24625-24633[Abstract/Free Full Text].
|
| 44.
|
Xu, D.,
S. J. McSorley,
S. N. Chatfield,
G. Dougan, and F. Y. Liew.
1995.
Protection against Leishmania major infection in genetically susceptible BALB/c mice by gp63 delivered orally in attenuated Salmonella typhimurium (AroA AroD ).
Immunology
85:1-7[Medline].
|
| 45.
|
Yang, D. M.,
N. Fairweather,
L. L. Button,
W. R. McMaster,
L. P. Kahl, and F. Y. Liew.
1990.
Oral Salmonella typhimurium (AroA ) vaccine expressing a major leishmanial surface protein (gp63) preferentially induces T helper 1 cells and protective immunity against leishmaniasis.
J. Immunol.
145:2281-2285[Abstract].
|
| 46.
|
Zwilling, B. S.,
L. Vespa, and M. Massie.
1987.
Regulation of I-A expression by murine peritoneal macrophages: differences linked to the Bcg gene.
J. Immunol.
138:1372-1376[Abstract].
|
Infect Immun, May 1998, p. 1910-1917, Vol. 66, No. 5
0019-9567/98/$04.00+0
Copyright © 1998, American Society for Microbiology. All rights reserved.
This article has been cited by other articles:
-
Jiang, H.-R., Gilchrist, D. S., Popoff, J.-F., Jamieson, S. E., Truscott, M., White, J. K., Blackwell, J. M.
(2009). Influence of Slc11a1 (formerly Nramp1) on DSS-induced colitis in mice. J. Leukoc. Biol.
85: 703-710
[Abstract]
[Full Text]
-
Stober, C. B., Brode, S., White, J. K., Popoff, J.-F., Blackwell, J. M.
(2007). Slc11a1, Formerly Nramp1, Is Expressed in Dendritic Cells and Influences Major Histocompatibility Complex Class II Expression and Antigen-Presenting Cell Function. Infect. Immun.
75: 5059-5067
[Abstract]
[Full Text]
-
Chen, A. Y., Fry, S. R., Forbes-Faulkner, J., Daggard, G., Mukkur, T. K. S.
(2006). Evaluation of the immunogenicity of the P97R1 adhesin of Mycoplasma hyopneumoniae as a mucosal vaccine in mice.. J Med Microbiol
55: 923-929
[Abstract]
[Full Text]
-
Caron, J., Lariviere, L., Nacache, M., Tam, M., Stevenson, M. M., McKerly, C., Gros, P., Malo, D.
(2006). Influence of Slc11a1 on the Outcome of Salmonella enterica Serovar Enteritidis Infection in Mice Is Associated with Th Polarization.. Infect. Immun.
74: 2787-2802
[Abstract]
[Full Text]
-
White, J. K., Mastroeni, P., Popoff, J.-F., Evans, C. A. W., Blackwell, J. M.
(2005). Slc11a1-mediated resistance to Salmonella enterica serovar Typhimurium and Leishmania donovani infections does not require functional inducible nitric oxide synthase or phagocyte oxidase activity. J. Leukoc. Biol.
77: 311-320
[Abstract]
[Full Text]
-
Smit, J. J., Van Loveren, H., Hoekstra, M. O., Karimi, K., Folkerts, G., Nijkamp, F. P.
(2003). The Slc11a1 (Nramp1) Gene Controls Efficacy of Mycobacterial Treatment of Allergic Asthma. J. Immunol.
171: 754-760
[Abstract]
[Full Text]
-
Vindurampulle, C. J., Attridge, S. R.
(2003). Vector Priming Reduces the Immunogenicity of Salmonella-Based Vaccines in Nramp1+/+ Mice. Infect. Immun.
71: 2258-2261
[Abstract]
[Full Text]
-
Guilloteau, L. A., Dornand, J., Gross, A., Olivier, M., Cortade, F., Vern, Y. L., Kerboeuf, D.
(2003). Nramp1 Is Not a Major Determinant in the Control of Brucella melitensis Infection in Mice. Infect. Immun.
71: 621-628
[Abstract]
[Full Text]
-
He, Y., Vemulapalli, R., Schurig, G. G.
(2002). Recombinant Ochrobactrum anthropi Expressing Brucella abortus Cu,Zn Superoxide Dismutase Protects Mice against B. abortus Infection Only after Switching of Immune Responses to Th1 Type. Infect. Immun.
70: 2535-2543
[Abstract]
[Full Text]
-
Hernychova, L., Hajduch, M.
(2000). Influence of the Bcg Locus on Natural Resistance to Primary Infection with the Facultative Intracellular Bacterium Francisella tularensis in Mice. Infect. Immun.
68: 1480-1484
[Abstract]
[Full Text]
-
Wright, A. D., Chapes, S. K.
(1999). LPS sensitivity in recombinant mice lacking functional alleles at MHCII, Lps and Nramp1 genes. Innate Immunity
5: 297-305
[Abstract]