Previous Article | Next Article 
Infect Immun, June 1998, p. 2684-2690, Vol. 66, No. 6
0019-9567/98/$04.00+0
Copyright © 1998, American Society for Microbiology. All rights reserved.
Molecular and Immunological Analyses of the Mycobacterium
avium Homolog of the Immunodominant Mycobacterium
leprae 35-Kilodalton Protein
James A.
Triccas,1,
Nathalie
Winter,1,
Paul W.
Roche,1,
Andrea
Gilpin,2
Kathleen E.
Kendrick,3 and
Warwick
J.
Britton1,*
Centenary Institute of Cancer Medicine and
Cell Biology, Newtown, New South Wales 2042, Australia1;
Department of Plant
Sciences, The University of Western Ontario, London, Ontario,
Canada N6A 5B72; and
Department of
Microbiology, The Ohio State University, Columbus, Ohio
432103
Received 9 January 1998/Returned for modification 2 February
1998/Accepted 16 March 1998
 |
ABSTRACT |
The analysis of host immunity to mycobacteria and the development
of discriminatory diagnostic reagents relies on the characterization of
conserved and species-specific mycobacterial antigens. In this report,
we have characterized the Mycobacterium avium homolog of
the highly immunogenic M. leprae 35-kDa protein. The genes encoding these two proteins were well conserved, having 82% DNA identity and 90% identity at the amino acid level. Moreover both proteins, purified from the fast-growing host M. smegmatis, formed multimeric complexes of around 1000 kDa in size
and were antigenically related as assessed through their recognition by
antibodies and T cells from M. leprae-infected
individuals. The 35-kDa protein exhibited significant sequence identity
with proteins from Streptomyces griseus and the
cyanobacterium Synechoccocus sp. strain PCC 7942 that are
up-regulated under conditions of nutrient deprivation. The 67% amino
acid identity between the M. avium 35-kDa protein and
SrpI of Synechoccocus was spread across the sequences of
both proteins, while the homologous regions of the 35-kDa protein and the P3 sporulation protein of S. griseus were interrupted
in the P3 protein by a divergent central region. Assessment by PCR
demonstrated that the gene encoding the M. avium
35-kDa protein was present in all 30 M. avium clinical
isolates tested but absent from M. intracellulare,
M. tuberculosis, or M. bovis BCG.
Mice infected with M. avium, but not M. bovis BCG, developed specific immunoglobulin G antibodies to the
35-kDa protein, consistent with the observation that tuberculosis
patients do not recognize the antigen. Strong delayed-type
hypersensitivity was elicited by the protein in guinea pigs sensitized
with M. avium.
 |
INTRODUCTION |
The Mycobacterium avium
complex (MAC) consists predominantly of two species, M. avium and M. intracellulare (12).
Members of the MAC are ubiquitous environmental organisms, present in soil, water, food, and a variety of animal species (12).
Although human infection caused by MAC can be serious, they are rare in immunocompetent individuals. By contrast, disseminated MAC infection represents the major cause of systemic bacterial infection in AIDS
patients (3). Up to 50% of AIDS patients may develop MAC infection, which contributes significantly to the morbidity and mortality of the disease (9). Owing to the increasing
medical importance of the MAC, research has been directed toward
understanding the immunopathology of infection caused by these
organisms. These studies have included the identification a number of
protein antigens of the MAC, through the screening of expression
libraries with anti-MAC monoclonal antibodies (MAbs) (18-20, 28,
29) or the identification of homologs of known antigens from
other mycobacterial species (2, 23). Some of these antigens,
such as the secreted antigen 85B, are common to all mycobacteria
(23), while others, including the immunogenic 19- and 27-kDa
lipoproteins of M. intracellulare, are restricted
to a few mycobacterial species (19, 20) and as such may be
useful candidates for the specific detection of MAC infection. While a
number of these antigens were immunogenic, being recognized by
the host immune response or able to elicit delayed-type
hypersensitivity (DTH) in MAC-sensitized guinea pigs, none were
able to show adequate immunological discrimination between the MAC and
M. tuberculosis (1, 8, 15, 17, 19, 20, 28).
The 35-kDa protein of Mycobacterium leprae is one of two
major membrane components of the leprosy bacillus (11). The
other major membrane protein is a bacterioferritin, and its abundance within in vivo-grown M. leprae has been postulated to
facilitate acquisition of iron by the bacillus within the
nutrient-limited environment of the macrophage (25). The
35-kDa protein is also highly abundant within M. leprae, but its specific biological function is unknown, and
further analysis is hindered by the inability to cultivate
M. leprae in vitro. Nevertheless, the 35-kDa protein is
a major antigenic component of the leprosy bacillus, as it is
recognized by the majority of leprosy patients and healthy contacts of
leprosy patients (referred to as healthy leprosy contacts) tested
(37). By contrast, tuberculosis (TB) patients do not recognize the 35-kDa protein (37), consistent with previous genetic and serological evidence that the protein is absent from M. tuberculosis (31, 39). Furthermore, skin
tests with the antigen distinguished between sensitization with
M. leprae and M. tuberculosis in guinea
pigs (37).
Hybridization studies with the gene encoding the M. leprae 35-kDa protein identified a homologous region in the genome
of M. avium (38). In this study, we have
characterized the gene encoding the M. avium 35-kDa
protein and purified the protein from a rapidly growing mycobacterial
host. Genetic, structural, and immunological analyses revealed a high
degree of similarity between the M. avium 35-kDa
protein and its M. leprae counterpart. Subsequent
analyses revealed strong similarity of the M. avium and
M. leprae 35-kDa proteins with two stress-induced
proteins from distinct bacterial genera. Specific immune responses to
the M. avium 35-kDa protein developed during
experimental M. avium infection.
 |
MATERIALS AND METHODS |
Bacterial strains and growth conditions.
M. avium
IS94 (a clinical isolate from a human immunodeficiency virus-infected
individual), M. avium MAC101 (provided by C. Cheers,
University of Melbourne, Parkville, Victoria, Australia), and
M. tuberculosis H37Rv and M. bovis BCG
CSL (Commonwealth Serum Laboratories, Parkville, Victoria Australia)
were grown in Middlebrook 7H9 medium (Difco Laboratories, Detroit,
Mich.). M. smegmatis was grown in LB medium
(30) supplemented with 0.05% Tyloxacol (Sigma, St. Louis,
Mo.). MAC clinical isolates were provided by William Chu, Westmead
Hospital, Westmead, New South Wales, Australia.
Antigens and antibodies.
The recombinant M. leprae 35-kDa protein was purified by MAb affinity chromatography
as described previously (37). Murine anti-M.
leprae 35-kDa protein MAb CS-38 was a kind gift of P. J. Brennan (Colorado State University, Fort Collins), and murine anti-M. leprae 35-kDa protein MAb ML-03 was kindly
supplied by J. Ivanyi (Hammersmith Hospital, London, England).
DNA manipulation.
DNA manipulations were carried out by
using standard techniques (30). Sequence of double-stranded
DNA templates were determined by the dideoxy-chain termination method
with the use of Sequenase (United States Biochemicals, Cleveland, Ohio)
according to the manufacturer's instructions. Sequences were compared
to those in the GenBank, EMBL, Genpeptide, PIR, and Swissprot
databases, using the FASTA algorithm (25). M. leprae and M. avium NCTC 8559 DNAs were provided
by M. J. Colston (National Institute for Medical Research,
London, England) and K. Jackson (Victorian Infectious Disease Reference
Laboratory, Fairfield, Victoria, Australia), respectively. PCR
amplification of the 35-kDa protein-encoding gene from M. avium clinical isolates was performed with the primers JA8
(5' GGCGCCGGCAGCGAAGAG 3') and JA11 (5'
TCACTTGTACTCATGGAA 3'). Single M. avium colonies
were resuspended in 100 µl of distilled water and boiled for 5 min,
and 5 µl of the suspension was used for PCR (94°C for 1 min, 50°C
for 1 min, 72°C for 1 min; 30 cycles). The PCR-amplified product of
primers JA7 (5' CTCGGTACCATTTTTCGACC 3') and JN9 (5'
CTAGAATTCGAGCTCAAGCTTTCACTTGTACTC 3') was used in the
construction of plasmid pAJ11.
Purification of the M. avium 35-kDa protein from
M. smegmatis.
Plasmid DNA (1 µg) was
electroporated into M. smegmatis mc2155
(31), using a gene pulser apparatus (Bio-Rad, Hercules,
Calif.). Kanamycin-resistant colonies were screened for
expression by sodium dodecyl sulfate-polyacrylamide gel electrophoresis
(SDS-PAGE) and immunoblotting with MAb CS-38 as previously described
(26). Single recombinant M. smegmatis
colonies were inoculated into 1 liter of LB medium supplemented with
0.05% Tyloxacol and incubated for 3 days at 37°C with shaking. Cells
were pelleted and resuspended in phosphate-buffered saline (PBS)
containing 1% Triton X-100, 10% glycerol, and 1 M NaCl, and the
suspension sonicated four time for 4 min each. Anti-35-kDa protein
immunoglobulin G (IgG) was purified from MAb ML-03 ascites fluid and
coupled to cyanogen bromide-activated Sepharose 4B (Pharmacia, Uppsala,
Sweden). M. smegmatis sonicate was passed over the
affinity column; the column was washed with 10 volumes of sonication
buffer without Triton X-100 and 5 volumes of PBS containing 0.5 M NaCl.
Bound protein was eluted with 0.1 M diethylamine (pH 11.0) and dialyzed
against PBS. Molecular mass estimation of the 35-kDa protein was
performed by gel filtration using a Superose 6 fast performance liquid
chromatography (FPLC) column (Pharmacia). The column was calibrated by
using four standard proteins; aldolase (158 kDa), catalase (232 kDa), ferritin (440 kDa), and thyroglobulin (669 kDa) (Pharmacia).
Detection of anti-35-kDa protein antibodies.
Microtiter
plates were coated with antigen (100 pg/ml to 100 µg/ml) overnight at
room temperature. Plates were washed and blocked with 3% bovine serum
albumin, and pooled sera (diluted 1:100) were added for 90 min at
37°C. Plates were washed, and alkaline phosphatase-conjugated
anti-human IgG (Sigma) was added for 60 min at 37°C. Binding was
visualized by the addition of n-nitrophenyl phosphate (1 mg/ml), and absorbance was measured at 405 nm.
Lymphocyte proliferation assays.
Nepali subjects tested for
cellular reactivity included 18 paucibacillary (PB) leprosy patients,
12 healthy leprosy contacts, and 10 patients with active TB. Peripheral
blood mononuclear cell (PBMC) proliferation was performed and analyzed
as described previously (37). The optimal protein
concentrations were 10 µg/ml for M. leprae sonicate
(MLS) and the M. leprae 35-kDa protein and 3 µg/ml for M. avium 35-kDa protein.
Infection of mice with M. avium.
Eight- to
twelve-week-old female C57BL/6 mice were inoculated subcutaneously with
PBS, 5 × 106 M. bovis BCG CSL, or
M. avium MAC101. At 2 and 4 weeks, sera were collected
and the presence of anti-35 kDa antibodies was detected by
enzyme-linked immunosorbent assay (ELISA) using 5 µg of the
M. smegmatis-derived M. avium 35-kDa
protein per ml. The reactivities of the sera were also tested with
M. smegmatis sonicate (5 and 0.5 µg/ml), BCG sonicate
(10 µg/ml), and M. avium sonicate (10 µg/ml) as
antigens.
Measurement of DTH.
Outbred female guinea pigs, 10 to 12 weeks old, were sensitized intradermally with 0.5 mg (wet weight) of
heat-killed M. avium IS94, M. bovis BCG
CSL, or M. leprae or gamma-irradiated M. tuberculosis H37Rv. The guinea pigs were challenged intradermally
4 weeks later with 10 µg of MLS or the M. avium
35-kDa protein. The area of induration was measured 24 h later.
Nucleotide sequence accession number.
The GenBank accession
number for the gene encoding the M. avium 35-kDa
protein is U43835.
 |
RESULTS |
Cloning of the gene encoding the M. avium 35-kDa
protein.
We previously reported the identification of a 3-kb
PstI M. avium chromosomal DNA fragment that
hybridized with the gene encoding the M. leprae 35-kDa
protein (39). Immunoblotting revealed the presence of a
35-kDa protein in the sonicate of M. avium IS94 that
reacted with CS-38, a MAb raised against the M. leprae
35-kDa protein (Fig. 1). To isolate the
gene encoding this protein, chromosomal DNA from M. avium IS94 was digested with PstI, and fragments in the
range of 2.5 to 4 kb were ligated into pUC19 digested with PstI. Clones were chosen by screening with an
-32P-labeled PCR fragment of the entire M. leprae 35-kDa protein-encoding gene, and the positive clone chosen
was termed pAJ6. Sequencing of the 3-kb insert of pAJ6 revealed a major
open reading frame encoding a protein of 308 amino acids (Fig.
2). A putative ribosome binding site was
identified 5 bp upstream of the predicted translational start codon.
The gene was 82% identical to that encoding the M. leprae 35-kDa protein, which translated to 90% identity at the amino acid level (Fig. 3). The lengths
and predicted molecular masses of the two proteins were essentially
identical.

View larger version (57K):
[in this window]
[in a new window]
|
FIG. 1.
Identification of a homolog of the M. leprae 35-kDa protein in M. avium. Sonic
extracts (15 µg) of M. avium (lane 1), M. tuberculosis (lane 2), and M. leprae (lane 3) were
separated by SDS-PAGE and stained with Coomassie brilliant blue (A) and
then transferred to nitrocellulose for immunoblotting with the
anti-M. leprae 35-kDa protein MAb CS-38 (B).
|
|

View larger version (55K):
[in this window]
[in a new window]
|
FIG. 2.
Nucleotide sequence of the gene encoding the 35-kDa
protein of M. avium. The nucleotide sequence of 962 bp
of the insert of pAJ6 is shown. The deduced protein sequence of the
35-kDa protein is shown above the nucleotide sequence. A potential
ribosome binding site is represented by boldface.
|
|

View larger version (39K):
[in this window]
[in a new window]
|
FIG. 3.
Comparison of the deduced amino acid sequence of the
M. avium 35-kDa protein (Mav35) with sequences of the
M. leprae 35-kDa protein (Mlp35),
Synechococcus sp. strain PCC 7942 SrpI (SrpI), and S. griseus P3 (SgrP3). Amino acids identical to the M. avium 35-kDa protein are indicated by dashes; gaps in the sequence
are represented by periods.
|
|
Homology searches of nucleotide and protein databases identified two
proteins showing significant identity with the 35-kDa
protein. The
first was the SrpI of
Synechococcus sp. strain PCC
7942, a
protein of as yet unknown function induced under condition
of sulfur
stress and coordinately regulated with two proteins
involved in
cysteine metabolism by the organism (
21,
22).
The
M. avium 35-kDa protein and SrpI were 67% identical at
the
amino acid level, with the similarity spread over the entire
lengths
of the two proteins (Fig.
3). The
M. avium
35-kDa protein also
showed significant identity with a 52-kDa protein,
termed P3,
that accumulates during sporulation in
Streptomyces
griseus under
conditions of phosphate deprivation (
14).
P3 and the 35-kDa
protein exhibited 49% amino acid identity, with the
homology restricted
to the initial 75 amino acids and the C-terminal
236 amino acids
of P3 (Fig.
3). The remaining central region of 148 amino acids
of P3 showed no similarity to the
M. avium
35-kDa protein.
Distribution of the gene encoding the M. avium
35-kDa protein within the MAC.
The MAC is composed of a large
number of serologically distinct groups (serotypes). To evaluate the
distribution of the gene encoding the M. avium 35-kDa
protein within this complex, 32 clinical MAC isolates were screened by
PCR for the presence or absence of the gene. Figure
4 shows a representative gel of the PCR
products. A band of 750 bp indicates a positive result. All MAC
isolates classified as M. avium (serovars 1, 2, 4, 5, 8, 9, and 21) were positive for the gene encoding the M. avium 35-kDa protein (Table 1). The
two M. intracellulare isolates (serovar 16) were
negative for the gene. The primer combination used was specific to
M. avium such that no amplification was detected on
chromosomal DNA from M. leprae, M. tuberculosis, or M. bovis BCG (Fig. 4).

View larger version (96K):
[in this window]
[in a new window]
|
FIG. 4.
Detection of the gene encoding the M. avium 35-kDa protein in members of the MAC. PCR was used to detect
the 35-kDa protein-encoding gene in serotyped MAC clinical isolates. A
750-bp band indicates a positive result. Lanes: Mk, molecular weight
markers; 1 and 15, M. avium IS94; 2 to 5, M. avium NCTC 8559, M. leprae, M. tuberculosis H37Rv, and M. bovis BCG CSL; 7 to 14, MAC serovars 1, 2, 3, 5, 8, 9, 21, and 16; 16, no-DNA control.
|
|
Purification of the M. avium 35-kDa protein from
recombinant M. smegmatis and comparative analysis of
the M. avium and M. leprae 35-kDa
proteins.
The 35-kDa protein-encoding gene was placed under the
control of the strong
-lactamase promoter of M. fortuitum (36), yielding plasmid pAJ11. When pAJ11 was
introduced into M. smegmatis, high-level expression of
the M. avium 35-kDa protein-encoding gene was observed, such that the protein constituted one of the major protein bands of
recombinant M. smegmatis (Fig.
5, lane 2). Recombinant product was
efficiently purified from the sonicate of M. smegmatis/pAJ11 by single-step MAb affinity chromatography (Fig.
5, lane 3).

View larger version (83K):
[in this window]
[in a new window]
|
FIG. 5.
SDS-PAGE of recombinant M. avium 35-kDa
proteins purified from M. smegmatis. Twenty micrograms
of bacterial sonicate and 10 µg of purified proteins were separated
by SDS-PAGE and stained with Coomassie brilliant blue. Lanes: 1, M. smegmatis/pJN30 sonicate; 2, M. smegmatis/pAJ11 sonicate; 3, M. avium 35-kDa
protein.
|
|
The native
M. leprae 35-kDa protein and the recombinant
product purified from
M. smegmatis form multimeric
complexes of around
1,000 kDa in size (
37,
39). Superose 6 FPLC separation indicated
that the
M. avium 35-kDa
protein also formed multimeric complexes,
estimated at 987 ± 61 kDa (mean of three experiments). As maximal
binding of the
M. leprae homolog to leprosy sera relied on the
protein
maintaining a correct conformational state (
37), the
binding
of pooled sera from 10 lepromatous leprosy patients to
the
M. leprae and
M. avium 35-kDa proteins
was assessed. Both
proteins were equally reactive with these pooled
sera over the
range of concentrations tested (Fig.
6). By contrast, pooled sera
from either
8 tuberculosis patients or 10 BCG vaccinees did not
react significantly
with either protein (Fig.
6).

View larger version (25K):
[in this window]
[in a new window]
|
FIG. 6.
Recognition of recombinant 35-kDa proteins by leprosy,
TB, and BCG vaccinee sera. The binding of pooled lepromatous leprosy
sera (LLS), tuberculosis sera (TBS), and sera from BCG vaccinees (BCGS)
to the M. avium (Mav) and M. leprae
(Mlp) 35-kDa proteins was determined by ELISA.
|
|
To determine if the sequence and serological similarities demonstrated
between the two proteins could be extended to cellular
recognition, the
reactivity of the
M. avium 35-kDa protein was
assessed
in leprosy patients and healthy leprosy contacts who
recognized the
M. leprae homolog, together with TB patients. PBMCs
from the majority of healthy leprosy contacts and approximately
half of
the PB leprosy patients responded to the
M. avium
protein
(Table
2). By contrast, none of
the TB patients tested exhibited
a positive proliferative response to
the
M. avium 35-kDa protein
(Table
2).
View this table:
[in this window]
[in a new window]
|
TABLE 2.
Proliferation of PBMCs from leprosy and TB patients and
healthy leprosy contacts in response to the M. avium and M. leprae 35-kDa proteins
|
|
Immune recognition of the M. avium protein in
M. avium-infected mice.
To determine if the
M. avium 35-kDa protein is recognized during the course
of a mycobacterial infection, mice were infected with the virulent
MAC101 strain and the level of anti-35 kDa IgG antibodies was
determined. The presence of the gene encoding the 35-kDa protein in
this strain of M. avium was confirmed by PCR (data not
shown). As shown in Fig. 7, all
MAC101-immunized mice exhibited high anti-35-kDa IgG antibodies 4 weeks
after infection (mean optical density ± standard deviation,
0.951 ± 0.099). These sera were not reactive with M. smegmatis sonicate at the same concentration (optical density of
0.083 ± 0.015), indicating that the reactivity was not directed
to any M. smegmatis contaminants in the 35-kDa
protein preparation. Furthermore, the immune response was specific, as
mice immunized with M. bovis BCG exhibited no detectable antibodies directed against the M. avium
35-kDa protein (Fig. 7). Both M. avium- and
M. bovis BCG-immunized mice developed antibodies to
crude sonicates of either organism, indicating that both infections had
stimulated an antibody response (data not shown).

View larger version (14K):
[in this window]
[in a new window]
|
FIG. 7.
Detection of anti-M. avium 35-kDa
protein antibodies in sera of M. avium-infected mice.
C57BL/6 mice were immunized subcutaneously with PBS, M. bovis BCG CSL (BCG), or M. avium MAC101 (MAV), and
the presence of anti-35-kDa antibodies was analyzed by ELISA at 2 and 4 weeks postinfection.
|
|
Elicitation of DTH by the M. avium 35-kDa
protein.
The ability of the M. avium 35-kDa
protein to elicit DTH in mycobacterium-sensitized guinea pigs was
assessed. DTH was elicited by the M. avium 35-kDa
protein in all M. avium- and M. leprae-sensitized animals tested (Table
3). The magnitude of this response was similar to that elicited by MLS in the same animals. A minority of
animals sensitized with M. tuberculosis or
M. bovis BCG also responded to the protein, and the
level of DTH in the responding animals was comparable to that in
M. avium- or M. leprae-sensitized animals. MLS elicited strong DTH in all M. tuberculosis- and M. bovis BCG-sensitized animals.
 |
DISCUSSION |
Characterization of members of the MAC has determined that many of
the major antigens are shared with M. leprae and/or
M. tuberculosis. These include the 18-kDa heat shock
protein (2), the secreted antigen 85B (23), and
the highly immunogenic 19-kDa lipoprotein (19). We have
extended this list to include the 35-kDa protein of M. leprae, through identification of its M. avium
homolog. The two antigens were closely related at the genetic level,
showing 82% DNA and 90% amino acid identity. The proteins adopted
similar conformation, both forming multimeric complexes of the same
size and exhibiting similar serological determinants. The M. avium 35-kDa protein stimulated the proliferation of PBMCs from
leprosy-infected and -exposed individuals, indicating that T-cell as
well as B-cell epitopes are shared between the M. leprae and M. avium 35-kDa proteins.
The presence of the M. leprae 35-kDa antigen in
M. avium indicates that both major membrane proteins
(MMP) of M. leprae, MMPI, the 35-kDa protein, and
MMPII, a 22-kDa bacterioferritin (25), have well-conserved
homologs in M. avium (13). Added to this is
the identification of antigens in M. avium which were
initially described as M. leprae specific and absent
from M. tuberculosis, such as the 12- and 18-kDa
proteins (2, 5). This antigenic similarity between
M. leprae and the MAC may explain why the ICRC bacillus and Mycobacterium w, organisms classified as
belonging to the MAC complex, are being investigated for their
antileprosy potential. Both organisms stimulate proliferative responses
from the T cells of leprosy patients (7, 40) and evoke
lepromin conversion in vaccinated lepromatous patients (4,
33).
Of the mycobacterial antigens isolated and characterized, only a few
have identified functions (34, 41). The presence of a
well-conserved homolog of the M. leprae 35-kDa protein
in M. avium provides one avenue to explore the
protein's function, as it is possible to manipulate genetically
members of the MAC (6, 16). Elucidation of the protein's
biological function will also be facilitated by the analogous SrpI of
Synechococcus sp. strain PCC 7942 and the P3 protein of
S. griseus, both which show striking similarity with the
M. avium and M. leprae 35-kDa proteins.
The specific function of SrpI is unknown, but it is up-regulated under
conditions of sulfur stress and coordinately regulated with SrpG and
SrpH, two proteins together capable of cysteine biosynthesis (21,
22). Interestingly, where in Synechococcus sp. strain
PCC 7942 the srpGHI genes from a tightly clustered operon
(22), we found no evidence of adjacent homologs of
srpG and srpH genes in M. avium
or M. leprae by analysis of sequence around the 35-kDa
protein-encoding gene. Furthermore, Southern blotting of chromosomal
DNA with srpGH also failed to detect any homologous
sequences (data not shown), indicating that these genes are not present
in the mycobacteria studied or are too dissimilar to be detected by
this technique. Where SrpI is induced under sulfur deprivation, P3 of
S. griseus is induced by the deprivation of phosphate
(14), suggesting that the 35-kDa protein may be involved in
the response of M. avium and M. leprae
to conditions of environmental stress, such as the lack of nutrients.
Indeed, such conditions are prevalent in the macrophage, the preferred host microenvironment of M. avium and M. leprae. P3 also contains a proposed cyclic nucleotide binding
domain between amino acids 100 to 220 (14), which is absent
from the 35-kDa protein and SrpI (Fig. 3). Therefore, if P3, SrpI, and
the 35-kDa protein do form a set of functionally related proteins
spanning three bacterial genera, at least one functional process has
been retained by P3 but lost by the other two proteins.
The 35-kDa protein of M. leprae is a major immunogenic
antigenic component of the bacillus, recognized by the large majority of leprosy patients and healthy leprosy contacts (37). The
recognition of the 35-kDa protein during experimental M. avium infection in mice confirms that the M. avium
homolog is also immunogenic. Furthermore, the protein contains T-cell
and B-cell epitopes recognized by the human immune response during
mycobacterial infection (Table 2; Fig. 6). The gene for the
M. avium 35-kDa protein is absent from the genomes of
M. tuberculosis and M. bovis BCG, and
the protein does not appear to be recognized by TB patients. Although a
number of MAC antigens were initially described as MAC specific, these
were unable to distinguish between MAC and M. tuberculosis on an immunological basis (1, 8, 15, 17, 19, 20, 28). Such distinction would be of benefit in the early treatment of diseases caused by these organisms, as the currently used skin test
reagents for detection of M. avium exposure lack
specificity (10). Sensitization with M. avium stimulated a T-cell response to the 35-kDa protein as
demonstrated by DTH (Table 3); however, a minority of M. bovis BCG- and M. tuberculosis-sensitized animals also responded to the protein. More extensive studies are required to
determine if the M. avium 35-kDa protein can be used to
distinguish between M. avium and M. tuberculosis infection in humans.
The rapid detection of MAC infection will be facilitated by the
development of new PCR-based methods for the amplification of
species-specific fragments. The gene for the M. avium
35-kDa protein offers the opportunity for the specific detection of
M. avium infection, as it was detected by PCR in all
MAC clinical isolates classified as M. avium. Isolates
of M. avium usually account for the majority of MAC
infections in AIDS patients, most frequently serovars 1, 4, and 8 (38). All isolates of these three serovars tested were
positive for the gene. By contrast, the gene was absent from the one
M. intracellulare serovar studied. The lack of other
typed M. intracellulare isolates available for testing
highlights the paucity of opportunistic infection by this subspecies in
AIDS patients (38). The significance of the differential distribution of this gene within the MAC remains to be evaluated, but
it is possible that a component of the differences in virulence and
biochemistry between M. avium and M. intracellulare (reviewed in reference 13) can
be attributed in part to the 35-kDa protein.
 |
ACKNOWLEDGMENTS |
This work was supported by the National Health and Medical
Research Council of Australia. J.A.T. was a recipient of an Australian postgraduate award, N.W. was supported by an INSERM postdoctoral fellowship, and P.W.R. was a recipient of an University of Sydney Medical Foundation research fellowship.
We are grateful for the assistance of C. R. Butlin and the staff
and patients of Anandaban Leprosy Hospital, Kathmandu, Nepal, which is
fully supported by The Leprosy Mission International. We thank B. Gicquel of the Institut Pasteur, Paris, France, for providing plasmid
pJN30 and W. Chu, Westmead Hospital, Sydney, Australia, for providing
the typed MAC isolates.
 |
FOOTNOTES |
*
Corresponding author. Mailing address: Centenary
Institute of Cancer Medicine and Cell Biology, Locked Bag no. 6, Newtown, NSW 2042, Australia. Phone: 61-2-9515-7098. Fax:
61-2-9565-6101. E-mail: wbritton{at}medicine.usyd.edu.au.
Present address: Unité de Génétique
Mycobactérienne, Institut Pasteur, 75724 Paris Cedex 15, France.
Present address: Mycobacterial Research Laboratories, Anandaban
Leprosy Hospital, Kathmandu, Nepal.
Editor: S. H. E. Kaufmann
 |
REFERENCES |
| 1.
|
Abe, C.,
H. Saito,
H. Tomiako, and Y. Fukasawa.
1989.
Production of a monoclonal antibody specific for Mycobacterium avium and immunological activity of the affinity-purified antigen.
Infect. Immun.
57:1095-1099[Abstract/Free Full Text].
|
| 2.
|
Booth, R. J.,
D. L. Williams,
K. D. Moudgil,
L. C. Noonan,
P. M. Grandison,
J. J. McKee,
R. L. Prestidge, and J. D. Watson.
1993.
Homologs of Mycobacterium leprae 18-kilodalton and Mycobacterium tuberculosis 19-kilodalton antigens in other mycobacteria.
Infect. Immun.
61:1509-1515[Abstract/Free Full Text].
|
| 3.
|
Coker, R. J.,
T. J. Hellyer,
I. N. Brown, and J. N. Weber.
1992.
Clinical aspects of mycobacterial infections in HIV infections.
Res. Microbiol.
143:377-381[Medline].
|
| 4.
|
Deo, M. G.,
C. V. Bapat,
V. Bhalero,
R. M. Chaturvedi,
R. G. Chulawala, and W. S. Bhatki.
1983.
Anti-leprosy potential of the ICRC vaccine: a study in patients and healthy volunteers.
Int. J. Lepr.
51:540-549.
|
| 5.
|
Deshpande, R. G.,
M. B. Khan, and G. Navalkar.
1992.
Comparative antigenic analysis of Mycobacterium avium complex (MAC) isolates from AIDS patients.
Tubercle
73:356-361.
|
| 6.
| Foley-Thomas, E. M., D. L. Whipple,
L. E. Bermudez, and R. G. Barletta. Phage infection,
transfection and transformation of Mycobacterium avium complex and
Mycobacterium tuberculosis. Microbiology 141:1173-1181.
|
| 7.
|
Gangal, S. G.,
S. V. Chiplunkar,
S. R. Shinde,
P. D. Samson, and M. G. Deo.
1990.
Immunoreactivity of T-cells from leprosy patients to ICRC and M. leprae antigens before and after vaccination.
Trop. Med. Parasitol.
41:314-316[Medline].
|
| 8.
|
Harris, D. P.,
H. M. Vordermeier,
S. J. Brett,
G. Pasvol,
C. Moreno, and J. Ivanyi.
1994.
Epitope specificity and isoforms of the mycobacterial 19-kilodalton antigen.
Infect. Immun.
62:2963-2972[Abstract/Free Full Text].
|
| 9.
|
Horsburgh, C. R.,
J. A. Havlik,
D. A. Ellis,
E. Kennedy,
S. A. Fann,
R. E. Dubois, and S. E. Thompson.
1991.
Survival of patients with acquired immune deficiency syndrome and disseminated Mycobacterium avium-complex infections, with and without antimycobacterial chemotherapy.
Am. Rev. Respir. Dis.
144:557-559[Medline].
|
| 10.
|
Huebner, R.,
M. Schein,
G. Cauthen,
L. Geiter,
M. Selin,
R. Good, and R. O'Brien.
1992.
Evaluation of the clinical usefulness of mycobacterial skin test antigens in adults with pulmonary mycobacterioses.
Am. Rev. Respir. Dis.
145:1160-1166[Medline].
|
| 11.
|
Hunter, S. W.,
B. Rivoire,
V. Mehra,
B. R. Bloom, and P. J. Brennan.
1990.
The major native proteins of the leprosy bacillus.
J. Biol. Chem.
265:14065-14068[Abstract/Free Full Text].
|
| 12.
|
Inderlied, C. B.,
C. A. Kemper, and L. E. M. Bermudez.
1993.
The Mycobacterium avium complex.
Clin. Microbiol. Rev.
6:266-310[Abstract/Free Full Text].
|
| 13.
|
Inglis, N. F.,
K. Stevenson,
A. H. Hosie, and J. M. Sharp.
1994.
Complete sequence of the gene encoding the bacterioferritin subunit of Mycobacterium avium subspecies silvaticum.
Gene
150:205-206[Medline].
|
| 14.
| Kwak, J., and K. E. Kendrick. Unpublished
data.
|
| 15.
|
Mackall, J. C.,
G. H. Bai,
D. A. Rouse,
G. R. Armoa,
F. Chidian,
J. Nair, and J. Morris.
1993.
A comparison of the T-cell delayed-type hypersensitivity epitopes of the 19 kDa antigens from Mycobacterium tuberculosis and Mycobacterium intracellulare using overlapping synthetic peptides.
Clin. Exp. Immunol.
93:172-177[Medline].
|
| 16.
|
Marklund, B.-I.,
D. P. Speert, and R. W. Stokes.
1995.
Gene replacement through homologous recombination in Mycobacterium intracellulare.
J. Bacteriol.
177:6100-6105[Abstract/Free Full Text].
|
| 17.
|
Morris, S. L.,
J. C. Mackall,
A. Malik,
D. A. Rouse, and S. D. Chaparas.
1992.
Skin testing with recombinant Mycobacterium intracellulare antigens.
Tubercle
73:129-133.
|
| 18.
|
Morris, S. L.,
D. A. Rouse,
D. Hussong, and S. D. Chaparas.
1990.
Isolation and characterization of recombinant lambda gt11 bacteriophages expressing four different Mycobacterium intracellulare antigens.
Infect. Immun.
58:17-20[Abstract/Free Full Text].
|
| 19.
|
Nair, J.,
D. A. Rouse, and S. L. Morris.
1992.
Nucleotide sequence analysis and serologic characterization of the Mycobacterium intracellulare homologue of the Mycobacterium tuberculosis 19 kDa antigen.
Mol. Microbiol.
6:1431-1439[Medline].
|
| 20.
|
Nair, J.,
D. A. Rouse, and S. L. Morris.
1993.
Nucleotide sequence analysis and serologic characterization of a 27-kilodalton Mycobacterium intracellulare lipoprotein.
Infect. Immun.
61:1074-1081[Abstract/Free Full Text].
|
| 21.
|
Nicholson, M. L., and D. E. Laudenbach.
1995.
Genes encoded on a cyanobacterial plasmid that are transcriptionally regulated by sulfur availability and CysR.
J. Bacteriol.
177:2143-2150[Abstract/Free Full Text].
|
| 22.
|
Nicholson, M. L.,
M. Gaasenbeek, and D. E. Laundenbach.
1995.
Two enzymes together capable of cysteine biosynthesis are encoded on a cyanobacterial plasmid.
Mol. Gen. Genet.
247:623-632[Medline].
|
| 23.
|
Ohara, N.,
K. Matsuo,
R. Yamaguchi,
A. Yamazaki,
H. Tasaka, and T. Yamada.
1993.
Cloning and sequencing of the gene for the alpha antigen from Mycobacterium avium and mapping of B-cell epitopes.
Infect. Immun.
61:1173-1179[Abstract/Free Full Text].
|
| 24.
|
Pearson, W. R., and D. J. Lipman.
1988.
Improved tools for biological sequences comparisons.
Proc. Natl. Acad. Sci. USA
85:2444-2448[Abstract/Free Full Text].
|
| 25.
|
Pessolani, M. C. V.,
D. R. Smith,
B. Rivoire,
J. McCormick,
S. A. Hefta,
S. T. Cole, and P. J. Brennan.
1994.
Purification, characterisation, gene sequence and significance of a bacterioferritin from Mycobacterium leprae.
J. Exp. Med.
180:319-327[Abstract/Free Full Text].
|
| 26.
|
Roche, P. W.,
P. W. Peake,
H. Billman-Jacobe,
T. Doran, and W. J. Britton.
1994.
T-cell determinants and antibody binding sites on the major mycobacterial secretory protein MPB59 of Mycobacterium bovis.
Infect. Immun.
62:5319-5326[Abstract/Free Full Text].
|
| 27.
|
Roche, P. W.,
N. Winter,
J. A. Triccas,
C. Feng, and W. J. Britton.
1996.
Expression of Mycobacterium tuberculosis MPT64 in recombinant M. smegmatis: purification, immunogenicity and application to skin tests for tuberculosis.
Clin. Exp. Immunol.
103:226-232[Medline].
|
| 28.
|
Rouse, D. A.,
S. L. Morris,
A. B. Karpas,
J. C. Mackall,
P. G. Probst, and S. D. Chaparas.
1991.
Immunological characterization of recombinant antigens isolated from a Mycobacterium avium lambda gt11 expression library by using monoclonal antibody probes.
Infect. Immun.
59:2595-2600[Abstract/Free Full Text].
|
| 29.
|
Rouse, D. A.,
S. L. Morris,
A. B. Karpas,
P. G. Probst, and S. D. Chaparas.
1990.
Production, characterization, and species specificity of monoclonal antibodies to Mycobacterium avium complex protein antigens.
Infect. Immun.
58:1445-1449[Abstract/Free Full Text].
|
| 30.
|
Sambrook, J.,
E. F. Fritsch, and T. Maniatis.
1989.
In
Molecular cloning: a laboratory manual, 2nd ed.
Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y.
|
| 31.
|
Sinha, S.,
U. Sengupta,
G. Ramu, and J. Ivanyi.
1985.
Serological survey of leprosy and control subjects by a monoclonal antibody-based immunoassay.
Int. J. Lepr.
53:33-38.
|
| 32.
|
Snapper, C. K.,
R. E. Melton,
S. Mustapha,
T. Kieser, and W. R. Jacobs.
1990.
Isolation and characterization of efficient plasmid transformation mutants of Mycobacterium smegmatis.
Mol. Microbiol.
11:1911-1919.
|
| 33.
|
Talwar, G. P.,
S. A. Zaheer,
R. Mukherjee,
R. Walia,
R. S. Misera,
A. K. Sharma,
H. K. Kar,
R. Mukherjee,
S. K. Pardia,
N. R. Suresh,
S. K. Nair, and R. M. Pandey.
1990.
Immunotherapeutic effects of an anti-leprosy vaccine based on a saprophytic cultivatable mycobacterium, Mycobacterium w, in multibacillary leprosy patients.
Vaccine
8:121-129[Medline].
|
| 34.
|
Thole, J. E. R.,
B. Wieles,
J. E. Clark-Curtiss,
T. H. M. Ottenhoff, and T. F. Rinke de Wit.
1995.
Immunological and functional characterization of Mycobacterium leprae protein antigens: an overview.
Mol. Microbiol.
18:791-800[Medline].
|
| 35.
|
Timm, J.,
E. M. Lim, and B. Gicquel.
1994.
Escherichia coli-mycobacteria shuttle vectors for operon and gene fusions to lacZ: the pJEM series.
J. Bacteriol.
176:6749-6753[Abstract/Free Full Text].
|
| 36.
|
Timm, J.,
M. G. Perilli,
C. Duez,
J. Trias,
G. Orefici,
L. Fattorini,
G. Amicosante,
A. Oratore,
B. Joris,
J. M. Frere,
A. P. Pugsley, and B. Gicquel.
1994.
Transcription and expression analysis, using lacZ and phoA gene fusions, of Mycobacterium fortuitum -lactamase genes cloned from a natural isolate and a high-level -lactamase producer.
Mol. Microbiol.
12:491-504[Medline].
|
| 37.
|
Triccas, J. A.,
P. W. Roche,
N. Winter,
C. G. Feng,
C. R. Butlin, and W. J. Britton.
1996.
A 35-kilodalton protein is a major target of the human immune response to Mycobacterium leprae.
Infect. Immun.
64:5171-5177[Abstract].
|
| 38.
|
Tsang, A. Y.,
J. C. Denner,
P. J. Brennan, and K. McClatchy.
1992.
Clinical and epidemiological importance of typing Mycobacterium avium by amplification of 16S rRNA sequences.
J. Clin. Microbiol.
31:2509-2512[Abstract/Free Full Text].
|
| 39.
|
Winter, N.,
J. A. Triccas,
B. Rivoire,
M. C. V. Pessolani,
K. Eiglmeier,
S. W. Hunter,
P. J. Brennan, and W. J. Britton.
1995.
Characterization of the gene encoding the immunodominant 35 kDa protein Mycobacterium leprae.
Mol. Microbiol.
16:865-876[Medline].
|
| 40.
|
Yadava, A.,
N. R. Suresh,
S. A. Zaheer,
G. P. Talwar, and R. Mukherjee.
1991.
T-cell responses to fractionated antigens of Mycobacterium w, a candidate anti-leprosy vaccine in leprosy patients.
Scand. J. Immunol.
34:23-31[Medline].
|
| 41.
|
Young, D. B.,
S. H. E. Kaufmann,
P. W. M. Hermans, and J. E. R. Thole.
1992.
Mycobacterial protein antigens: a compilation.
Mol. Microbiol.
6:133-145[Medline].
|
Infect Immun, June 1998, p. 2684-2690, Vol. 66, No. 6
0019-9567/98/$04.00+0
Copyright © 1998, American Society for Microbiology. All rights reserved.
This article has been cited by other articles:
-
Bannantine, J. P., Paustian, M. L., Waters, W. R., Stabel, J. R., Palmer, M. V., Li, L., Kapur, V.
(2008). Profiling Bovine Antibody Responses to Mycobacterium avium subsp. paratuberculosis Infection by Using Protein Arrays. Infect. Immun.
76: 739-749
[Abstract]
[Full Text]
-
Parkash, O., Kumar, A., Nigam, A., Girdhar, B. K.
(2006). Detection of antibodies against Mycobacterium leprae culture filtrate protein-10 in leprosy patients.. J Med Microbiol
55: 1337-1341
[Abstract]
[Full Text]
-
Saito, N., Xu, J., Hosaka, T., Okamoto, S., Aoki, H., Bibb, M. J., Ochi, K.
(2006). EshA Accentuates ppGpp Accumulation and Is Conditionally Required for Antibiotic Production in Streptomyces coelicolor A3(2). J. Bacteriol.
188: 4952-4961
[Abstract]
[Full Text]
-
Bannantine, J. P., Huntley, J. F. J., Miltner, E., Stabel, J. R., Bermudez, L. E.
(2003). The Mycobacterium avium subsp. paratuberculosis 35 kDa protein plays a role in invasion of bovine epithelial cells. Microbiology
149: 2061-2069
[Abstract]
[Full Text]
-
Black, G. F., Weir, R. E., Chaguluka, S. D., Warndorff, D., Crampin, A. C., Mwaungulu, L., Sichali, L., Floyd, S., Bliss, L., Jarman, E., Donovan, L., Andersen, P., Britton, W., Hewinson, G., Huygen, K., Paulsen, J., Singh, M., Prestidge, R., Fine, P. E. M., Dockrell, H. M.
(2003). Gamma Interferon Responses Induced by a Panel of Recombinant and Purified Mycobacterial Antigens in Healthy, Non-Mycobacterium bovis BCG-Vaccinated Malawian Young Adults. CVI
10: 602-611
[Abstract]
[Full Text]
-
Saito, N., Matsubara, K., Watanabe, M., Kato, F., Ochi, K.
(2003). Genetic and Biochemical Characterization of EshA, a Protein That Forms Large Multimers and Affects Developmental Processes in Streptomyces griseus. J. Biol. Chem.
278: 5902-5911
[Abstract]
[Full Text]
-
Kawamoto, S., Watanabe, M., Saito, N., Hesketh, A., Vachalova, K., Matsubara, K., Ochi, K.
(2001). Molecular and Functional Analyses of the Gene (eshA) Encoding the 52-Kilodalton Protein of Streptomyces coelicolor A3(2) Required for Antibiotic Production. J. Bacteriol.
183: 6009-6016
[Abstract]
[Full Text]
-
Kwak, J., McCue, L. A., Trczianka, K., Kendrick, K. E.
(2001). Identification and Characterization of a Developmentally Regulated Protein, EshA, Required for Sporogenic Hyphal Branches in Streptomyces griseus. J. Bacteriol.
183: 3004-3015
[Abstract]
[Full Text]
-
Triccas, J. A., Britton, W. J., Gicquel, B.
(2001). Isolation of strong expression signals of Mycobacterium tuberculosis. Microbiology
147: 1253-1258
[Abstract]
[Full Text]
-
Podmore, M., Ebersole, J.L., Kinane, D.F.
(2001). Immunodominant Antigens in Periodontal Disease: a Real or Illusive Concept?. CROBM
12: 179-185
[Abstract]
[Full Text]
-
Martin, E., Kamath, A. T., Triccas, J. A., Britton, W. J.
(2000). Protection against Virulent Mycobacterium avium Infection following DNA Vaccination with the 35-Kilodalton Antigen Is Accompanied by Induction of Gamma Interferon-Secreting CD4+ T Cells. Infect. Immun.
68: 3090-3096
[Abstract]
[Full Text]
-
Bean, A. G. D., Roach, D. R., Briscoe, H., France, M. P., Korner, H., Sedgwick, J. D., Britton, W. J.
(1999). Structural Deficiencies in Granuloma Formation in TNF Gene-Targeted Mice Underlie the Heightened Susceptibility to Aerosol Mycobacterium tuberculosis Infection, Which Is Not Compensated for by Lymphotoxin. J. Immunol.
162: 3504-3511
[Abstract]
[Full Text]
-
Wilkinson, R. J., Wilkinson, K. A., Jurcevic, S., Hills, A., Sinha, S., Sengupta, U., Lockwood, D. N. J., Katoch, K., Altman, D., Ivanyi, J.
(1999). Specificity and Function of Immunogenic Peptides from the 35-Kilodalton Protein of Mycobacterium leprae. Infect. Immun.
67: 1501-1504
[Abstract]
[Full Text]