Previous Article | Next Article 
Infect Immun, May 1998, p. 2356-2361, Vol. 66, No. 5
0019-9567/98/$04.00+0
Copyright © 1998, American Society for Microbiology. All rights reserved.
Immunohistological Localization of the MrkD Adhesin
in the Type 3 Fimbriae of Klebsiella pneumoniae
Ann-Mari
Tarkkanen,
Benita
Westerlund-Wikström,*
Leena
Erkkilä, and
Timo K.
Korhonen
Division of General Microbiology, Department
of Biosciences, FIN-00014 University of Helsinki, Finland
Received 26 September 1997/Returned for modification 21 November
1997/Accepted 4 February 1998
 |
ABSTRACT |
The adhesive minor protein MrkD of the type 3 fimbria of
Klebsiella pneumoniae was expressed and purified from
Escherichia coli as a fusion protein with an N-terminal
polyhistidine tail. Polyclonal antibodies raised against MrkD
specifically recognized the MrkD peptide in Western blots of fimbrial
preparations. Immunoelectron microscopic analyses showed that the
anti-MrkD immunoglobulins bound to the tip of the plasmid-encoded
variant of the type 3 fimbria of K. pneumoniae, whereas no
binding to the chromosomally encoded MrkD-deficient type 3 fimbrial
variant of K. pneumoniae was detected. Immunoglobulins from
an antiserum raised against purified type 3 fimbrial filaments bound
laterally to both type 3 fimbrial variants. The anti-MrkD antibodies
also bound to the tip of a papG deletion derivative of the
E. coli P fimbria complemented with mrkD,
indicating that MrkD structurally complements a PapG mutation in the P
fimbria of E. coli.
 |
TEXT |
Type 3 fimbriae are expressed by
most Klebsiella isolates associated with human urinary or
respiratory tract infections (9, 17, 23). Klebsiella
pneumoniae and Klebsiella oxytoca are opportunistic
pathogens that cause complicated urinary tract infections in the
elderly or in compromised hosts who have predisposing factors such as
urinary catheters or primary infections caused by other microorganisms
(17, 24). Klebsiella infections often occur in
hospitalized patients and frequently lead to sepsis, as well as to
chronic or recurrent urinary tract infections, and many Klebsiella isolates are resistant to a variety of
antibiotics.
Type 3 fimbriae were originally characterized by their ability to
hemagglutinate tannin-treated erythrocytes (3). At least six
mrk genes are needed for the synthesis of the type 3 fimbrial filament; of these, the mrkA gene encodes the major
fimbrillin and mrkD encodes the hemagglutinin (4, 6,
7). Recent evidence has shown that Klebsiella type 3 fimbriae occur in at least two variants, a plasmid-encoded one and a
chromosomally encoded one (9, 21). The variants were first
described in K. pneumoniae IA565 (9) and
differ in that the chromosomally encoded variant lacks hemagglutination
capacity, as well as the mrkD gene. The mrkD gene
is present in the plasmid-borne mrk gene cluster and
responsible for hemagglutination capacity (7, 9). Cloned
mrkD complements the mrkD-deficient chromosomally
encoded variant and restores the adhesive properties of the fimbriae
(9). We have presented evidence that the MrkD adhesin of the
plasmid-borne variant binds to type V collagen in basolateral aspects
of renal tubuli, as well as in vessel walls (22). Such
adhesiveness may increase the infectivity of klebsiellas at damaged
tissue sites, e.g., in a catheterized urinary tract (17) or
damaged regions in the lung (8, 10).
The plasmid-borne mrk gene cluster is similar in genetic
organization to the pap gene cluster encoding the
globoside-binding P (or Pap) fimbriae of uropathogenic
Escherichia coli (reviewed in reference
11). The P fimbriae are the most important single virulence factor of pyelonephritis-associated E. coli
(for a review, see reference 17). Both gene
clusters contain genes for the major fimbrillin and the minor
adhesin, as well as for a periplasmic chaperone and an outer membrane
usher protein anchoring the fimbriae to the bacterial cell wall. The
adhesive property of P fimbriae is carried on a tip-associated
fibrillum that is composed of PapE, PapF, PapK, and the adhesive
molecule PapG (16). It is not clear how well the structure
of P fimbria serves as a model for other fimbrial filaments of
gram-negative bacteria. Indeed, the mannose-binding FimH adhesin of the
type 1 fimbria of E. coli has been detected as
occurring laterally at intervals along the fimbrial filament in studies
utilizing immunoelectron microscopy with a mannose-coupled carrier
protein or antibodies specific for FimH (1, 15). On the
other hand, a tip fibrillum highly similar to that described for P
fimbriae has also been reported for the type 1 fimbria of E. coli (12).
As a step towards understanding the mechanism of adhesion displayed by
the MrkD adhesin, we expressed and purified MrkD containing an
N-terminal histidine tail. We used antibodies against purified MrkD in
immunoelectron microscopy to locate the adhesin in the type 3 fimbrial
filament of a recombinant E. coli and a wild-type K. pneumoniae strain. Gerlach et al. (7)
have previously demonstrated that mrkD can complement a
papG mutation to produce P fimbriae with an MrkD-specific
binding function. We also demonstrate here that this complementation
results in correct tip localization of MrkD in the P-fimbrial filament.
Bacterial strains and proteins.
For expression of cloned
fimbrial genes, nonfimbriate E. coli LE392
(20) was used as the host strain. Plasmid pFK12
(4), containing the plasmid-borne mrk gene
cluster of K. pneumoniae, was used for the expression
of wild-type type 3 fimbriae. For expression of PapG-deficient P
fimbriae, plasmid pDC17 (7), carrying a
papG-deficient pap gene cluster, was used; the
papG deletion in pDC17 was complemented in trans
by plasmid pFK52 (7), which consists of the
mrkD gene in plasmid pACYC184. The type 1 fimbriae of
K. pneumoniae IA565 were expressed in E. coli LE392 by using plasmid pGG101 (5) carrying the
fim gene cluster. For expression of wild-type type 3 fimbriae, K. pneumoniae IA565 (4), carrying
a fim gene cluster, as well as an mrkD-deficient mrk gene cluster on the chromosome and a plasmid-borne
mrkD-containing mrk gene cluster, was used.
The bacteria were grown for 18 h at 37°C on Luria
agar supplemented with ampicillin (75 µg/ml) or chloramphenicol (25 µg/ml), as appropriate. K. pneumoniae IApc35 (9), carrying the fim gene cluster, as well
as an mrkD-deficient mrk gene cluster on the
chromosome, was cultured on glycerol-Casamino Acids agar (8,
10) for 18 h at 37°C. Purified fimbriae of E. coli HB101(pFK12), HB101(pDC17),
HB101(pFK52/pDC17), and HB101(pGG101) were available from
previous work (22, 23). K. pneumoniae IApc35
fimbriae were purified by using deoxycholate and concentrated urea as
described before (13). Rabbit antibodies against purified type 3 fimbriae were available from previous work (14).
Peptide synthesis and immunization.
To have a tool
for identification of MrkD in recombinant E. coli, we first raised an antipeptide serum that was specific for MrkD. Using solid-phase peptide synthesis on RapidAmide resin (Du Pont
de Nemours, Dreieich, Germany) and 9-fluorenylmethyloxycarbonyl amino
acid chemistry, we manually synthesized an 11-mer peptide corresponding
to the predicted, potentially antigenic sequence 54-TLKSDAKVVA-63 of
the mature MrkD protein (7) and added an extra
cysteine at the C terminus for subsequent immunization. The
full-length peptide was detached from the resin and purified by
reverse-phase chromatography on a preparative PepRPC HR10/10 column
(Pharmacia, Uppsala, Sweden) using an increasing gradient (0 to 0.1%
[vol/vol]) of trifluoroacetic acid in acetonitrile as the eluent, and
the homogeneity of the peptide was verified by amino acid sequencing in
a gas-pulsed liquid-phase sequencer. The side chain of the C-terminal
cysteine was reduced to thiol form, the deprotected peptide was coupled
to the
m-maleimidobenzoyl-N-hydroxysuccinimide-activated carrier protein keyhole limpet hemocyanin, and after desalting, the
complex was used as an immunogen in rabbits in accordance with standard
procedures (2). The anti-MrkD-antibody reacted in a Western
blot with the denatured MrkD present in the type 3 fimbrial preparation
(Fig. 1A). The specificity of the
antibodies for the 34-kDa MrkD peptide was shown by their lack of
binding to the 20.5-kDa MrkA peptide (lane 1 of Fig. 1A) that was
strongly stained by the anti-type 3 fimbria antibodies (lane 4 of Fig. 1A). The antipeptide antibodies also detected MrkD in the purified LE392(pFK52/pDC17) fimbrial preparation, whereas the fimbriae of
LE392(pDC17) did not react with the antibodies (lanes 2 and 3 in Fig.
1A, respectively). This indicates that MrkD forms an integral part of
the PapG-deficient hybrid P fimbria purified from recombinant strain
LE392(pFK52/pDC17). It was concluded that the antipeptide serum was
specific enough to be used in the detection of MrkD expression in
E. coli.

View larger version (29K):
[in this window]
[in a new window]
|
FIG. 1.
Immunoblotting of purified fimbriae and MrkD with
antipeptide and antifimbria antibodies. (A) Reactivity of the fimbriae
from E. coli LE392(pFK12) (lanes 1 and 4),
LE392(pFK52/pDC17) (lanes 2 and 5), and LE392(pDC17) (lanes 3 and 6)
with the anti-MrkD peptide (lanes 1 to 3) and anti-type 3 fimbria
(lanes 4 to 6) antibodies. (B) Lane 1, SDS-PAGE analysis of purified
MrkD; lane 2, Western blot of MrkD with the antipeptide antibodies. The
arrowheads indicate the migration distance of MrkD. The values to the
left of each panel are molecular sizes in kilodaltons.
|
|
Expression and purification of recombinant MrkD protein.
The
anti-MrkD peptide antibody did not react with MrkD in immunoelectron
microscopy or immunofluorescence assays with type 3 fimbrial filaments
(data not shown). Therefore, we next expressed and purified a
recombinant MrkD protein carrying an N-terminal polyhistidine tail. It
was constructed by PCR cloning a 912-bp DNA fragment encoding mature
MrkD into plasmid pQE30 (Qiagen). Plasmid pFK12 (4) was used
as the template, oligonucleotides 5'CGCGGATCCTGGGCATCATGTTGGCAATC and
5'GGAAGCTTTTAATCGTACGTCAGGTTAAAG were used as primers,
and the reading frames of both the polyhistidine-encoding sequence of pQE30 and the mrkD fragment were retained. After
transformation into E. coli XL1-Blue MRF' (Stratagene),
a clone that produced large amounts of MrkD was identified by Western
blotting with the antipeptide serum and named E. coli
XL1-Blue(mrkD/pQE30). In a larger-scale purification of
recombinant MrkD, late-log-phase bacteria were induced with 1 mM
isopropyl-
-D-thiogalactopyranoside (IPTG) and cultured
for an additional 5 h. The recombinant MrkD protein carried an
N-terminal polyhistidine tail that efficiently binds to nickel ions and
was purified from inclusion bodies of urea-treated cells by affinity
chromatography on nickel-nitrilotriacetic acid resin (Qiagen). To wash
out unbound or only loosely bound proteins, the column was washed with
8 M urea in 10 mM Tris-phosphate buffer in a decreasing pH
gradient (pH 8.0 to 6.3) until the optical density at 280 nm reached
zero. Column-bound protein was eluted by using 10 mM
Tris-phosphate buffer (pH 5.9) containing 8 M urea and the histidine
analog imidazole at 0.25 M. The fractions containing the 34-kDa MrkD
protein were further purified on a Superose 12 HR10/30 gel filtration
column (Pharmacia), and for renaturation, purified MrkD was dialyzed
stepwise against decreasing concentrations of urea in
phosphate-buffered saline (PBS) and finally against PBS. Sodium dodecyl
sulfate-polyacrylamide gel electrophoresis (SDS-PAGE) analysis of the
MrkD preparation is shown in Fig. 1B. Only one peptide, with an
apparent molecular mass of 34 kDa, which is similar to the calculated
molecular mass of the mrkD gene product, was detected. This
peptide also reacted with the antipeptide antibodies (Fig. 1B),
indicating that it indeed was MrkD.
Specificity of polyclonal anti-MrkD antibodies.
We immunized
rabbits with purified recombinant MrkD in accordance with standard
procedures (13) and assessed the specificity of these
antibodies by Western blotting (Fig. 2).
Purified MrkD (1 µg per lane) and Klebsiella type 1 and 3 fimbriae (25 to 100 µg per lane) were analyzed by SDS-PAGE using a
5% (wt/vol) stacking gel and a 15% separating gel (Fig. 2A).
Polypeptides were transferred to a nitrocellulose membrane (Bio-Rad) by
using a semidry transfer apparatus (Pharmacia). The membranes were
quenched with 2% bovine serum albumin in PBS, and the polypeptides
were visualized by staining with specific primary antibodies (described
below) diluted in 1% bovine serum albumin in PBS and alkaline
phosphatase-conjugated secondary antibodies (Orion Diagnostica,
Espoo, Finland) diluted 1:500. A phosphatase substrate containing
nitroblue tetrazolium (Sigma) and
5-bromo-4-chloro-3-indoly-1-phosphate (Sigma) was used. The anti-MrkD
protein antibodies (diluted 1:400) detected only a peptide with an
apparent molecular mass equivalent to that of the mature MrkD peptide
(34 kDa; lanes 1 and 2 in Fig. 2B) and failed to react with the MrkA
(20.5 kDa) and FimA (apparent size, 18 kDa) peptides (lanes 2 to 4 in
Fig. 2B). Furthermore, the anti-MrkD peptide antibody (diluted 1:100)
did not react with the fimbrial preparation from K. pneumoniae IApc35 (lane 3 in Fig. 2B), which is in accordance with
the reported lack of mrkD in this type 3 fimbria gene
cluster (9, 22). The anti-type 3 fimbria antibodies (diluted
1:500) strongly detected the 20.5-kDa MrkA peptide (lanes 2 and 3 in
Fig. 2C) but only weakly detected the 34-kDa MrkD peptide (lanes 1 and
2 in Fig. 2C). We also tested the reactivity of both antisera with the
type 1 fimbriae of K. pneumoniae purified from
recombinant E. coli LE392(pGG101); neither antiserum
gave a detectable reaction with the Fim peptides (lane 4 in Fig. 2B and
C).

View larger version (19K):
[in this window]
[in a new window]
|
FIG. 2.
Immunoblotting of purified MrkD and fimbriae with
anti-MrkD and anti-type 3 fimbria antibodies. (A) SDS-PAGE of purified
MrkD (lane 1) and fimbriae from E. coli LE392(pFK12)
(lane 2), K. pneumoniae IApc35 (lane 3), and
E. coli LE392(pGG101) (lane 4). The migration distances
of molecular size standard proteins (sizes are in kilodaltons) are
indicated on the left. Immunoblotting of the antigens with anti-MrkD
antibodies is shown in panel B, and immunoblotting with anti-type 3 fimbria serum is shown in panel C. The arrowheads indicate the position
of MrkD, and the arrows indicate that of MrkA.
|
|
Immunoelectron microscopy.
To locate the MrkD protein in the
type 3 fimbrial filament, we used immunoelectron microscopy (Fig.
3 and 4).
Bacterial cells expressing the various fimbriae were immobilized on
copper grids and allowed to react with antibodies against type 3 fimbriae (diluted 1:500) or recombinant MrkD (diluted 1:300) for 90 min
at 20°C. Bound antibodies were visualized with an Auroprobe EM
protein A conjugate diluted 1:50 (Amersham). Bacteria were negatively stained by 1% sodium tungstic acid (NaPT), pH 7.0, for 40 s. The grids were examined in a JEOL JEM-1200EX transmission electron microscope at an operating voltage of 60 kV. The type 3 fimbriae on
E. coli LE392(pFK12) bound anti-type 3 fimbria
antibodies laterally (Fig. 3A), whereas the anti-MrkD antibodies were
detected exclusively at the fimbrial tips (Fig. 3B). E. coli LE392 carrying only the cloning vector did not react with the
antibodies (data not shown). The MrkD-deficient type 3 fimbriae from
strain IApc35 reacted with the anti-type 3 fimbria antibodies (Fig.
3C), whereas the anti-MrkD protein antibodies did not bind to the
IApc35 fimbriae (Fig. 3D). Recombinant strain LE392(pFK52/pDC17)
reacted similarly with both antisera: binding of the antibodies was
detected exclusively at the fimbrial tips (Fig. 3E and F). Under higher
magnification, the gold particles were visualized at sites where a
weakly electron-dense structure separated them from the bulk of the
P-fimbrial filament (Fig. 3G). This tip-associated structure was
difficult to visualize by negative staining and very likely corresponds
to the tip fibrillum of the P fimbriae (16). The
PapG-deficient P fimbriae from strain LE392(pDC17) without the
mrkD complementation did not bind the antibodies (Fig. 3H
and I). The type 3 fimbriae of wild-type K. pneumoniae
IA565 showed binding of antibodies identical to that of type 3 fimbriae
of E. coli LE392(pFK12) (Fig. 4). Anti-type 3 fimbria
antibodies bound laterally to the fimbriae (Fig. 4A), whereas anti-MrkD
protein antibodies bound exclusively to the tips of the fimbriae (Fig.
4B).

View larger version (126K):
[in this window]
[in a new window]
|
FIG. 3.
Immunoelectron microscopy of fimbrial antigens with
anti-type 3 fimbria serum (A, C, E, and H) and with anti-MrkD
antibodies (B, D, F, G, and I). The bacteria are E. coli LE392(pFK12) (A and B), K. pneumoniae IApc35
(C and D), E. coli LE392(pFK52/pDC17) (E to G), and
E. coli LE392(pDC17) (H and I). Arrowheads indicate
binding of antibodies and protein A-gold to tips of fimbrial filaments,
long arrows indicate binding along the fimbrial filament, and short
arrows indicate lack of binding. Bars, 100 nm.
|
|

View larger version (133K):
[in this window]
[in a new window]
|
FIG. 4.
Immunoelectron microscopy of fimbrial antigens of
K. pneumoniae IA565 with anti-type 3 fimbria serum (A)
and anti-MrkD protein antibodies (B). Arrowheads indicate binding of
antibodies and protein A-gold to tips of fimbrial filaments, and long
arrows indicate binding along the fimbrial filament. Bar, 100 nm.
|
|
Our results demonstrate that the MrkD minor adhesin of the type 3 fimbrial filaments of
K. pneumoniae is localized at the
tip of the fimbrial filaments. The organization of the type 3
fimbrial
filaments thus greatly resembles that of the P fimbriae
of
uropathogenic
E. coli (
11), which remains
the best-characterized
fimbrial type in regard to genetics and
biosynthesis. Our results
also demonstrate that
mrkD
complements a
papG mutation resulting
in a P-fimbrial
filament with MrkD located at the tip of the filament.
This indicates a
high degree of similarity in the biogenesis and
structural constraints
within the two filaments.
We demonstrated the tip orientation of MrkD in type 3 fimbriae
expressed on both a recombinant and a wild-type strain by
immunoelectron
microscopy with highly specific anti-MrkD antibodies.
The antibodies
were raised against MrkD purified from the cytoplasm of
E. coli that expressed MrkD with an N-terminal
polyhistidine tail. The
resulting fusion protein was of the correct
size and reacted with
antibodies raised against a synthetic peptide
mimicking an antigenic
site in the MrkD sequence. The antibodies
obtained by immunization
with purified MrkD reacted exclusively with
the tip of the type
3 fimbrial filament, whereas antibodies raised by
immunization
with purified type 3 fimbriae reacted along the sides of
the fimbrial
filament. The specificity of the anti-MrkD antibodies was
demonstrated
in a Western blot by their lack of reactivity with the
20.5-kDa
MrkA peptide in the type 3 fimbrial preparations, as well as
with
the 18-kDa type 1 fimbrial peptides of
K. pneumoniae. Furthermore,
the type 3 fimbriae from
K. pneumoniae IApc35, whose chromosome
does not hybridize with
mrkD and which does not exhibit the MrkD-mediated
hemagglutination of tanned erythrocytes (
9,
21), failed to
react with the anti-MrkD antibodies in a Western blot and in
immunoelectron
microscopy. This strongly suggests that the anti-MrkD
antibodies
recognized only the 34-kDa MrkD peptide in the fimbrial
filaments.
In contrast, the anti-type 3 fimbria antibodies reacted with
the
20.5-kDa MrkA peptide in a Western blot and bound similarly to
both
type 3 fimbrial filaments. This indicates that the major
MrkA subunits
in the two type 3 fimbrial variants are immunologically
cross-reactive.
It is impossible to say whether the chromosomal
type 3 fimbrial
variant on strain IApc35 completely lacks
mrkD or
whether it carriers a variant adhesin that is genetically and
structurally unrelated to MrkD. The latter situation has been
detected in the PapG variants of uropathogenic
E. coli
(
18).
Gerlach et al. (
7) found that
mrkD complements a
papG mutation in the P fimbria of
E. coli.
The complemented strain is
able to hemagglutinate (
7) and to
bind to type V collagen (
22),
which indicates that MrkD has
a functionally correct conformation
on the
E. coli
surface. It was not, however, assessed whether
MrkD in this construct
actually is associated with the fimbriae
or whether it is just
transported to the outer membrane by the
P-fimbrial biosynthetic
machinery. Our results indicate that MrkD
is located at the tip of the
P-fimbrial filament and that it also
has a correct structural
localization in the tip fibrillum (
16)
of the hybrid
fimbria. It should be noted that the hybrid fimbriae
shown in Fig.
1
were purified by using deoxycholate and concentrated
urea. The fact
that the hybrid fimbriae could stand these agents
indicates strong
interactions between the components of the tip
fibrillum. The
structurally and functionally correct complementation
of
papG by
mrkD actually is surprising in terms of
the different
primary structures of the two adhesins. The molecular
size of
PapG is 38.3 kDa, and that of MrkD is 34.0 kDa, and their amino
acid sequences are only 12% identical. This suggests that shared
dominant features in the structure of the minor components, rather
than
their primary structure, are important in the biogenesis
of the P
fimbria. The chaperone proteins PapD and MrkB show only
a low level of
sequence similarity but share the few critical
amino acid residues that
are considered important for the structure
and correct folding of PapD
(
11).
The present and previous (
7,
22) results demonstrate that
the plasmid-encoded type 3 fimbria of
K. pneumoniae and
the
P fimbria of
E. coli share structural similarity
and probably
represent evolutionarily related fimbrial types. We have
recently
found (
19) that in the G (F17) fimbrial filament,
the GafD lectin
is also tip associated but the
gafD
lectin gene cannot complement
the
papG mutation we used
here. Hence G fimbriae, despite their
overall morphological similarity
to P fimbriae, may represent
another type of organization of fimbrial
subunits in
E. coli.
 |
ACKNOWLEDGMENTS |
This study was supported by the Academy of Finland (projects 29346 and 1511) and the University of Helsinki.
We thank Marc Baumann for performing amino acid sequence analyses,
Raili Lameranta for technical assistance, and Steven Clegg and Doug
Hornick for the Klebsiella strains.
 |
FOOTNOTES |
*
Corresponding author. Mailing address: Division
of General Microbiology, Department of Biosciences, P.O. Box 56, FIN-00014 University of Helsinki, Finland. Phone: 358-9-70859251. Fax:
358-9-70859262. E-mail: Benita.Westerlund{at}Helsinki.Fi.
Editor: P. E. Orndorff
 |
REFERENCES |
| 1.
|
Abraham, S. N.,
J. D. Goguen,
D. Sun,
P. Klemm, and E. H. Beachey.
1987.
Identification of two ancillary subunits of Escherichia coli type 1 fimbriae by using antibodies against synthetic oligopeptides of fim gene products.
J. Bacteriol.
169:5530-5536[Abstract/Free Full Text].
|
| 2.
|
Coligan, J. H.,
A. M. Kruisbeek,
D. H. Margulies,
E. M. Shevach, and W. Strober.
1994.
In
Current protocols in immunology.
John Wiley & Sons, Inc., New York, N.Y.
|
| 3.
|
Duguid, J. P.
1959.
Fimbriae and adhesive properties in Klebsiella strains.
J. Gen. Microbiol.
21:271-286[Abstract/Free Full Text].
|
| 4.
|
Gerlach, G.-F., and S. Clegg.
1988.
Cloning and characterization of the gene cluster encoding type 3 (MR/K) fimbriae of Klebsiella pneumoniae.
FEMS Microbiol. Lett.
49:377-383.
|
| 5.
|
Gerlach, G.-F., and S. Clegg.
1988.
Characterization of two genes encoding antigenically distinct type-1 fimbriae of Klebsiella pneumoniae.
Gene
64:231-240[Medline].
|
| 6.
|
Gerlach, G.-F.,
B. L. Allen, and S. Clegg.
1988.
Molecular characterization of the type 3 (MR/K) fimbriae of Klebsiella pneumoniae.
J. Bacteriol.
170:3547-3553[Abstract/Free Full Text].
|
| 7.
|
Gerlach, G.-F.,
S. Clegg, and B. L. Allen.
1989.
Identification and characterization of the genes encoding the type 3 and type 1 fimbrial adhesins of Klebsiella pneumoniae.
J. Bacteriol.
171:1262-1270[Abstract/Free Full Text].
|
| 8.
|
Hornick, D. B.,
B. L. Allen,
M. A. Horn, and S. Clegg.
1992.
Adherence to respiratory epithelia by recombinant Escherichia coli expressing Klebsiella pneumoniae type 3 fimbrial gene products.
Infect. Immun.
60:1577-1588[Abstract/Free Full Text].
|
| 9.
|
Hornick, D. B.,
J. Thommandru,
W. Smits, and S. Clegg.
1995.
Adherence properties of an mrkD-negative mutant of Klebsiella pneumoniae.
Infect. Immun.
63:2026-2032[Abstract].
|
| 10.
|
Hornick, D. B.,
B. L. Allen,
M. A. Horn, and S. Clegg.
1991.
Fimbrial types among respiratory isolates belonging to the family Enterobacteriaceae.
J. Clin. Microbiol.
29:1795-1800[Abstract/Free Full Text].
|
| 11.
|
Hultgren, S. J.,
S. Normark, and S. N. Abraham.
1991.
Chaperone-assisted assembly and molecular architecture of adhesive pili.
Annu. Rev. Microbiol.
45:383-415[Medline].
|
| 12.
|
Jones, C. H.,
J. S. Pinkner,
R. Roth,
John Heuser,
A. V. Nicholes,
S. N. Abraham, and S. J. Hultgren.
1995.
FimH adhesin of type 1 pili is assembled into a fibrillar tip structure in the Enterobacteriaceae.
Proc. Natl. Acad. Sci. USA
92:2081-2085[Abstract/Free Full Text].
|
| 13.
|
Korhonen, T. K.,
E.-L. Nurmiaho,
H. Ranta, and C. Svanborg-Edén.
1980.
New method for isolation of immunologically pure pili from Escherichia coli.
Infect. Immun.
27:569-575[Abstract/Free Full Text].
|
| 14.
|
Korhonen, T. K.,
E. Tarkka,
H. Ranta, and K. Haahtela.
1983.
Type 3 fimbriae of Klebsiella sp.: molecular characterization and role in bacterial adhesion to plant roots.
J. Bacteriol.
155:860-865[Abstract/Free Full Text].
|
| 15.
|
Krogfelt, K.,
H. Bergmans, and P. Klemm.
1990.
Direct evidence that the FimH protein is the mannose-specific adhesin of Escherichia coli type 1 fimbriae.
Infect. Immun.
58:1995-1998[Abstract/Free Full Text].
|
| 16.
|
Kuehn, M. J.,
J. Heuser,
S. Normark, and S. Hultgren.
1992.
P pili of uropathogenic Escherichia coli are composite fibres with distinct fibrillar adhesive tips.
Nature
356:252-255[Medline].
|
| 17.
|
Kunin, C. M.
1987.
In
Detection, prevention, and management of urinary tract infections.
Lea & Febiger, Philadelphia, Pa.
|
| 18.
|
Lund, B.,
B.-I. Marklund,
N. Strömberg,
F. Lindberg,
K.-A. Karlsson, and S. Normark.
1988.
Uropathogenic Escherichia coli can express serologically identical pili of different receptor binding specificities.
Mol. Microbiol.
2:255-263[Medline].
|
| 19.
| Saarela, S., J. Tanskanen, N. Kalkkinen, B. Westerlund-Wikström, M. Rhen, and T. K. Korhonen.
Unpublished data.
|
| 20.
|
Sambrook, J.,
E. F. Fritsch, and T. Maniatis.
1989.
In
Molecular cloning: a laboratory manual, 2nd ed.
Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y.
|
| 21.
|
Schurtz, T. A.,
D. B. Hornick,
T. K. Korhonen, and S. Clegg.
1994.
The type 3 fimbrial adhesin gene (mrkD) is not conserved among all fimbriate strains.
Infect. Immun.
62:4186-4191[Abstract/Free Full Text].
|
| 22.
|
Tarkkanen, A.-M.,
B. L. Allen,
B. Westerlund,
H. Holthöfer,
P. Kuusela,
L. Risteli,
S. Clegg, and T. K. Korhonen.
1990.
Type V collagen as the target for type-3 fimbriae, enterobacterial adherence organelles.
Mol. Microbiol.
4:1353-1361[Medline].
|
| 23.
|
Tarkkanen, A.-M.,
B. L. Allen,
P. H. Williams,
M. Kauppi,
K. Haahtela,
A. Siitonen,
I. Ørskov,
F. Ørskov,
S. Clegg, and T. K. Korhonen.
1992.
Fimbriation, capsulation, and iron-scavenging systems of Klebsiella strains associated with human urinary tract infection.
Infect. Immun.
60:1187-1192[Abstract/Free Full Text].
|
| 24.
|
Williams, P., and J. M. Tomas.
1990.
The pathogenicity of Klebsiella pneumoniae.
Rev. Med. Microbiol.
1:196-204.
|
Infect Immun, May 1998, p. 2356-2361, Vol. 66, No. 5
0019-9567/98/$04.00+0
Copyright © 1998, American Society for Microbiology. All rights reserved.
This article has been cited by other articles:
-
Nuccio, S.-P., Baumler, A. J.
(2007). Evolution of the Chaperone/Usher Assembly Pathway: Fimbrial Classification Goes Greek. Microbiol. Mol. Biol. Rev.
71: 551-575
[Abstract]
[Full Text]