Previous Article | Next Article 
Infect Immun, July 1998, p. 3088-3094, Vol. 66, No. 7
Departments of Medicine and Microbiology and
Immunology,
Received 2 September 1997/Returned for modification 4 November
1997/Accepted 24 April 1998
Broth culture supernatants from Tox+ Helicobacter
pylori strains induce vacuolation of HeLa cells in vitro
and contain VacA in concentrations that are higher than those
found in supernatants from Tox Helicobacter pylori
organisms are curved, gram-negative bacteria found associated with the
gastric epithelia of humans and other primates. Colonization of the
human stomach with H. pylori consistently results in
the development of gastric mucosal inflammation and is a risk factor
for the development of peptic ulcer disease and gastric adenocarcinoma
(7, 17, 21). One putative virulence determinant of
H. pylori is a unique toxin (VacA) that induces vacuolation of epithelial cells (5, 22). VacA is initially translated as a 140-kDa protoxin, which subsequently undergoes both
N-terminal and C-terminal processing to yield an ~90-kDa mature
secreted toxin (10, 23-25). Deep-etch electron microscopic analysis indicates that VacA forms large, six- or seven-sided complexes
comprised of 12 or 14 subunits (9, 20).
Considerable variation exists among different H. pylori strains in the production of vacuolating cytotoxin
activity. Thus, broth culture supernatants from some H. pylori strains (designated Tox+) induce vacuolation of
HeLa cells in vitro, whereas other H. pylori strains
(designated Tox In this report, we demonstrate that vacA is transcribed in
both Tox+ and Tox Bacteria and culture conditions.
H. pylori
strains were cultured at 37°C in ambient air containing 5%
CO2. The wild-type H. pylori strains used
in this study are listed in Table 1. The
vacA genotypes of all strains were determined by a PCR-based
typing method as previously described (2). Complete or
partial vacA sequences from several of these strains have
been reported previously (Table 1).
Analysis of VacA production.
H. pylori strains
were cultured in sulfite-free brucella broth containing 5% fetal
bovine serum (FBS) for approximately 24 h and harvested after
reaching an optical density at 600 nm (OD600) of about 0.5. After centrifugation of the cultures, the supernatants were
concentrated by ultrafiltration and tested for vacuolating cytotoxin
activity by adding serial dilutions to HeLa cells in tissue culture
medium containing 10 mM ammonium chloride as described previously
(8). The broth culture supernatants were immunoblotted with
rabbit anti-VacA serum prepared by immunizing a rabbit with purified,
denatured VacA from H. pylori 60190 as described
previously (6). As another approach for analyzing
concentrations of VacA in culture supernatants, H. pylori 60190, 86-338, and 86-313 were grown in sulfite-free
brucella broth containing 0.5% activated charcoal, and oligomeric VacA
was purified from the broth culture supernatants as described
previously (9). Yields of purified VacA were assessed by
measuring the OD280 of VacA-containing fractions and by
semiquantitative analysis of the density of VacA bands after sodium
dodecyl sulfate-polyacrylamide gel electrophoresis and silver staining.
Molecular biology methods.
To prepare genomic DNA from
H. pylori, cells were suspended in TE buffer (10 mM
Tris, 1 mM EDTA, pH 8.0) and lysed by the addition of sodium dodecyl
sulfate and proteinase K (final concentrations of 0.5% and 0.1 mg/ml,
respectively) at 37°C for 45 min. Sodium chloride was then added to a
final concentration of 0.7 M, and a solution of 10%
hexadecyltrimethylammonium bromide-0.7 M sodium chloride was added
to yield a final hexadecyltrimethylammonium bromide concentration of
1%. Cell lysates were incubated at 65°C for 10 min. Following the
addition of an equal volume of chloroform, cell debris was cleared by
centrifugation for 10 min at 10,000 × g. Supernatants
were then extracted sequentially with equal volumes of chloroform and
phenol-chloroform (1:1) and precipitated with isopropanol
(3).
0019-9567/98/$04.00+0
Copyright © 1998, American Society for Microbiology. All rights reserved.
Heterogeneity in Levels of Vacuolating Cytotoxin
Gene (vacA) Transcription among Helicobacter
pylori Strains
ABSTRACT
Top
Abstract
Introduction
Materials & Methods
Results & Discussion
References
H. pylori
strains. To investigate the basis for this phenomenon, we
analyzed the transcription of the vacuolating cytotoxin gene (vacA) in eight Tox+ strains (each with a type
s1/m1 vacA genotype) and nine Tox strains
(each with a type s2/m2 vacA genotype). Most of the
Tox+ and Tox strains tested used the same
vacA transcriptional start point, but Tox+
strains yielded significantly stronger primer extension signal intensities than did Tox strains (mean densitometry
values of 15.8 ± 1.9 versus 8.9 ± 1.7, P = 0.0016). Correspondingly, when we introduced
vacA::xylE transcriptional
fusions into the chromosomes of a Tox+ strain (60190) and a
Tox strain (86-313), the level of XylE activity in 60190 vacA::xylE was about 30-fold higher
than that in 86-313 vacA::xylE.
Sequence analysis and promoter exchange experiments indicated that the different levels of vacA transcription in these two strains
cannot be explained solely by a difference in promoter strength. These data indicate that Tox+ and Tox H. pylori strains typically differ not only in the VacA amino acid
sequence but also in the level of vacA transcription.
INTRODUCTION
Top
Abstract
Introduction
Materials & Methods
Results & Discussion
References
) lack detectable vacuolating activity in
this assay (2, 8, 18). In previous studies, it has been
shown that all H. pylori isolates hybridize with
vacA probes (2, 10, 24, 25), but the
vacA alleles in Tox+ strains are typically
considerably different from those in Tox strains (2,
10). A system for classifying vacA alleles has been
developed in which specific families of vacA alleles are associated with the production of detectable vacuolating cytotoxin activity (2). Specifically, most H. pylori
strains with a type s1 vacA signal sequence and a type m1
vacA midregion induce prominent cell vacuolation, whereas
strains with a type s2 signal sequence and type m2 midregion
consistently fail to induce cytotoxic effects (2). In
addition to these vacA sequence differences, there is also
evidence that concentrations of VacA are higher in broth culture
supernatants from Tox+ strains than in supernatants from
Tox strains (6, 8).
strains, but transcription
typically occurs at higher levels in Tox+ strains than in
Tox strains. This variation is not attributable to
differences in vacA transcriptional start points and is not
due solely to differences in vacA promoter strength.
Heterogeneity in vacA transcription levels among
H. pylori strains may be a factor that contributes to
different vacuolating cytotoxin phenotypes.
MATERIALS AND METHODS
Top
Abstract
Introduction
Materials & Methods
Results & Discussion
References
TABLE 1.
Vacuolating cytotoxin activities and vacA
transcriptional activities of H. pylori strains used in
this study
.
Primer extension analysis. Seventeen different H. pylori strains were inoculated into sulfite-free brucella broth containing 5% FBS such that the initial OD600 was approximately 0.05. Cultures were harvested when the OD600 reached approximately 0.5. Total cellular RNA was extracted from the bacterial pellets by using the hot phenol method (12). Standardized (40-µg) RNA samples from each strain were heated to 90°C for 2 min in a buffer consisting of 20 mM Tris (pH 8.0), 100 mM sodium chloride, 0.1 mM EDTA, and 20 ng of a 32P-end-labeled oligonucleotide (5' TTTTTGCACAAAGGGTGCGAC). Following primer annealing at 50°C for 3 h, extension of the labeled primer was accomplished by incubation in 50 mM Tris (pH 8.2)-6 mM MgCl2-10 mM dithiothreitol-0.2 mM deoxynucleoside triphosphates-5 U of avian myeloblastosis virus reverse transcriptase (Promega) for 1 h at 42°C. Primer extension products and sequencing reaction ladders generated by using the same primer were analyzed on 7 M urea-8% polyacrylamide gels. Signal intensities were quantified by densitometry using a GS-670 densitometer and Molecular Analyst version 1.4.1 software (Bio-Rad).
Construction of a vacA::xylE transcriptional fusion in Tox+ H. pylori 60190. The promoterless xylE gene, encoding Pseudomonas putida catechol 2,3-dioxygenase, was fused upstream of a kanamycin resistance gene (hereafter designated km) such that these two genes were transcribed in the same direction and the kanamycin resistance gene retained its native promoter sequence (16). This xylE/km cassette was cloned into the unique BglII site within pCTB6, which contains a vacA gene fragment of H. pylori 60190 (10). The resultant plasmid construct, pCTB6::xylE/km, was used to introduce the xylE/km cassette into vacA of H. pylori 60190 by natural transformation and allelic exchange (10). Transformants were selected on brucella agar plates supplemented with 5% FBS and kanamycin (40 µg/ml). The orientation of the cassette in the transformants was determined by PCR with a xylE-specific forward primer (5' CATGACGTCACCTCTTCATAG) and a vacA-specific reverse primer (5' GCCTTTTTTACAACCGTGATC). The resultant Tox+ vacA reporter strain, with xylE in the same orientation as vacA transcription, is designated 60190 VX-1 (see Fig. 4A).
Construction of a vacA::xylE
transcriptional fusion in Tox H. pylori
86-313.
A 1.3-kb internal fragment of vacA from
Tox strain 86-313 was PCR amplified by using primers
5' CCCACGCAAGTCATTGATGG 3' and 5' GGTATTATTTTTTCGCACCAC
3' (2) and cloned into pT7 Blue (Novagen), resulting
in pA144. The xylE/km cassette described above was cloned into the unique EcoRV site within this vacA
sequence. The resulting plasmid, pA144::xylE/km,
was introduced into strain 86-313 via natural transformation, and
kanamycin-resistant colonies were selected. The resulting 86-313 vacA::xylE reporter strain, with xylE in the same orientation as vacA
transcription, is designated 86-313 VX-1 (see Fig. 3A).
Construction of chimeric strains with alternate vacA
promoters.
To place the vacA::xylE
transcriptional fusion in strain 86-313 VX-1 under the control of a
Tox+ promoter, a 1.3-kb fragment was amplified from
Tox+ 60190 genomic DNA by using primers 5'
AATTACTTGCTAGGGGTGCATTAT 3' and 5' ATCAGCACTATCCTTATAGCTTG
3'. This fragment contains 519 bp from the 3' end of
cysS, the cysS-vacA intergenic region, and 548 bp
from the 5' end of vacA and was cloned into pT7Blue
(Novagen) to yield pBW5. The chloramphenicol acetyltransferase
(cat) gene of Campylobacter coli (26)
was then cloned into the HindIII site at the 3' terminus
of cysS, in the orientation opposite to that of
vacA to yield pBW5cat (see Fig. 3B). This plasmid
was used to introduce the Tox+ vacA promoter and
adjacent sequences into the Tox reporter strain 86-313 VX-1 described above. Transformants were screened on brucella agar
containing 5% FBS and chloramphenicol (10 µg/ml). The extent of
replacement of 86-313 sequences with 60190 sequences in the resulting
Kmr Cmr 86-313 VX-1 transformants was
determined by PCR amplification and sequencing of the
cysS-vacA intergenic region. The chimeric strain shown in
Fig. 3B is designated 86-313 VXC-1.
promoter, a DNA fragment was amplified from Tox strain
86-313 by using primers 5' GAAGAACTGCTTGGCATCGGG 3' and 5' ATTCCATTTTCTTCCTTTC 3'. This fragment contains 221 bp of
cysS, the entire cysS-vacA intergenic region, and
the first 7 bp of the vacA structural gene. The resulting
PCR product was cloned into pBluescript SK+ to yield pBW3. A unique
BglII site was introduced 3 bp downstream of the stop codon
of cysS in pBW3 by inverse PCR mutagenesis by using primers
with BglII sites incorporated at the 5' ends (5'
GAAGATCTAGCTTAAAAAAGCTTCTCCCAAATCGTGCC and 5' GAAGATCTTCTTTAAATTTTACCTATTTACGCACTC) to yield pBW4. The
cat gene from C. coli (26) was cloned
into the BglII site after ends were made blunt by treatment
with Klenow fragment (3). A construct, designated
pBW4cat, was selected in which cat and
vacA are divergently transcribed (see Fig. 4B). To replace
the native vacA promoter in Tox+ reporter strain
60190 VX-1 with the vacA promoter from Tox
strain 86-313, strain 60190 VX-1 was transformed with
pBW4cat. Cmr Kmr transformants were
selected, and the extent of sequence replacement was determined by PCR
amplifying and sequencing the entire cysS-vacA intergenic
region of the transformants. The resulting chimeric strain shown in
Fig. 4B is designated 60190 VXC-1.
The introduction of heterologous promoter sequences into either of the
chimeric reporter strains required the presence of two different
selectable markers (described above). To determine whether introduction
of the cat gene alone altered levels of vacA transcription, this gene was introduced into the chromosomes of strains
60190 VX-1 and 86-313 VX-1 in the same orientation and at the same
sites as described previously. This was accomplished by transformation
of strain 86-313 VX-1 with pBW4cat to generate an isogenic
Kmr Cmr Tox reporter strain
(86-313 VX-1 cat control) with a cat marker at the 3' terminus of cysS (see Fig. 3C). A similar control for
the Tox+ reporter, 60190 VX-1, was generated by
transformation with pCTB2cat to yield the isogenic
Kmr Cmr reporter strain 60190 VX-1
cat control (see Fig. 4C).
Assay for XylE activity. XylE activity was assessed qualitatively at the colony level by spraying colonies grown on brucella agar-5% FBS-kanamycin (40 µg/ml) with 20 mM catechol in distilled water and visually examining colonies for the yellow reaction product 2-hydroxymuconic semialdehyde. For quantitative assays, cells were harvested from broth cultures by centrifugation and resuspended in 50 mM potassium phosphate buffer (pH 7.5), and the cell density was quantified and standardized by measuring OD600. Catechol was added to a final concentration of 3 mM, and enzyme specific activities were determined spectrophotometrically in a Beckman DU 7400 spectrophotometer at 375 nm (11, 27). One unit of XylE activity corresponds to the formation at 22°C of 1 mmol of 2-hydroxymuconic semialdehyde/min (molar extinction coefficient, 4.4 × 104).
| |
RESULTS AND DISCUSSION |
|---|
|
Top
Abstract
Introduction
Materials & Methods
Results & Discussion
References
|
|---|
Characterization of VacA production by a panel of H. pylori strains.
In this study, we analyzed eight
H. pylori strains with a type s1/m1 vacA
genotype and nine strains with a type s2/m2 vacA genotype
(Table 1). Each strain was grown in broth culture until a standardized
OD600 was reached, and the broth culture supernatants then
were concentrated by ultrafiltration and tested in a HeLa cell
vacuolation assay. Broth culture supernatants from each of the type
s1/m1 strains (Tox+) induced vacuolation of HeLa cells,
whereas supernatants from each of the type s2/m2 strains
(Tox) did not (Table 1). Immunoblotting studies with
anti-VacA serum indicated that an immunoreactive ~90-kDa band was
present in broth culture supernatants from all 17 strains (data not
shown). However, when standardized amounts of supernatant protein from
different strains were immunoblotted and compared, the VacA bands in
Tox+ supernatants tended to be darker than those in
Tox supernatants. To compare the concentrations of VacA
in Tox+ and Tox supernatants by another
approach, VacA was purified from standardized volumes of culture
supernatant from three strains (Tox+ strain 60190, Tox strain 86-338, and Tox strain 86-313)
and the yields of purified VacA were analyzed as described in Materials
and Methods. The broth culture supernatant from H. pylori 60190 yielded about 10-fold higher quantities of purified
oligomeric VacA than did the supernatant from strain 86-338 and
>50-fold higher quantities than the supernatant from strain 86-313 (data not shown). These data indicate that all of the H. pylori strains tested produce a VacA product, but supernatants from Tox+ strains contain higher concentrations of VacA
than do supernatants from Tox strains.
Primer extension analysis of vacA transcription.
To investigate a possible basis for the different concentrations of
VacA in supernatants from Tox+ and Tox
strains, we analyzed vacA transcription in the panel of 17 H. pylori strains by quantitative primer extension
analysis (Fig. 1). The primer for these
experiments (Fig. 2) was chosen based on
the fact that its sequence was 100% complementary to the corresponding vacA sequences of the seven different Tox+ and
three Tox strains sequenced to date (including strains
60190, 84-183, 87-199, Tx30a, 86-313, and 87-203 from the current
study), thereby reducing the possibility that varying signal strengths
could be due to inefficient primer annealing. As shown in Fig. 1,
vacA transcription was detected in all 17 strains, and 15 strains (7 Tox+ and 8 Tox) used the same
conserved single transcriptional start point (TSP). This site was
located 1 nucleotide downstream from the vacA
transcriptional start site identified in a previous study
(24). The use of a second primer
(5'AGAGGGCGATTGATTTTGCGGTGTG), which anneals farther downstream within the vacA coding region, confirmed the use
of this TSP and failed to demonstrate any alternate start sites (data not shown). A variant Tox+ strain (92-29) appeared to use a
TSP located 1 bp closer to the translational start codon (Fig. 1),
which could potentially be due to a 1-bp deletion within the 5'
untranslated region of this strain. A variant Tox strain
(87-75) simultaneously used three different, adjacent nucleotides as
TSPs (Fig. 1). The conservation of adenosine as the +1 site for
vacA transcription in most strains may be important, because
it has been demonstrated that the identity of the +1 site can affect
transcriptional efficiency (19). Although most strains used
the same vacA TSP, there was considerable variation in the intensity of primer extension signals (Fig. 1). Primer extension signals from eight Tox+ strains were significantly more
intense than signals from nine Tox strains (relative
densitometry OD values [mean ± the standard error of the mean]
of 15.8 ± 1.9 versus 8.9 ± 1.7, P = 0.0016) (Fig. 1), although there were outliers in both groups. These data indicate that Tox+ and Tox H. pylori strains differ in the level of vacA
transcription.
|
|
Introduction of vacA::xylE
transcriptional fusions into H. pylori 60190 and
86-313.
To investigate further the apparent differences among
strains in the level of vacA transcription, we introduced
vacA::xylE transcriptional fusions into
the chromosomes of two H. pylori strains,
Tox+ strain 60190 and Tox strain 86-313. These two strains were chosen based on the primer extension data, which
indicated a difference in the level of vacA transcription
(Fig. 1), and because both strains were known to be naturally
competent for transformation (unpublished data). The introduction
of vacA::xylE transcriptional
fusions into strains 60190 and 86-313 yielded strains 60190 VX-1
and 86-313 VX-1, respectively (Fig.
3A and
4A). The XylE activity
was more than 30-fold higher in Tox+ reporter strain 60190 VX-1 than in Tox reporter strain 86-313 VX-1 (76,500 ± 500 versus 2,136 ± 500 mU/OD600, P < 0.001). Thus, both primer extension analysis and vacA::xylE transcriptional fusion data
indicated that these two strains differ in the level of vacA
transcription.
|
|
Comparison of vacA promoter strengths in H. pylori 60190 and 86-313.
One possible explanation for
differential vacA transcription among strains is the
occurrence of variations in vacA promoters. Such a
phenomenon accounts for the active transcription of the pertussis toxin
operon in Bordetella pertussis and the presence of a silent
toxin operon in B. parapertussis and B. bronchiseptica (1). Although the precise locations of
vacA promoter sequences in H. pylori have
not been determined, putative 
10 and 35 hexamers can be inferred
based on spacing relative to the vacA transcriptional start
point and comparison with E. coli consensus sequences. A comparison of the putative vacA 10 and 35 sequences in
H. pylori 60190 and 86-313 reveals no obvious
differences that would account for the different levels of
vacA transcription in these two strains (Fig. 2). A second
potential explanation for the demonstrated difference in
vacA transcription might be varying numbers of binding sites
for a trans-acting factor. This possibility is relevant because unlike that of Tox+ strain 60190, the
cysS-vacA intergenic region of Tox strain
86-313 contains a 63-bp insertion (14). This 63-bp insertion contains a 36-bp segment that is duplicated a few base pairs farther downstream (Fig. 2).
reporter strain 86-313 VX-1 was placed under the control of the vacA promoter region from Tox+ strain 60190. Sequence analysis confirmed that in this chimeric reporter strain
(86-313 VXC-1), an exchange of promoter and signal sequences had taken
place and that the 63-bp insertion had been eliminated (Fig. 3B).
Nevertheless, there was no increase in XylE activity in response to the
heterologous promoter sequences (Fig. 5).
These data indicate that the constraint on transcription in strain
86-313 is not the consequence of either a weak promoter or
cis-acting sequences in the promoter region.
|
strain
86-313. Sequence analysis of the DNA from the resulting chimeric
reporter, 60190 VXC-1, confirmed that all 73 bp upstream from the
promoter, the putative 35 and 10 sequences, and the 5' untranslated
region through +87 in this chimeric strain had been replaced with
sequences from strain 86-313 (Fig. 4B). The level of XylE activity in
this chimera was about 65% less than that of the control strain, 60190 VX-1 cat control (Fig. 5; P < 0.001).
However, the level of XylE activity in the chimeric strain was still
about 10-fold higher than that in Tox reporter strain
86-313 VX-1 (Fig. 5).
The results of these promoter exchange experiments suggest that strains
60190 and 86-313 differ in vacA promoter strength. However,
any such difference must be dictated by sequences outside the putative
10 and 35 hexamers, since these sequences are identical in the two
strains. An important finding is that the Tox (strain
86-313) vacA promoter is capable of initiating higher levels
of vacA mRNA synthesis in the strain 60190 background than in the strain 86-313 background. Therefore, it seems likely that the
vacA transcription level difference between these two
strains is not due solely to a difference in vacA promoter
strength. One possibility is the expression of a
trans-acting repressor factor in strain 86-313, or
alternatively, that strain 60190 produces an activator factor which is
absent or reduced in quantity or function in strain 86-313.
Another possible explanation for these data is that strains 60190 and
86-313 differ in vacA transcript stability. To investigate this possibility, we attempted to determine the half-lives of vacA transcripts in these two strains by using serial
quantitative primer extension analyses of bacterial cells that had been
treated with rifampin to inhibit RNA polymerase activity. These
experiments repeatedly yielded nonlinear patterns of primer
extension signal decay, and therefore, it remains unclear whether
strains 60190 and 86-313 differ in vacA transcript
stability. Important determinants of mRNA stability in
prokaryotic organisms include stem-loop structures located at
either the 5' or the 3' ends of transcripts (4, 12, 13). In
the promoter switching experiments described in this report, we
replaced the entire 5' untranslated region of vacA from
strain 86-313 with that from strain 60190 and failed to demonstrate any
significant increase in vacA transcription in the chimeric
strain (86-313 VXC-1, Fig. 3). This suggests that sequences at the 5'
end of vacA mRNA do not significantly alter vacA
mRNA stability. Both Tox+ and Tox strains
that have been analyzed thus far contain prominent stem-loop structures
at the 3' ends of vacA transcripts (2, 10), and thus, there is also no evidence that sequence differences in this region would contribute to different vacA mRNA stability.
Determinants of the vacuolating cytotoxin phenotype.
The two
groups of H. pylori strains analyzed in this study
(Tox+ and Tox) clearly differ in the capacity
to induce vacuolation of HeLa cells. One explanation for this
difference, supported by data in this study, as well as previous
studies (6, 8), is that there are higher concentrations of
VacA in broth culture supernatant from Tox+ strains than in
supernatant from Tox strains. Heterogeneity among strains
in the level of vacA transcription would undoubtedly be a
factor that contributes to this phenomenon. In addition, there also may
be heterogeneity among strains in the efficiency of vacA
secretion, possibly related to differences in vacA signal
sequences (2). In support of this hypothesis, in the present
study, we detected 10-fold higher concentrations of VacA in supernatant
from Tox+ H. pylori 60190 than in
supernatant from Tox H. pylori 86-338 but
found that the two strains did not differ substantially in the level of
vacA transcription (Fig. 1 and Table 1).
strains analyzed in this study
produce vacA products (types s1/m1 and s2/m2, respectively)
that have markedly different amino acid sequences. Specifically, type
s1/m1 and type s2/m2 VacA proteins are only about 58% identical
within a 250-amino-acid midregion segment (2). These
substantial differences would be expected to result in considerably
different structural and functional properties. Nevertheless, in
previous studies, we have demonstrated that a type s2/m2 VacA
protein is capable of assembling into a complex oligomeric structure
that is almost identical to that of type s1/m1 VacA proteins
(9). To determine whether the different amino acid sequences
of type s1/m1 and s2/m2 VacA proteins are important determinants of the
vacuolating cytotoxin phenotype, we purified VacA oligomers from
culture supernatants of strains 60190 (type s1/m1 VacA) and 86-338 (type s2/m2 VacA) and tested equal concentrations of the two
acid-activated proteins in a HeLa cell vacuolation assay. This
experiment indicated that the s1/m1 VacA protein produced prominent
cell vacuolation, as expected, whereas the type s2/m2 VacA protein
lacked any detectable activity in this assay. Thus, equal
concentrations of VacA from Tox+ and Tox
strains are not equal in toxicity.
In summary, the vacuolating cytotoxin phenotype of an H. pylori strain is dependent on the amino acid sequence of its
vacA product but may also be modulated by other
strain-specific factors, such as the level of vacA
transcription or the efficiency of VacA secretion. The considerable
variation in these determinants among H. pylori strains
is consistent with the high level of genetic diversity that exists in
the H. pylori species (15) and may be
relevant to the occurrence of different clinical outcomes in H. pylori-infected humans.
| |
ACKNOWLEDGMENTS |
|---|
This work was supported by grant AI 39657 from the National Institutes of Health and by the Medical Research Service of the Department of Veterans Affairs. J.A. is the recipient of a Clinician Scientist Fellowship from the Medical Research Council (United Kingdom).
We thank Beverly Hosse for technical assistance and Mikio Karita for his gift of the xylE/km cassette.
| |
FOOTNOTES |
|---|
* Corresponding author. Mailing address: Division of Infectious Diseases, Medical Center North A3310, Vanderbilt University School of Medicine, Nashville, TN 37232-2605. Phone: (615) 322-2035 Fax: (615) 343-6160 E-mail: COVERTL{at}ctrvax.vanderbilt.edu.
Editor: J. G. Cannon
| |
REFERENCES |
|---|
|
Top
Abstract
Introduction
Materials & Methods
Results & Discussion
References
|
|---|
| 1. |
Arico, B., and R. Rappuoli.
1987.
Bordetella parapertussis and Bordetella bronchiseptica contain transcriptionally silent pertussis toxin genes.
J. Bacteriol.
169:2847-2853 |
| 2. |
Atherton, J. C.,
P. Cao,
R. M. Peek, Jr.,
M. K. R. Tummuru,
M. J. Blaser, and T. L. Cover.
1995.
Mosaicism in vacuolating cytotoxin alleles of Helicobacter pylori: association of specific vacA types with cytotoxin production and peptic ulceration.
J. Biol. Chem.
270:17771-17777 |
| 3. | Ausubel, F. M., R. Brent, R. E. Kingston, D. D. Moore, J. G. Seidman, J. A. Smith, and K. Struhl. 1994. Current protocols in molecular biology. Wiley-Interscience, New York, N.Y. |
| 4. | Chen, C. Y., J. T. Beatty, S. N. Cohen, and J. G. Belasco. 1988. An intercistronic stem-loop structure functions as an mRNA decay terminator necessary but insufficient for puf mRNA stability. Cell 52:609-619[Medline]. |
| 5. | Cover, T. L. 1996. The vacuolating cytotoxin of Helicobacter pylori. Mol. Microbiol. 20:241-246[Medline]. |
| 6. |
Cover, T. L., and M. J. Blaser.
1992.
Purification and characterization of the vacuolating toxin from Helicobacter pylori.
J. Biol. Chem.
267:10570-10575 |
| 7. | Cover, T. L., and M. J. Blaser. 1996. Helicobacter pylori infection, a paradigm for chronic mucosal inflammation: pathogenesis and implications for eradication and prevention. Adv. Intern. Med. 41:85-117[Medline]. |
| 8. |
Cover, T. L.,
P. Cao,
C. D. Lind,
K. T. Tham, and M. J. Blaser.
1993.
Correlation between vacuolating cytotoxin production by Helicobacter pylori isolates in vitro and in vivo.
Infect. Immun.
61:5008-5012 |
| 9. |
Cover, T. L.,
P. I. Hanson, and J. E. Heuser.
1997.
Acid-induced dissociation of VacA, the Helicobacter pylori vacuolating cytotoxin, reveals its pattern of assembly.
J. Cell Biol.
138:759-769 |
| 10. |
Cover, T. L.,
M. K. R. Tummuru,
P. Cao,
S. A. Thompson, and M. J. Blaser.
1994.
Divergence of genetic sequences for the vacuolating cytotoxin among Helicobacter pylori strains.
J. Biol. Chem.
269:10566-10573 |
| 11. | Curcic, R., S. Dhandayuthapani, and V. Deretic. 1994. Gene expression in mycobacteria: transcriptional fusions based on xylE and analysis of the promoter region of the response regulator mtrA from Mycobacterium tuberculosis. Mol. Microbiol. 13:1057-1064[Medline]. |
| 12. |
Emory, S. A., and J. G. Belasco.
1990.
The ompA 5' untranslated RNA segment functions in Escherichia coli as a growth-rate-regulated mRNA stabilizer whose activity is unrelated to translational efficiency.
J. Bacteriol.
172:4472-4481 |
| 13. |
Emory, S. A.,
P. Bouvet, and J. G. Belasco.
1992.
A 5' terminal stem-loop structure can stabilize mRNA in Escherichia coli.
Genes Dev.
6:135-148 |
| 14. | Garner, J. A., and T. L. Cover. 1995. Analysis of genetic diversity in cytotoxin-producing and non-cytotoxin-producing Helicobacter pylori strains. J. Infect. Dis. 172:290-293[Medline]. |
| 15. |
Go, M. F.,
V. Kapur,
D. Y. Graham, and J. M. Musser.
1996.
Population genetic analysis of Helicobacter pylori by multilocus enzyme electrophoresis: extensive allelic diversity and recombinational population structure.
J. Bacteriol.
178:3934-3938 |
| 16. | Karita, M., M. K. R. Tummuru, H. P. Wirth, and M. J. Blaser. 1996. Effect of growth phase and acid shock on Helicobacter pylori cagA expression. Infect. Immun. 64:4501-4507[Abstract]. |
| 17. | Labigne, A., and H. deReuse. 1996. Determinants of Helicobacter pylori pathogenicity. Infect. Agents Dis. 5:191-202[Medline]. |
| 18. |
Leunk, R. D.,
P. T. Johnson,
B. C. David,
W. G. Kraft, and D. R. Morgan.
1988.
Cytotoxic activity in broth-culture filtrates of Campylobacter pylori.
J. Med. Microbiol.
26:93-99 |
| 19. |
Liu, J., and C. L. Turnbough, Jr.
1994.
Effects of transcriptional start site sequence and position on nucleotide-sensitive selection of alternative start sites at the pyrC promoter in Escherichia coli.
J. Bacteriol.
176:2938-2945 |
| 20. |
Lupetti, P.,
J. E. Heuser,
R. Manetti,
P. Massari,
S. Lanzaecchia,
P. L. Bellon,
R. Dallai,
R. Rappuoli, and J. L. Telford.
1996.
Oligomeric and subunit structure of the Helicobacter pylori vacuolating cytotoxin.
J. Cell Biol.
133:801-807 |
| 21. | Mobley, H. L. T. 1996. Defining Helicobacter pylori as a pathogen: strain heterogeneity and virulence. Am. J. Med. 100:25-115. |
| 22. |
Papini, E.,
M. de Bernard,
E. Milia,
M. Bugnoli,
M. Zerial,
R. Rappuoli, and C. Montecucco.
1994.
Cellular vacuoles induced by Helicobacter pylori originate from late endosomal compartments.
Proc. Natl. Acad. Sci. USA
91:9720-9724 |
| 23. |
Phadnis, S. H.,
D. Ilver,
L. Janzon,
S. Normark, and T. U. Westblom.
1994.
Pathological significance and molecular characterization of the vacuolating cytotoxin gene of Helicobacter pylori.
Infect. Immun.
62:1557-1565 |
| 24. | Schmitt, W., and R. Haas. 1994. Genetic analysis of the Helicobacter pylori vacuolating cytotoxin: structural similarities with the IgA protease type of exported protein. Mol. Microbiol. 12:307-319[Medline]. |
| 25. |
Telford, J. L.,
P. Ghiara,
M. Dell'Orco,
M. Comanducci,
D. Burroni,
M. Bugnoli,
M. F. Tecce,
S. Censini,
A. Covacci,
Z. Xiang,
E. Papini,
C. Montecucco,
L. Parente, and R. Rappuoli.
1994.
Gene structure of the Helicobacter pylori cytotoxin and evidence of its key role in gastric disease.
J. Exp. Med.
179:1653-1658 |
| 26. | Wang, Y., and D. E. Taylor. 1990. Chloramphenicol resistance in Campylobacter coli: nucleotide sequence, expression, and cloning vector construction. Gene 94:23-28[Medline]. |
| 27. |
Zukowski, M., M.,
D. E. Gaffney,
D. Speck,
M. Kauffmann,
A. Findeli,
A. Wisecup, and J. P. Lecocq.
1983.
Chromogenic identification of genetic regulatory signals in Bacillus subtilis based on expression of a cloned Pseudomonas gene.
Proc. Natl. Acad. Sci. USA
80:1101-1105 |
Infect Immun, July 1998, p. 3088-3094, Vol. 66, No. 7
0019-9567/98/$04.00+0
Copyright © 1998, American Society for Microbiology. All rights reserved.
This article has been cited by other articles:
-
Chitcholtan, K., Hampton, M. B., Keenan, J. I.
(2008). Outer membrane vesicles enhance the carcinogenic potential of Helicobacter pylori. Carcinogenesis
29: 2400-2405
[Abstract] [Full Text] -
Loh, J. T., Forsyth, M. H., Cover, T. L.
(2004). Growth Phase Regulation of flaA Expression in Helicobacter pylori Is luxS Dependent. Infect. Immun.
72: 5506-5510
[Abstract] [Full Text] -
Owen, R. J., Xerry, J., Gotada, T., Naylor, G., Tompkins, D.
(2004). Analysis of geospecific markers for Helicobacter pylori variants in patients from Japan and Nigeria by triple-locus nucleotide sequence typing. Microbiology
150: 151-161
[Abstract] [Full Text] -
Ismail, S., Hampton, M. B., Keenan, J. I.
(2003). Helicobacter pylori Outer Membrane Vesicles Modulate Proliferation and Interleukin-8 Production by Gastric Epithelial Cells. Infect. Immun.
71: 5670-5675
[Abstract] [Full Text] -
Letley, D. P., Rhead, J. L., Twells, R. J., Dove, B., Atherton, J. C.
(2003). Determinants of Non-toxicity in the Gastric Pathogen Helicobacter pylori. J. Biol. Chem.
278: 26734-26741
[Abstract] [Full Text] -
McClain, M. S., Iwamoto, H., Cao, P., Vinion-Dubiel, A. D., Li, Y., Szabo, G., Shao, Z., Cover, T. L.
(2003). Essential Role of a GXXXG Motif for Membrane Channel Formation by Helicobacter pylori Vacuolating Toxin. J. Biol. Chem.
278: 12101-12108
[Abstract] [Full Text] -
Cover, T. L., Krishna, U. S., Israel, D. A., Peek, R. M. Jr.
(2003). Induction of Gastric Epithelial Cell Apoptosis by Helicobacter pylori Vacuolating Cytotoxin. Cancer Res.
63: 951-957
[Abstract] [Full Text] -
Forsyth, M. H., Cao, P., Garcia, P. P., Hall, J. D., Cover, T. L.
(2002). Genome-Wide Transcriptional Profiling in a Histidine Kinase Mutant of Helicobacter pylori Identifies Members of a Regulon. J. Bacteriol.
184: 4630-4635
[Abstract] [Full Text] -
McClain, M. S., Cao, P., Iwamoto, H., Vinion-Dubiel, A. D., Szabo, G., Shao, Z., Cover, T. L.
(2001). A 12-Amino-Acid Segment, Present in Type s2 but Not Type s1 Helicobacter pylori VacA Proteins, Abolishes Cytotoxin Activity and Alters Membrane Channel Formation. J. Bacteriol.
183: 6499-6508
[Abstract] [Full Text] -
Vinion-Dubiel, A. D., McClain, M. S., Cao, P., Mernaugh, R. L., Cover, T. L.
(2001). Antigenic Diversity among Helicobacter pylori Vacuolating Toxins. Infect. Immun.
69: 4329-4336
[Abstract] [Full Text] -
Xu, Q., Blaser, M. J.
(2001). Promoters of the CATG-Specific Methyltransferase Gene hpyIM Differ between iceA1 and iceA2 Helicobacter pylori Strains. J. Bacteriol.
183: 3875-3884
[Abstract] [Full Text] -
Ando, T., Perez-Perez, G. I., Kusugami, K., Ohsuga, M., Bloch, K. C., Blaser, M. J.
(2000). Anti-CagA Immunoglobulin G Responses Correlate with Interleukin-8 Induction in Human Gastric Mucosal Biopsy Culture. CVI
7: 803-809
[Abstract] [Full Text] -
De Gusmão, V. R., Nogueira Mendes, E., De Magalhães Queiroz, D. M., Aguiar Rocha, G., Camargos Rocha, A. M., Ramadan Ashour, A. A., Teles Carvalho, A. S.
(2000). vacA Genotypes in Helicobacter pylori Strains Isolated from Children with and without Duodenal Ulcer in Brazil. J. Clin. Microbiol.
38: 2853-2857
[Abstract] [Full Text] -
Forsyth, M. H., Cover, T. L.
(2000). Intercellular Communication in Helicobacter pylori: luxS Is Essential for the Production of an Extracellular Signaling Molecule. Infect. Immun.
68: 3193-3199
[Abstract] [Full Text] -
Allen, L.-A. H., Schlesinger, L. S., Kang, B.
(2000). Virulent Strains of Helicobacter pylori Demonstrate Delayed Phagocytosis and Stimulate Homotypic Phagosome Fusion in Macrophages. JEM
191: 115-128
[Abstract] [Full Text] -
Marais, A., Mendz, G. L., Hazell, S. L., Megraud, F.
(1999). Metabolism and Genetics of Helicobacter pylori: the Genome Era. Microbiol. Mol. Biol. Rev.
63: 642-674
[Abstract] [Full Text] -
Doig, P., de Jonge, B. L., Alm, R. A., Brown, E. D., Uria-Nickelsen, M., Noonan, B., Mills, S. D., Tummino, P., Carmel, G., Guild, B. C., Moir, D. T., Vovis, G. F., Trust, T. J.
(1999). Helicobacter pylori Physiology Predicted from Genomic Comparison of Two Strains. Microbiol. Mol. Biol. Rev.
63: 675-707
[Abstract] [Full Text] -
Perez-Perez, G. I., Peek, R. M. Jr., Atherton, J. C., Blaser, M. J., Cover, T. L.
(1999). Detection of Anti-VacA Antibody Responses in Serum and Gastric Juice Samples Using Type s1/m1 and s2/m2 Helicobacter pylori VacA Antigens. CVI
6: 489-493
[Abstract] [Full Text] -
Forsyth, M. H., Cover, T. L.
(1999). Mutational Analysis of the vacA Promoter Provides Insight into Gene Transcription in Helicobacter pylori. J. Bacteriol.
181: 2261-2266
[Abstract] [Full Text] -
Thompson, S. A., Shedd, O. L., Ray, K. C., Beins, M. H., Jorgensen, J. P., Blaser, M. J.
(1998). Campylobacter fetus Surface Layer Proteins Are Transported by a Type I Secretion System. J. Bacteriol.
180: 6450-6458
[Abstract] [Full Text]
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Copyright © 2009 by the American Society for Microbiology. For an alternate route to Journals.ASM.org, visit: http://intl-journals.asm.org | More Info»