IAI FigSearch
Home Help [Feedback] [For Subscribers] [Archive] [Search] [Contents]
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowReprints and Permissions
Right arrow Copyright Information
Right arrow Books from ASM Press
Right arrow MicrobeWorld
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Webb, J. R.
Right arrow Articles by Reed, S. G.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Webb, J. R.
Right arrow Articles by Reed, S. G.

 Previous Article  |  Next Article 

Infect Immun, July 1998, p. 3279-3289, Vol. 66, No. 7
0019-9567/98/$04.00+0
Copyright © 1998, American Society for Microbiology. All rights reserved.

Human and Murine Immune Responses to a Novel Leishmania major Recombinant Protein Encoded by Members of a Multicopy Gene Family

John R. Webb,1,dagger Antonio Campos-Neto,1 Pamela J. Ovendale,2 Tricia I. Martin,1 Erika J. Stromberg,2 Roberto Badaro,3 and Steven G. Reed1,2,4,*

Infectious Disease Research Institute,1 Corixa Corporation,2 and Department of Pathobiology, University of Washington,4 Seattle, Washington, and Federal University of Bahia, Salvador, Bahia, Brazil3

Received 21 January 1998/Returned for modification 4 March 1998/Accepted 20 April 1998

    ABSTRACT
Top
Abstract
Introduction
Materials & Methods
Results
Discussion
References

Vaccination of BALB/c mice with Leishmania major promastigote culture filtrate proteins plus Corynebacterium parvum confers resistance to infection with L. major. To define immunogenic components of this protein mixture, we used sera from vaccinated mice to screen an L. major amastigote cDNA expression library. One of the immunoreactive clones thus obtained encoded a novel protein of L. major with a molecular mass of 22.1 kDa. The predicted amino acid sequence of this clone exhibited significant homology to eukaryotic thiol-specific-antioxidant (TSA) proteins. Therefore, we have designated this protein L. major TSA protein. Southern blot hybridization analyses indicate that there are multiple copies of the TSA gene in all species of Leishmania analyzed. Northern blot analyses demonstrated that the TSA gene is constitutively expressed in L. major promastigotes and amastigotes. Recombinant TSA protein containing an amino-terminal six-histidine tag was expressed in Escherichia coli with the pET17b system and was purified to homogeneity by affinity chromatography. Immunization of BALB/c mice with recombinant TSA protein resulted in the development of strong cellular immune responses and conferred protective immune responses against infection with L. major when the protein was combined with interleukin 12. In addition, recombinant TSA protein elicited in vitro proliferative responses from peripheral blood mononuclear cells of human leishmaniasis patients and significant TSA protein-specific antibody titers were detected in sera of both cutaneous-leishmaniasis and visceral-leishmaniasis patients. Together, these data suggest that the TSA protein may be useful as a component of a subunit vaccine against leishmaniasis.

    INTRODUCTION
Top
Abstract
Introduction
Materials & Methods
Results
Discussion
References

Protozoan parasites of the genus Leishmania cause a spectrum of human diseases that range from a self-healing cutaneous ulcer to a potentially fatal visceral infection, dependent primarily upon the species of parasite involved (for a review, see reference 5). The disease is prevalent in many tropical and subtropical regions of the world, where it is transmitted via the bite of the Phlebotamus sand fly. Treatment generally involves chemotherapy with high doses of pentavalent antimony compounds or various formulations of amphotericin B. However, the increasing prevalence of drug-resistant organisms and the tendency for patients to relapse after an initially successful regimen of chemotherapy underscore the need for an effective prophylactic vaccine reagent.

Infection of inbred strains of mice with Leishmania major has proven to be a valuable model system for studying host immune responses to the parasite. Subcutaneous injection of L. major into BALB/c mice results in a characteristic uncontrolled growth of the parasite at the site of inoculation which then spreads to the local draining lymph nodes. Without intervention, the infection eventually visceralizes and causes the death of the animal. C57BL/6 mice, on the other hand, are able to mount an effective immune response against the L. major parasite and control the infection at an early stage. An abundance of scientific evidence indicates that these distinct patterns of susceptibility are attributable to the differential expansion of distinct CD4+ T-cell subsets. These T-cell subsets are defined by the profile of cytokines that they produce: Th1 cells are biased towards production of interleukin 2 (IL-2) and gamma interferon (IFN-gamma ), whereas Th2 cells produce more IL-4, IL-5, IL-6, and IL-10 (32). In experimental murine leishmaniasis, production of the Th1 cytokine IFN-gamma is associated with resistance to L. major infection (most commonly in C57BL/6 mice) whereas production of the Th2 cytokine IL-4 is associated with extreme susceptibility in BALB/c mice (27, 34, 35, 41). It is therefore plausible to use infection of susceptible BALB/c mice as a system to analyze the protective capability of potential vaccine compounds, providing that appropriate adjuvants are employed to drive the differentiation of the CD4+ effector T-cell response towards a Th1 phenotype. Adjuvants currently used in the experimental BALB/c mouse model include killed Corynebacterium parvum (45) and IL-12 (1, 33). Several recombinant Leishmania antigens have previously been characterized in terms of their ability to confer protection in BALB/c mice and have provided various degrees of success (15, 19, 29, 30, 56). Recently, the purified recombinant antigen LACK was reported to confer high levels of protective immunity in the BALB/c model; however, this protection was entirely dependent upon the presence of IL-12 as an adjuvant (33). To date, no recombinant vaccine reagent is available for use in humans.

We have recently been characterizing the immune responses elicited by L. major promastigote culture filtrate proteins (CFP). Our rationale for analyzing this material is based on previous observations showing that CFP from other intracellular pathogens such as Mycobacterium tuberculosis and Legionella pneumophila contain antigens that are highly immunogenic and protective in vaccine models (2, 6, 20, 21, 39). Similarly, Leishmania promastigote CFP elicit strong in vitro proliferative responses from the draining lymph node cells of L. major-infected BALB/c mice and from leishmaniasis patient peripheral blood mononuclear cells (PBMC). In addition, we have found that immunization of BALB/c mice with L. major promastigote CFP plus C. parvum results in protection from an otherwise lethal challenge of parasites. To identify immunogenic components of the promastigote CFP, we obtained serum samples from CFP-vaccinated BALB/c mice prior to challenge with L. major and used these sera to screen an L. major cDNA expression library. One of the clones thus obtained encoded a novel protein of L. major with significant sequence homology to eukaryotic thiol-specific-antioxidant (TSA) proteins. In this paper we report the molecular characterization and expression of the L. major TSA protein and describe the antigenicity of recombinant TSA protein.

    MATERIALS AND METHODS
Top
Abstract
Introduction
Materials & Methods
Results
Discussion
References

L. major promastigote CFP. L. major (Friedlin strain) promastigotes were cultured at 26°C in M199 (Gibco BRL) containing 10% fetal bovine serum (Hyclone) for 6 to 7 days. At this time, over 90% of the parasites had reached the stationary or metacyclic stage of differentiation. The cells were washed four times with serum-free M199 and incubated overnight at a concentration of 107 promastigotes/ml in a mixture of 50% M199 and 50% RPMI 1640 (serum free). Cultures were centrifuged to remove parasites, and supernatants were concentrated approximately 50-fold by ultrafiltration with a 3-kDa-cutoff filter unit (Amicon). Protein concentration was determined by the Lowry method. For immunogenicity studies, female BALB/c mice (Charles River) were immunized subcutaneously in their footpads with 30 µg of L. major CFP plus 100 µg of C. parvum (Ribi Immunochem). Ten days after the immunization, mice were sacrificed and the draining popliteal lymph nodes were removed. In vitro proliferative responses and cytokine production were measured as described below for recombinant TSA protein.

Library screening. An L. major (Friedlin strain) amastigote cDNA expression library (52) constructed in lambda  Zap (Stratagene) was screened according to the manufacturer's instructions with pooled sera obtained from BALB/c mice immunized with L. major promastigote CFP and C. parvum (see above). Approximately 45,000 plaques were screened with sera (preadsorbed against Escherichia coli lysate) at a dilution of 1:400, and immunoreactive plaques were detected with an alkaline phosphatase-conjugated secondary serum (goat antimouse immunoglobulin G, A, and M [heavy and light chains]; Zymed) and BCIP (5-bromo-4-chloro-3-indolylphosphate toluidinium)-nitroblue tetrazolium substrate (Life Technologies). Three immunoreactive plaques were purified to homogeneity by two subsequent rounds of low-density plaque screening, and Bluescript phagemids were excised from positive clones according to the protocols of the manufacturer (Stratagene).

DNA sequence analysis. DNA sequence analyses were performed on an Applied Biosystems 373 automated sequencer with Taq polymerase and dye-coupled dideoxynucleoside triphosphate terminators or dye-labeled sequencing primers. The sequence of the full-length TSA cDNA was determined by primer-directed sequencing with a set of synthetic oligonucleotide primers (Life Technologies).

Southern and Northern blot hybridization analysis. A Southern blot containing genomic DNA (2.5 µg/lane) isolated from L. major, Leishmania tropica, Leishmania donovani, Leishmania infantum, Leishmania chagasi, Leishmania amazonensis, Leishmania braziliensis, Leishmania guyanensis, Trypanosoma cruzi, and Trypanosoma brucei digested with the restriction enzymes indicated in Fig. 3 was kindly provided by D. Dillon (Corixa Corp.). The blot was hybridized with an EcoRI/XhoI restriction fragment of clone TSA (encompassing the entire TSA protein cDNA) labeled to high specific activity (~109 cpm/µg) with [alpha -32P]dCTP by the random-primer method (16). The blot was subsequently washed to a stringency of 0.5× SSC (1× SSC is 0.15 M NaCl plus 0.015 M sodium citrate) at 65°C and analyzed by autoradiography. Northern blotting was performed with total parasite RNA (5 µg) separated by electrophoresis on formaldehyde agarose gels and blotted overnight to Nytran membrane (Schleicher and Schuell) in 10× SSC. Northern blots were hybridized with the 32P-labeled EcoRI/XhoI restriction fragment of clone TSA as described above for Southern blots.

Expression and purification of recombinant TSA protein. The TSA protein gene open reading frame was modified by PCR amplification to contain an amino-terminal six-histidine tag with the synthetic oligonucleotides 5'-CAATT ACATATGCATCACCATCACCATCACATGTCCTGCGGTAACGCCAA G-3' as a 5'-end-specific primer and 5'-CATGGAATTCTTACTGCTTGCTGAAGTATCC-3' as a 3'-end-specific primer. The resulting PCR product was digested with NdeI and EcoRI and subcloned into an NdeI- and EcoRI-digested pET17b vector (Novagen). Ligation products were transformed into E. coli BL21(DE3)pLysE for high-level protein expression. Five-hundred-milliliter cultures of recombinant E. coli were induced to express recombinant TSA protein at mid-log phase of growth by the addition of 2 mM IPTG (isopropyl-beta -D-thiogalactopyranoside). Growth was continued for 3 to 4 h, and bacteria were pelleted and washed once with cold phosphate-buffered saline (PBS). Bacteria were resuspended in 20 ml of lysis buffer (50 mM Na2HPO4 [pH 8.0], 300 mM NaCl, 2 mM phenylmethylsulfonyl fluoride, 200 µg of leupeptin per ml) containing 0.75 mg of lysozyme per ml, lysed by a 1-h incubation at 4°C, and then briefly sonicated. Insoluble material was removed from the lysate by centrifugation at 10,000 × g for 10 min, and recombinant protein was found to be evenly distributed between the soluble and insoluble fractions. Insoluble material was discarded at this point, and soluble recombinant protein containing the amino-terminal histidine tag was affinity purified with Ni-nitrilotriacetic acid (NTA) resin (Qiagen) according to the manufacturer's protocols. Briefly, 8 ml of Ni-NTA resin resuspended in lysis buffer was added to the soluble E. coli lysate fraction and binding was conducted with constant mixing for 1 h at 4°C. The mixture was then loaded into a gravity flow column, and the nonbinding material was allowed to flow through. The Ni-NTA matrix was washed three times with 25 ml of wash buffer (50 mM Na2HPO4 [pH 6.0], 300 mM NaCl), and bound material was eluted in 25 ml of elution buffer (50 mM Na2HPO4 [pH 4.5], 300 mM NaCl). The eluted material was dialyzed against three changes of 10 mM Tris HCl, pH 8.0, filtered under sterile conditions, and stored at -20°C. The purified recombinant protein was shown by sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE) analysis to be free of any significant amount of E. coli protein. The amount of endotoxin in purified recombinant TSA protein was determined to be 30.4 endotoxin units/mg by the Limulus assay (BioWhittaker). The manufacturer of this assay suggests that 1 endotoxin unit equals approximately 0.1 ng of endotoxin. Recombinant TSA protein was used at a maximum concentration of 25 µg/ml for in vitro proliferation-cytokine assays, which translates into approximately 75 pg of endotoxin per ml. A polyclonal antiserum against recombinant TSA protein was generated in mice by repeated subcutaneous injection of recombinant protein in incomplete Freund's adjuvant (IFA).

In vitro analyses of TSA protein immunoreactivity. TSA protein-specific antibody titers in the sera of immunized mice were determined by a standard enzyme-linked immunosorbent assay (ELISA) procedure. Briefly, serial dilutions of sera obtained from mice after immunization with either CFP plus C. parvum or recombinant TSA protein plus IFA were added to 96-well plates previously coated with recombinant TSA protein (200 ng/well). After a 1-h incubation at room temperature, plates were washed extensively with PBS containing 0.1% Tween 20 and incubated for 1 h with secondary antibody (horseradish peroxidase-conjugated goat anti-mouse immunoglobulin G [Zymed]). After five washes in PBS containing 0.1% Tween 20, plates were developed with TNB substrate (Kirkegaard and Perry Laboratories) and absorbance was read at 450 nm. The titer of TSA protein-specific antibody in human leishmaniasis patient serum was determined in the same manner except that bound antibody was detected with horseradish peroxidase-conjugated protein A (Zymed).

T-cell immunogenicity was evaluated by subcutaneously injecting mice with 25 µg of recombinant TSA protein in IFA and recovering the draining popliteal lymph node cells 10 days later. Bulk lymph node cell suspensions (prepared in RPMI 1640 [Gibco BRL] containing 10% heat-inactivated fetal calf serum [Hyclone], 25 mM HEPES, and 50 µM 2-mercaptoethanol) were incubated in 96-well plates (2 × 105 cells/well) in the presence of various concentrations of recombinant TSA protein or L. major promastigote CFP. Assays were performed in the absence or presence of soluble anti-IL-4 receptor antibodies (Immunex) at a concentration of 1 µg/ml to facilitate quantitation of IL-4 production. Plates were cultured for 3 days at 37°C in 5% CO2 and were pulsed with 1 µCi of [3H]thymidine (Amersham) for the final 18 h. Cells were harvested onto filter mats and counted with a Matrix 9600 direct beta counter (Packard). Culture supernatants were collected immediately prior to being pulsed, and the levels of cytokines (IL-4 and IFN-gamma ) released into the medium were measured by cytokine ELISA. For analysis of human T-cell reactivity, bulk PBMC obtained from normal North American control donors or from individuals undergoing clinical treatment for mucosal leishmaniasis or visceral leishmaniasis (2 × 105 cells/well) were incubated with the amounts of recombinant TSA protein, total promastigote lysate, or phytohemagglutinin (PHA) indicated in Table 1. Proliferative responses were measured by [3H]thymidine incorporation during an 18-h pulse on day 5 of the assay.

Protection experiments. For protection experiments using CFP, female BALB/c mice (five per group; Charles River) were immunized intraperitoneally with 100 µg of C. parvum (Ribi Immunochem) plus 30 µg of L. major CFP, with 100 µg of C. parvum alone, or with saline alone. Mice were boosted twice at 2-week intervals with the same preparation. Three weeks after the final boost, serum samples were obtained and animals were challenged by subcutaneous injection of 2 × 105 metacyclic L. major promastigotes in the right rear footpad. Disease progression was monitored by weekly caliper measurement of footpad swelling. For protection experiments using recombinant TSA protein, female BALB/c mice (five per group) were immunized subcutaneously in the left rear footpad with 12.5 µg of recombinant TSA protein plus 1 µg of murine IL-12 (kindly provided by S. Wolf, Genetics Institute), 12.5 µg of recombinant TSA protein in IFA, 12.5 µg of recombinant TSA protein alone, 1 µg of IL-12 alone, or saline alone. Mice were boosted 2 weeks later with the same preparation and were challenged by subcutaneous injection of 2 × 105 metacyclic L. major promastigotes in the right rear footpad 2 weeks after the boost. Footpad swelling was measured as described above.

Nucleotide sequence accession number. The nucleotide sequence and the deduced amino acid sequence of the L. major TSA gene have been entered in the GenBank database under accession no. AF044679.

    RESULTS
Top
Abstract
Introduction
Materials & Methods
Results
Discussion
References

Protection against L. major infection with promastigote CFP. The CFP of intracellular pathogens such as Mycobacterium tuberculosis induce protection against tuberculosis (2, 20, 21, 39). Therefore, we investigated the possibility that a similar preparation from L. major promastigotes can confer protection against experimental murine leishmaniasis. Short-term culture filtrates of L. major promastigotes were prepared by growing parasites overnight in serum-free medium at 26°C. Culture filtrates were concentrated by ultrafiltration, and BALB/c mice were immunized in their rear footpads with 30 µg of CFP formulated with the adjuvant C. parvum. The animals were sacrificed 10 days later, and draining popliteal lymph node cells were isolated for analysis of antigen-specific in vitro proliferation and cytokine production. L. major promastigote CFP, within a range of 25 µg/ml to 40 ng/ml, elicited T-cell proliferation from draining lymph node cells in a dose-dependent manner (Fig. 1A). In addition, these cells produced high levels of IFN-gamma in the presence of CFP, again in a dose-dependent manner (Fig. 1B). Analysis of these same culture supernatants revealed that cells also produced IL-4 when they were stimulated with CFP (Fig. 1C). Interestingly, cells stimulated with L. major promastigote CFP in the presence of soluble anti-IL-4 receptor antibody exhibited particularly high levels of IL-4 production compared to levels in cells stimulated in the absence of antibody. The addition of anti-IL-4 receptor antibody presumably blocks the uptake of secreted IL-4 by activated T cells, thereby providing a more precise measurement of IL-4 production without affecting levels of proliferation or IFN-gamma production (Fig. 1A and B). CFP did not elicit proliferation or cytokine production from draining lymph node cells of mice immunized with adjuvant (C. parvum) only (data not shown). These results clearly indicated that CFP-immunized mice develop a strong, antigen-specific cellular immune response. Although this response appeared to comprise a mixed or "Th0" response, we next tested whether this response was sufficient to confer protection against a challenge with virulent L. major promastigotes. BALB/c mice were immunized three times at 2-week intervals with CFP in the presence of C. parvum and challenged 3 weeks after the last immunization with L. major promastigotes. Protection was assessed by measuring footpad thickness at weekly intervals. Figure 1D shows that this antigen formulation induced excellent protection against infection with L. major in the highly susceptible BALB/c mouse strain.


View larger version (30K):
[in this window]
[in a new window]
 
FIG. 1.   (A to C) Antigenicity of promastigote CFP. BALB/c mice were immunized with CFP (30 µg) plus C. parvum (100 µg), and draining lymph node cells were isolated 10 days later for in vitro proliferative responses (A), IFN-gamma production (B), or IL-4 production (C) in the presence of CFP at the indicated concentrations. Cells were incubated in the presence or absence of soluble anti-IL-4 receptor (1 µg/ml) to facilitate measurement of IL-4 production by inhibiting uptake of secreted IL-4. (D) Protection of BALB/c mice against L. major infection with promastigote CFP. Mice were immunized intraperitoneally with saline only, 100 µg of adjuvant only (C. parvum), or 100 µg of C. parvum plus 30 µg of L. major CFP and were boosted twice at 2-week intervals with the same preparation. Three weeks after the final boost, animals were challenged by subcutaneous injection of 105 metacyclic L. major promastigotes in the right rear footpad. Disease progression was monitored by weekly caliper measurement of footpad thickness.

Identification of TSA protein as a component of the promastigote CFP. To identify components of L. major CFP that elicit immune responses in the BALB/c mouse strain, an L. major amastigote cDNA expression library was screened with pooled sera obtained from BALB/c mice that had been immunized with L. major promastigote CFP and C. parvum. Although parasite-specific antibodies are not thought to contribute to host protective immune responses against leishmaniasis, we hypothesized that the specificity of the T-cell-dependent antibody response might be reflective of the T-cell antigens that induce immunity in this model. The rationale for screening an amastigote library with sera raised against promastigote CFP was to identify only those antigens that are expressed in both promastigotes and amastigotes. From a screen of approximately 40,000 plaques, three immunoreactive clones were isolated. Two of the clones were found to carry genes encoding the previously identified promastigote surface antigen 2 (PSA-2) protein from L. major, a glycosylphosphatidylinositol (GPI)-anchored membrane glycoprotein encoded by members of a highly polymorphic gene family (36). A modified form of PSA-2 has been previously observed in promastigote culture filtrates (50). The third clone identified herein carried a gene encoding a novel 22.1-kDa protein antigen of L. major. The sequence of the 1.7-kb cDNA and the predicted amino acid sequence of this clone are shown in Fig. 2. The cDNA contained the final 13 bp of the spliced leader sequence (54) at the 5' terminus and a 119-bp poly(A) tail at the 3' terminus and was therefore assumed to be full length. The clone contained a single 597-bp open reading frame that initiated with an ATG codon located 13 bp downstream of the 3' end of the spliced leader sequence and which was in frame with the vector-encoded beta -galactosidase protein. A second potential translational initiation codon was located 61 bp downstream of the first. The open reading frame was followed by an extensive 3' untranslated region that terminated with a poly(A) tail.


View larger version (56K):
[in this window]
[in a new window]
 
FIG. 2.   Nucleotide sequence of the L. major cDNA clone encoding the TSA protein. The sequence of the entire cDNA clone, including the 3' end of the spliced leader sequence (indicated by the line labeled SL) and the 119-bp poly(A) tail, is shown. The deduced amino acid sequence is shown directly below the nucleotide sequence. The two cysteine residues that are conserved among all TSA proteins and that are implicated in homodimer formation are circled.

A search of the SwissProt data bank for sequences similar to the predicted amino acid sequence shown in Fig. 2 revealed extensive similarity to a family of TSA proteins that is conserved from humans to Saccharomyces cerevisiae (12). This nomenclature is based upon the ability of the S. cerevisiae TSA protein to confer protection against oxidative damage in a thiol oxidation-based enzyme inhibition assay (11). TSA protein has subsequently been redefined as thioredoxin peroxidase, an enzyme that is dependent upon thioredoxin, thioredoxin reductase, and NADPH as reducing equivalents (10, 37). All members of the TSA protein family contain two invariant cysteine residues (Cys-47 and Cys-170 in yeast TSA protein) that are known to mediate dimer formation and are critical for peroxidase activity (13). The Leishmania protein shown in Fig. 2 has 53.5% sequence identity to TSA protein from S. cerevisiae and contains both conserved cysteine residues; therefore, we propose that this sequence constitutes an L. major homolog of TSA protein and will refer to it henceforth as L. major TSA protein.

The L. major TSA protein also exhibited significant similarity to a 29-kDa surface antigen of Entamoeba histolytica (51) and a 26-kDa antigen of Helicobacter pylori (38) and more distant relatedness to a number of other prokaryotic proteins.

Southern and Northern blot analyses. Southern blot hybridization analysis of L. major genomic DNA revealed a restriction pattern that was consistent with TSA protein being encoded by multiple gene copies (Fig. 3A, lanes 1 to 6). Specifically, analysis of the TSA cDNA sequence shown in Fig. 2 revealed the presence of two internal PstI sites separated by only 6 bp. Digestion of genomic DNA with the enzyme PstI resulted in a complex pattern of at least six hybridizing bands when it was probed with a fragment spanning the entire TSA protein cDNA insert (Fig. 3A, lane 6). This result suggests that there is a minimum of three copies of the TSA gene in the L. major genome. Furthermore, the band of approximately 2.5 kbp in lane 6 that hybridized strongly to the full-length cDNA probe also hybridized strongly to probes specific for both the 5' and 3' ends of the cDNA (data not shown), implying that the genes may be arranged as a tandem array. Also, digestion of L. major genomic DNA with EcoRI (which does not cut within the TSA cDNA) resulted in at least three hybridizing bands (Fig. 3A, lane 1) when it was probed with the full-length cDNA probe, providing further evidence of at least three copies of the TSA gene in the L. major genome. Hybridization with genomic DNAs from a battery of different Leishmania species demonstrated that TSA genes are present in a number of clinically and geographically diverse species of Leishmania (Fig. 3A, lanes 7 to 13) but that there may be differences among species with regard to gene number and/or organization. Most notably, the strongly hybridizing PstI fragment of approximately 2.5 kbp was present only in the cutaneous disease-causing organisms L. major and L. tropica. Finally, a DNA fragment that hybridized with the TSA probe was detected in the genomic DNA of a related protozoan parasite, T. brucei (Fig. 3A, lane 15); however, at the stringency conditions used in our study (0.5× SSC at 65°C), no hybridizing bands were detectable in the DNA of T. cruzi.


View larger version (70K):
[in this window]
[in a new window]
 
FIG. 3.   (A) Southern blot hybridization analysis of the TSA gene locus. Genomic DNAs from L. major (lanes 1 to 6), L. tropica, L. donovani, L. infantum, L. chagasi, L. amazonensis, L. braziliensis, L. guyanensis, T. cruzi, or T. brucei (lanes 7 to 15) were digested with the indicated restriction enzymes and analyzed by hybridization with the full-length insert of the TSA cDNA shown in Fig. 2. (B) Northern blot hybridization analysis of TSA gene expression. Total RNA from L. major promastigotes (lane 1) and amastigotes (lane 2) was separated by formaldehyde agarose gel electrophoresis and hybridized with the same probe described for panel A.

A Northern blot containing total RNA from L. major promastigotes and amastigotes was hybridized with a probe comprising the complete TSA cDNA, and a strong band corresponding to a transcript size of 2.3 kb was observed in both life stages (Fig. 3B, lanes 1 and 2). In addition, a region of diffuse hybridization was observed directly below the major 2.3-kb band in both life stages. The TSA cDNA reported herein had a total size of 1.7 kb and included a poly(A) tail and a portion of the spliced leader sequence at its 5' terminus, indicating that it is a full-length transcript. Therefore, it is likely that this cDNA is derived from the region of diffuse hybridization located below the major 2.3-kb band. The source of the stronger 2.3-kb band is unknown at this time but is assumed to be either a transcript from the same gene that has been processed at an alternate site(s) or a transcript derived from one of the additional gene copies observed in the Southern blot shown in Fig. 3A.

Expression of recombinant TSA protein. The 597-bp open reading frame of the L. major TSA gene was subcloned into the pET17b E. coli expression vector (Novagen) and was expressed as a recombinant protein containing an amino-terminal His tag. The recombinant fusion protein was expressed at high levels upon induction with IPTG and partitioned into the soluble lysate. Soluble material was purified by affinity chromatography over Ni-NTA affinity resin (Qiagen), and purity was demonstrated by SDS-PAGE (Fig. 4A, lanes 1 to 3). A small amount of protein with a molecular weight that was approximately twice that of TSA protein was consistently observed in preparations of TSA protein (Fig. 4A, lane 3). Amino-terminal sequencing confirmed that this band represented a dimer of TSA protein, and in fact, when recombinant TSA protein was electrophoresed under nonreducing conditions, 100% of the protein migrated as a dimer (data not shown). This finding is consistent with results of an earlier report describing TSA protein dimer formation via disulfide bonds (13). A polyclonal mouse antiserum raised against recombinant TSA protein was used to probe Western blots containing lysates of L. major promastigotes and amastigotes. A strongly reactive band of the expected size (22 kDa) was observed in promastigote lysate (Fig. 4B, lane 1). Two immunoreactive bands with molecular masses of approximately 16 and 17 kDa were evident in amastigote lysates (Fig. 4B, lane 2), suggesting that promastigotes and amastigotes process the TSA protein differently. Alternatively, various members of the multicopy TSA protein gene family may encode structurally distinct proteins that are differentially expressed in the two life stages. Preimmune mouse sera had no reactivity on duplicate blots (data not shown).


View larger version (44K):
[in this window]
[in a new window]
 
FIG. 4.   (A) Expression and purification of recombinant L. major TSA protein. The gene encoding L. major TSA protein was modified by PCR to incorporate a six-histidine tag at the amino terminus and was cloned into the pET17b expression vector. Lysates of noninduced (lane 1) and IPTG-induced (lane 2) cultures of E. coli and recombinant TSA protein purified by Ni-NTA affinity chromatography (lane 3) were separated by SDS-PAGE and stained with Coomassie blue. (B) Western blot analysis of TSA protein expression in L. major promastigotes (lane 1) and amastigotes (lane 2) with mouse polyclonal antiserum raised against the recombinant TSA protein (rTSA) shown in panel A. Fifty nanograms of recombinant TSA protein was run in lane 3 as a positive control for serological reactivity.

Immunoreactivity of recombinant TSA protein. The immunogenicity of recombinant TSA protein in the BALB/c mouse model is demonstrated in Fig. 5. Sera from mice that were immunized with promastigote CFP plus C. parvum (Fig. 1) had high levels of TSA protein-specific antibody (titers, >1:10,000) as measured by ELISA (Fig. 5A). This finding was expected, since these were the same sera used to isolate the TSA cDNA clone by expression screening. In contrast, mice immunized with saline or adjuvant alone exhibited minimal serological reactivity with recombinant TSA protein. Interestingly, sera obtained from BALB/c mice that were chronically infected with L. major had much higher titers of TSA-specific antibody (in excess of approximately 1:200,000 [data not shown]), indicating that a significant humoral response to TSA protein is developed during infection. Immunization of BALB/c mice with recombinant TSA protein in IFA resulted in the production of high levels of TSA-specific serum antibody (Fig. 5B). Furthermore, this same antisera exhibited strong cross-reactivity to promastigote CFP, once again confirming the presence of TSA protein in the CFP.


View larger version (28K):
[in this window]
[in a new window]
 
FIG. 5.   Immunogenicity of recombinant TSA protein in BALB/c mice. (A) Levels of TSA-specific antibody in the sera of mice immunized with saline, adjuvant alone, or adjuvant plus L. major promastigote CFP were determined over the indicated range of dilutions by ELISA. Sera from the third group of animals were the sera that were initially used to detect the TSA clone during screening of expression libraries. (B) Sera from mice immunized with recombinant TSA plus IFA were analyzed for reactivity against both recombinant TSA protein (anti-TSA) and promastigote CFP (anti-CFP) by ELISA. Sera from unimmunized mice (normal) were used as a negative control to assess background reactivity against recombinant TSA protein. ELISA plates were coated with all antigens at a concentration of 1 µg/well. (C) TSA protein-specific T-cell responses. BALB/c mice were immunized with recombinant TSA protein (rTSA; 25 µg) in IFA, and draining lymph node cells were analyzed 10 days later for in vitro proliferative responses in the presence of recombinant TSA protein or L. major promastigote CFP at the indicated concentrations. (D) In vitro cytokine production by TSA protein-specific T cells. Supernatants were collected from the draining lymph node cells described for panel C just prior to addition of [3H]thymidine, and levels of IFN-gamma and IL-4 secreted into culture supernatants were determined by cytokine ELISA.

To evaluate T-cell immunogenicity, mice were immunized subcutaneously in their rear footpads with recombinant TSA protein plus IFA and cells were obtained from the draining popliteal lymph nodes 10 days after immunization. Cells were stimulated in vitro with various amounts of recombinant TSA protein or crude CFP and were assayed for proliferative responses or cytokine production after 72 h in culture. Recombinant TSA protein elicited a strong, dose-dependent, proliferative response from draining lymph node cells of immunized mice (Fig. 5C). In addition, consistent with the presence of TSA protein in the crude CFP, CFP also elicited proliferative responses from the draining lymph node cells of mice immunized with recombinant TSA protein, albeit at a somewhat lower level. This latter finding was expected, considering the lower molar concentration of TSA protein in the crude CFP mixture. Analysis of the culture supernatants of cells stimulated in vitro with recombinant TSA protein revealed the presence of both IFN-gamma and IL-4 (Fig. 5D). This cytokine profile is consistent with the induction of a mixed cytokine response to this antigen when it is administered in IFA. Furthermore, crude CFP also elicited production of a mixed cytokine profile from these cells but at significantly lower levels, consistent with the lower proliferative responses observed in Fig. 5C. Lymph node cells obtained from control mice immunized with adjuvant alone (IFA or C. parvum) did not proliferate or produce cytokines in the presence of specific antigen (data not shown).

Protection in BALB/c mice immunized with recombinant TSA protein plus IL-12. To assess the protective capability of TSA protein, BALB/c mice were immunized subcutaneously in their left rear footpads with recombinant TSA protein alone, with recombinant TSA protein in the presence of the adjuvants IFA and IL-12, or with IL-12 alone. After a single boost, mice were challenged with 2 × 105 stationary-phase promastigotes in their right rear footpads and footpad swelling was measured at weekly intervals. Figure 6 shows that immunization with recombinant TSA protein plus IL-12 resulted in the development of significant protective immune responses against infection with L. major. Specifically, four of five mice immunized with TSA protein plus IL-12 exhibited a clear delay in the onset of footpad swelling and a reduced progression of disease in comparison to unimmunized mice or mice immunized with TSA alone or TSA plus IFA. The rate of disease progression in the remaining animal was comparable to that of control animals receiving saline only. A similar decrease in the rate of disease progression was observed when mice were immunized with recombinant TSA protein in the presence of C. parvum as an adjuvant (data not shown); however, protection was not as significant as that conferred in the presence of IL-12. Interestingly, animals receiving IL-12 only (no antigen) exhibited a higher rate of disease progression than control animals. The precise mechanism of IL-12-induced exacerbation is not clear at this time.


View larger version (24K):
[in this window]
[in a new window]
 
FIG. 6.   Protection of BALB/c mice against L. major infection with recombinant TSA protein. Female BALB/c mice (five per group) were immunized subcutaneously in their left rear footpads with recombinant TSA protein (12.5 µg) plus IL-12 (1 µg) or recombinant TSA protein (12.5 µg) plus IFA. Control animals were immunized with recombinant TSA protein (12.5 µg) only, IL-12 (1 µg) only, or saline only. Mice were challenged in their right rear footpads with 2 × 105 metacyclic L. major promastigotes, and disease progression was monitored by weekly caliper measurement of footpad thickness. Student's t test showed a statistically significant difference between the group receiving saline only and the group receiving TSA protein plus IL-12 starting at day 58 postinfection (P < 0.01) and at all dates thereafter (P < 0.05).

Analysis of TSA protein-specific immune responses in human donors. Serum samples obtained from human donors with either active cutaneous leishmaniasis (L. major [Sudan]) or visceral leishmaniasis (L. chagasi [Brazil]) were tested for seroreactivity towards recombinant TSA protein by ELISA. Of the patients tested in this study, approximately 50% from each group had significant TSA-specific antibody titers (Fig. 7). Patients who exhibited positive seroreactivity to TSA protein (optical density at 450 nm [OD450] at least 3 standard deviations above the mean OD450 of normal sera from noninfected North American control donors) tended to have very high titers, particularly within the cutaneous-leishmaniasis sample group.


View larger version (25K):
[in this window]
[in a new window]
 
FIG. 7.   Recognition of recombinant TSA protein by human leishmaniasis patient sera. Sera obtained from healthy, normal, North American control individuals and cutaneous-leishmaniasis patients (left panel) or visceral-leishmaniasis patients (right panel) were analyzed for specific reactivities to TSA protein by ELISA. Sera were diluted 1:50 for the assay, and recombinant TSA protein was bound to the plates overnight at a concentration of 200 ng/well. Values plotted are the average OD450 readings of duplicates of each individual serum sample. The horizontal bar on each graph represents the cutoff value (c.o.) for positive readings (OD450 values at least 3 standard deviations above the mean OD450 value of normal sera from noninfected North American control donors).

In addition, PBMC isolated from patients with mucosal leishmaniasis, visceral leishmaniasis (kala-azar), or convalescent visceral leishmaniasis (post-kala-azar) were assayed for in vitro proliferative and cytokine responses to recombinant TSA protein (Table 1). With respect to the patients who were tested in this study, recombinant TSA protein elicited proliferative responses (stimulation index of 5 or greater versus that of PBMC incubated with medium alone) in PBMC from three of five patients with mucosal leishmaniasis (L. braziliensis) and from two of four patients with post-kala-azar (L. chagasi). Two patients with active kala-azar had no response to recombinant TSA protein and only minimal responses to lysate. The TSA-specific responses of the mucosal-leishmaniasis patient PBMC tended to be stronger than those of the post-kala-azar patients; however, the PBMC from mucosal-leishmaniasis patients also had significantly stronger responses to total lysate. These results suggest that a specific T-cell epitope(s) of TSA protein is conserved among L. braziliensis, L. chagasi, and L. major. We are currently attempting to clone the TSA homolog from L. braziliensis in order to directly compare the reactivities of the L. major and L. braziliensis homologs. None of the five North American control donors exhibited significant reactivity to recombinant TSA protein. The viability of PBMC from all donors was confirmed by strong mitogenic stimulation in response to PHA.

                              
View this table:
[in this window]
[in a new window]
 
TABLE 1.   In vitro proliferation of normal or leishmaniasis patient PBMC in response to specific antigen

    DISCUSSION
Top
Abstract
Introduction
Materials & Methods
Results
Discussion
References

The culture filtrate material from in vitro-cultivated L. major promastigotes has been shown in the present study and in previous studies (46) to be highly antigenic and immunogenic in the experimental murine leishmaniasis model. Previous studies have shown that promastigotes of L. donovani secrete or shed as many as 40 distinct glycoproteins into the culture medium (4). However, the only CFP that have been extensively characterized, cloned, and sequenced are the secreted acid phosphatases (3, 53) and certain members of the PSA-2 or Gp46 family (50). Interestingly, unlike other species of Leishmania, promastigotes of L. major do not produce secreted acid phosphatases (28); therefore, their contribution to the antigenicity of L. major culture filtrates can be ruled out. Other candidate molecules of the culture filtrate that might act as antigens include a protein that is tightly associated with lipophosphoglycan (25, 43) or a recently identified proteophosphoglycan (22). In the present study, we have identified a novel protein of promastigote culture filtrates that exhibits significant sequence homology to a group of eukaryotic TSA proteins. Leishmania TSA protein is antigenic in both murine and human systems and is constitutively expressed in both promastigote and amastigote life stages. Furthermore, immunization of susceptible BALB/c mice with recombinant TSA protein plus IL-12 conferred partial protection against disease; therefore, TSA protein is a logical candidate for further analysis as a potential vaccine component.

It is particularly interesting that PBMC from some leishmaniasis patient donors respond to recombinant TSA protein as measured by in vitro proliferation. Although several recombinant Leishmania antigens are known to elicit T-cell responses in murine models of infection (8, 33, 55), only a few have been shown to elicit in vitro responses from human T cells (42, 47, 48). PBMC from several mucosal-leishmaniasis patients exhibited strong TSA-specific proliferative responses that titrated over the range of protein concentrations tested (25 to 1 µg/ml). PBMC from visceral-leishmaniasis patients also responded to recombinant TSA protein but with a lower frequency (two of six patients) and with a lower level of proliferation (maximum stimulation index of 5.2). However, two of the patients in the visceral-leishmaniasis group had active disease and, as with results of previous reports (9, 44), also had weak in vitro responses to total parasite lysate. The levels of IL-10 produced by cells from visceral-leishmaniasis patients have been reported to have a profound influence on in vitro responses (17). The lack of a TSA protein-specific response in individuals from other disease groups may be attributable to differences in HLA haplotype, the clinical status of disease progression, or differences in the TSA gene sequences of various Leishmania species. Thus, we are particularly interested in isolating the TSA gene homolog from L. braziliensis in order to determine whether recombinant L. braziliensis TSA protein might elicit proliferative responses from a broader range of mucosal-leishmaniasis patients. Nonetheless, the responses of several patients to TSA protein indicate that this antigen is presented during human leishmania infections and that it is a relevant target of the immune response. We are currently expanding our analysis of the human immune response to the TSA protein with the aim of understanding why TSA protein responses are restricted to certain individuals.

Although the precise function of the TSA protein in Leishmania is not known at this time, it is interesting to speculate on its role as a potential virulence factor. Production of a secreted antioxidant protein would confer an obvious survival advantage within the phagolysosome of the macrophage. In this regard, the TSA protein of S. cerevisiae was recently demonstrated to protect against peroxide-mediated oxidative damage by reducing H2O2, with thioredoxin as a reducing equivalent (10, 37). Thus, it has been proposed that the name TSA be changed to thioredoxin peroxidase. H2O2 is known to be produced during the macrophage respiratory burst and its effect on the survival of Leishmania has been well documented (24, 31). However, some parasites are able to escape the effects of H2O2 and they go on to establish infection. There are several proposed mechanisms for the evasion of oxidative killing, including global impairment of the macrophage respiratory burst (7, 14) and stage-dependent variability in sensitivity to H2O2 (57). Furthermore, virulent versus avirulent strains of L. donovani have been shown to have significant differences in terms of their levels of resistance to H2O2 (18). In the study of Goyal et al. (18), it was noted through the use of specific enzyme inhibitors that, in addition to well-characterized catalase and glutathione peroxidase activities being present, a thiol-sensitive peroxidase activity was present in promastigotes. It is speculated that this thiol-sensitive peroxidase may be the TSA enzyme reported herein.

The accumulation of multiple copies of the TSA gene in Leishmania organisms provides further evidence that TSA protein may be involved in the virulence of this parasite. In comparison, other nonpathogenic eukaryotes such as S. cerevisiae contain only a single copy of a TSA gene (11). It is not known at this time whether the additional copies of the Leishmania TSA gene encode identical or divergent proteins. However, our data suggest that the latter scenario is more likely for two reasons. First, multiple reactive bands with different molecular weights were observed in promastigote and amastigote lysates during Western blot analyses with TSA-specific antibodies. Although we cannot discount the possibility that these bands are the result of limited proteolysis during sample preparation, they are suggestive of the presence of distinct but immunologically cross-reactive proteins. Second, we noted that the TSA cDNA which we isolated [which is likely full length based on the presence of a poly(A) tail and a partial spliced leader sequence] was 1.7 kb in length whereas Northern blot analyses revealed a strong band of 2.3 kb and a diffuse hybridization pattern indicative of two or more transcripts between the sizes of 2.3 and 1.7 kb. Together, these data suggest that, at least in L. major, there may be multiple species of the TSA protein.

Although TSA was identified with serum that was specific for promastigote CFP, we have no direct evidence to address whether TSA protein is actively secreted or shed by promastigotes. In fact, the TSA protein does not contain a conventional signal sequence that would unequivocally identify it as a secretory protein. The amino terminus of the protein does contain a large percentage of hydrophobic amino acids; however, these are punctuated by a number of charged residues, a feature that is not usually present in conventional signal sequences. A similar arrangement is found in the putative signal sequence of the L. major PSA-2 surface protein (36). Interestingly, a TSA homolog was recently identified in the nematode Dirofilaria immitis, the agent of canine heartworm disease, by screening a cDNA library with sera from immunized dogs (26). Like L. major TSA protein, the D. immitis homolog lacks a conventional signal sequence but is present in excretory and secretory products of adult worms. In addition, the enteric protozoan parasite E. histolytica expresses a TSA protein homolog referred to as the 29-kilodalton antigen that is reported to be localized on the cell surface (40, 51) although it also lacks a signal sequence. If the TSA protein is in fact secreted or shed from the surface of the parasite, it would be interesting to determine whether it plays a role in protecting the parasite from host defense mechanisms. It has been reported that the synthesis of murine TSA protein can be upregulated in mouse peritoneal macrophages by treatment with H2O2 (23); however, we do not know at this time whether the same is true for the Leishmania TSA protein. If the TSA protein is required for survival within the phagolysosome, then it would be an obvious candidate for the development of parasite-specific inhibitors for use in novel chemotherapy strategies.

Last, we are currently attempting to achieve higher levels of protective immunity in the BALB/c mouse model by varying the dose of recombinant TSA protein used for immunization as well as formulating different combinations of antigens, varying the adjuvant formulation, and modifying the immunization schedule. In addition, the TSA gene was recently cloned into an appropriate vector for DNA vaccine studies (pCDNA 3.1) and preliminary results suggest that immunization of BALB/c mice with TSA DNA confers high levels of protective immunity (46a). However, the exact mechanism of DNA-induced immunity is not clear at this time. Recently, the 29-kDa TSA homolog of E. histolytica was shown to confer protective immune responses in a gerbil model of amebic liver abscess (49). Together, these results provide enticing evidence that promastigote CFP such as TSA protein are candidate antigens for further study as vaccine reagents.

    ACKNOWLEDGMENTS

We thank Dan Hoppe for automated DNA sequence analysis, Darin Benson and Ray Houghton for ELISA analysis of human serum samples, and S. F. Wolf (Genetics Institute, Cambridge, Mass.) for recombinant murine IL-12.

This work is supported by grants AI25038 and TW00428 from the National Institutes of Health. John R. Webb was a fellow of the Medical Research Council of Canada.

    FOOTNOTES

* Corresponding author. Mailing address: Infectious Disease Research Institute, 1124 Columbia St., Suite 200, Seattle, WA 98104. Phone: (206) 754-5712. Fax: (206) 754-5715. E-mail: reed{at}corixa.com.

dagger Present address: Department of Microbiology and Immunology, University of Ottawa, Ottawa, Ontario, Canada.

Editor:  J. M. Mansfield

    REFERENCES
Top
Abstract
Introduction
Materials & Methods
Results
Discussion
References

1. Afonso, L. C., T. M. Scharton, L. Q. Vieira, M. Wysocka, G. Trinchieri, and P. Scott. 1994. The adjuvant effect of interleukin-12 in a vaccine against Leishmania major. Science 263:235-237[Abstract/Free Full Text].
2. Andersen, P. 1994. Effective vaccination of mice against Mycobacterium tuberculosis infection with a soluble mixture of secreted mycobacterial proteins. Infect. Immun. 62:2536-2544[Abstract/Free Full Text].
3. Bates, P. A., and D. M. Dwyer. 1987. Biosynthesis and secretion of acid phosphatase by Leishmania donovani promastigotes. Mol. Biochem. Parasitol. 26:289-296[Medline].
4. Bates, P. A., M. Gottlieb, and D. M. Dwyer. 1988. Leishmania donovani: identification of glycoproteins released by promastigotes during growth in vitro. Exp. Parasitol. 67:199-209[Medline].
5. Berman, J. D. 1997. Human leishmaniasis: clinical, diagnostic, and chemotherapeutic developments in the last 10 years. Clin. Infect. Dis. 24:684-703[Medline].
6. Blander, S. J., and M. A. Horwitz. 1991. Vaccination with the major secretory protein of Legionella induces humoral and cell-mediated immune responses and protective immunity across different serogroups of Legionella pneumophila and different species of Legionella. J. Immunol. 147:285-291[Abstract].
7. Buchmuller-Rouiller, Y., and J. Mauel. 1987. Impairment of the oxidative metabolism of mouse peritoneal macrophages by intracellular Leishmania spp. Infect. Immun. 55:587-593[Abstract/Free Full Text].
8. Campos-Neto, A., L. Soong, J. L. Cordova, D. Sant'Angelo, Y. A. W. Skeiky, N. H. Ruddle, S. G. Reed, Jr., C. Janeway, and D. McMahon-Pratt. 1995. Cloning and expression of a Leishmania donovani gene instructed by a peptide isolated from major histocompatibility complex class II molecules of infected macrophages. J. Exp. Med. 182:1423-1433[Abstract/Free Full Text].
9. Carvalho, E. M., R. Badaro, S. G. Reed, W. D. Johnson, Jr., and T. C. Jones. 1985. Absence of gamma interferon and interleukin-2 production during active visceral leishmaniasis. J. Clin. Invest. 76:2066-2069.
10. Chae, H. Z., S. J. Chung, and S. G. Rhee. 1994. Thioredoxin-dependent peroxide reductase from yeast. J. Biol. Chem. 269:27670-27678[Abstract/Free Full Text].
11. Chae, H. Z., I. H. Kim, K. Kim, and S. G. Rhee. 1993. Cloning, sequencing, and mutation of thiol-specific antioxidant gene of Saccharomyces cerevisiae. J. Biol. Chem. 268:16815-16821[Abstract/Free Full Text].
12. Chae, H. Z., K. Robison, L. B. Poole, G. Church, G. Storz, and S. G. Rhee. 1994. Cloning and sequencing of thiol-specific antioxidant from mammalian brain: alkyl hydroperoxide reductase and thiol-specific antioxidant define a large family of antioxidant enzymes. Proc. Natl. Acad. Sci. USA 91:7017-7021[Abstract/Free Full Text].
13. Chae, H. Z., T. B. Uhm, and S. G. Rhee. 1994. Dimerization of thiol-specific antioxidant and the essential role of cysteine 47. Proc. Natl. Acad. Sci. USA 91:7022-7026[Abstract/Free Full Text].
14. Chakraborty, R., S. Mukherjee, and M. K. Basu. 1996. Oxygen-dependent leishmanicidal activity of stimulated macrophages. Mol. Cell. Biochem. 154:23-29[Medline].
15. Connell, N. D., E. Medina-Acosta, W. R. McMaster, B. R. Bloom, and D. G. Russell. 1993. Effective immunization against cutaneous leishmaniasis with recombinant bacille Calmette-Guerin expressing the Leishmania surface proteinase gp63. Proc. Natl. Acad. Sci. USA 90:11473-11477[Abstract/Free Full Text].
16. Feinberg, A. P., and B. Vogelstein. 1983. A technique for radiolabeling DNA restriction endonuclease fragments to high specific activity. Anal. Biochem. 132:6-13[Medline].
17. Ghalib, H. W., M. R. Piuvezam, Y. A. Skeiky, M. Siddig, F. A. Hashim, A. M. el-Hassan, D. M. Russo, and S. G. Reed. 1993. Interleukin 10 production correlates with pathology in human Leishmania donovani infections. J. Clin. Invest. 92:324-329.
18. Goyal, N., U. Roy, and A. K. Rastogi. 1996. Relative resistance of promastigotes of a virulent and an avirulent strain of Leishmania donovani to hydrogen peroxide. Free Radic. Biol. Med. 21:683-689[Medline].
19. Handman, E., F. M. Symons, T. M. Baldwin, J. M. Curtis, and J. P. Scheerlinck. 1995. Protective vaccination with promastigote surface antigen 2 from Leishmania major is mediated by a TH1 type of immune response. Infect. Immun. 63:4261-4267[Abstract].
20. Horwitz, M. A., B. W. Lee, B. J. Dillon, and G. Harth. 1995. Protective immunity against tuberculosis induced by vaccination with major extracellular proteins of Mycobacterium tuberculosis. Proc. Natl. Acad. Sci. USA 92:1530-1534[Abstract/Free Full Text].
21. Hubbard, R. D., C. M. Flory, and F. M. Collins. 1992. Immunization of mice with mycobacterial culture filtrate proteins. Clin. Exp. Immunol. 87:94-98[Medline].
22. Ilg, T., Y. D. Stierhof, D. Craik, R. Simpson, E. Handman, and A. Bacic. 1996. Purification and structural characterization of a filamentous, mucin-like proteophosphoglycan secreted by Leishmania parasites. J. Biol. Chem. 271:21583-21596[Abstract/Free Full Text].
23. Ishii, T., M. Yamada, H. Sato, M. Matsue, S. Taketani, K. Nakayama, Y. Sugita, and S. Bannai. 1993. Cloning and characterization of a 23-kDa stress-induced mouse peritoneal macrophage protein. J. Biol. Chem. 268:18633-18636[Abstract/Free Full Text].
24. James, S. L., and C. Nacy. 1993. Effector functions of activated macrophages against parasites. Curr. Opin. Immunol. 5:518-523[Medline].
25. Jardim, A., D. L. Tolson, S. J. Turco, T. W. Pearson, and R. W. Olafson. 1991. The Leishmania donovani lipophosphoglycan T lymphocyte-reactive component is a tightly associated protein complex. J. Immunol. 147:3538-3544[Abstract].
26. Klimowski, L., R. Chandrashekar, and C. A. Tripp. 1997. Molecular cloning, expression and enzymatic activity of a thioredoxin peroxidase from Dirofilaria immitis. Mol. Biochem. Parasitol. 90:297-306[Medline].
27. Liew, F. Y. 1989. Functional heterogeneity of CD4+ T cells in leishmaniasis. Immunol. Today 10:40-45[Medline].
28. Lovelace, J. K., and M. Gottlieb. 1986. Comparison of extracellular acid phosphatases from various isolates of Leishmania. Am. J. Trop. Med. Hyg. 35:1121-1128.
29. McMahon-Pratt, D., D. Rodriguez, J.-R. Rodriguez, Y. Zhang, K. Manson, C. Bergman, L. Rivas, J. F. Rodriguez, K. L. Lohman, N. H. Ruddle, and M. Esteban. 1993. Recombinant vaccinia viruses expressing GP46/M-2 protect against Leishmania infection. Infect. Immun. 61:3351-3359[Abstract/Free Full Text].
30. McSorley, S. J., D. Xu, and F. Y. Liew. 1997. Vaccine efficacy of Salmonella strains expressing glycoprotein 63 with different promoters. Infect. Immun. 65:171-178[Abstract].
31. Mehlotra, R. K. 1996. Antioxidant defense mechanisms in parasitic protozoa. Crit. Rev. Microbiol. 22:295-314[Medline].
32. Mosmann, T. R., and R. L. Coffman. 1989. TH1 and TH2 cells: different patterns of lymphokine secretion lead to different functional properties. Annu. Rev. Immunol. 7:145-173[Medline].
33. Mougneau, E., F. Altare, A. E. Wakil, S. Zheng, T. Coppola, Z.-E. Wang, R. Waldmann, R. M. Locksley, and N. Glaichenhaus. 1995. Expression cloning of a protective Leishmania antigen. Science 268:563-566[Abstract/Free Full Text].
34. Muller, I., J. A. Garcia-Sanz, R. Titus, R. Behin, and J. Louis. 1989. Analysis of the cellular parameters of the immune responses contributing to resistance and susceptibility of mice to infection with the intracellular parasite, Leishmania major. Immunol. Rev. 112:95-113[Medline].
35. Muller, I., T. Pedrazzini, J. P. Farrell, and J. Louis. 1989. T-cell responses and immunity to experimental infection with Leishmania major. Annu. Rev. Immunol. 7:561-578[Medline].
36. Murray, P. J., and T. W. Spithill. 1991. Variants of a Leishmania surface antigen derived from a multigenic family. J. Biol. Chem. 266:24477-24484[Abstract/Free Full Text].
37. Netto, L. E. S., H. Z. Chae, S. W. Kang, S. G. Rhee, and E. R. Stadtman. 1996. Removal of hydrogen peroxide by thiol-specific antioxidant enzyme (TSA) is involved with its antioxidant properties. TSA possesses thiol peroxidase activity. J. Biol. Chem. 271:15315-15321[Abstract/Free Full Text].
38. O'Toole, P. W., S. M. Logan, M. Kostrzynska, T. Wadstrom, and T. J. Trust. 1991. Isolation and biochemical and molecular analyses of a species-specific protein antigen from the gastric pathogen Helicobacter pylori. J. Bacteriol. 173:505-513[Abstract/Free Full Text].
39. Pal, P. G., and M. A. Horwitz. 1992. Immunization with extracellular proteins of Mycobacterium tuberculosis induces cell-mediated immune responses and substantial protective immunity in a guinea pig model of pulmonary tuberculosis. Infect. Immun. 60:4781-4792[Abstract/Free Full Text].
40. Reed, S. L., B. M. Flores, M. A. Batzer, M. A. Stein, V. L. Stroeher, J. E. Carlton, D. L. Diedrich, and B. E. Torian. 1992. Molecular and cellular characterization of the 29-kilodalton peripheral membrane protein of Entamoeba histolytica: differentiation between pathogenic and nonpathogenic isolates. Infect. Immun. 60:542-549[Abstract/Free Full Text].
41. Reiner, S. L., and R. M. Locksley. 1995. The regulation of immunity to Leishmania major. Annu. Rev. Immunol. 13:151-177[Medline].
42. Russo, D. M., J. M. Burns, Jr., E. M. Carvalho, R. J. Armitage, K. H. Grabstein, L. L. Button, W. R. McMaster, and S. G. Reed. 1991. Human T cell responses to gp63, a surface antigen of Leishmania. J. Immunol. 147:3575-3580[Abstract].
43. Russo, D. M., S. J. Turco, J. M. Burns, Jr., and S. G. Reed. 1992. Stimulation of human T lymphocytes by Leishmania lipophosphoglycan-associated proteins. J. Immunol. 148:202-207[Abstract].
44. Sacks, D. L., S. Lata Lal, S. N. Shvivastava, J. Blackwell, and F. A. Neva. 1987. An analysis of T cell responsiveness in Indian kala-azar. J. Immunol. 138:908-913[Abstract].
45. Scott, P. 1991. IFN-gamma modulates the early development of Th1 and Th2 responses in a murine model of cutaneous leishmaniasis. J. Immunol. 147:3149-3155[Abstract].
46. Scott, P., P. Caspar, and A. Sher. 1990. Protection against Leishmania major in BALB/c mice by adoptive transfer of a T cell clone recognizing a low molecular weight antigen released by promastigotes. J. Immunol. 144:1075-1079[Abstract].
46a. Seder, R. Personal communication.
47. Skeiky, Y. A. W., D. R. Benson, J. A. Guderian, J. A. Whittle, O. Bacelar, E. M. Carvalho, and S. G. Reed. 1995. Immune responses of leishmaniasis patients to heat shock proteins of Leishmania species and humans. Infect. Immun. 63:4105-4114[Abstract].
48. Skeiky, Y. A. W., J. A. Guderian, D. R. Benson, O. Bacelar, E. M. Carvalho, M. Kubin, R. Badaro, G. Trinchieri, and S. G. Reed. 1995. A recombinant Leishmania antigen that stimulates human peripheral blood mononuclear cells to express a Th1-type cytokine profile and to produce interleukin 12. J. Exp. Med. 181:1527-1537[Abstract/Free Full Text].
49. Soong, C. J., B. E. Torian, M. D. Abd-Alla, T. F. Jackson, V. Gatharim, and J. I. Ravdin. 1995. Protection of gerbils from amebic liver abscess by immunization with recombinant Entamoeba histolytica 29-kilodalton antigen. Infect. Immun. 63:472-477[Abstract].
50. Symons, F. M., P. J. Murray, H. Ji, R. J. Simpson, A. H. Osborn, R. Cappai, and E. Handman. 1994. Characterization of a polymorphic family of integral membrane proteins in promastigotes of different Leishmania species. Mol. Biochem. Parasitol. 67:103-113[Medline].
51. Torian, B. E., B. M. Flores, V. L. Stroeher, F. S. Hagen, and W. E. Stamm. 1990. cDNA sequence analysis of a 29-kDa cysteine-rich surface antigen of pathogenic Entamoeba histolytica. Proc. Natl. Acad. Sci. USA 87:6358-6362[Abstract/Free Full Text].
52. Webb, J. R., D. Kaufmann, A. Campos-Neto, and S. G. Reed. 1996. Molecular cloning of a novel protein antigen of Leishmania major that elicits a potent immune response in experimental murine leishmaniasis. J. Immunol. 157:5034-5041[Abstract].
53. Wiese, M., T. Ilg, F. Lottspeich, and P. Overath. 1995. Ser/Thr-rich repetitive motifs as targets for phosphoglycan modifications in Leishmania mexicana secreted acid phosphatase. EMBO J. 14:1067-1074[Medline].
54. Wilson, K., S. Hanson, S. Landfear, and B. Ullman. 1991. Nucleotide sequence of the Leishmania donovani medRNA gene. Nucleic Acids Res. 19:5787[Free Full Text].
55. Wilson, M. E., B. M. Young, K. P. Anderson, J. V. Weinstock, A. Metwali, K. M. Ali, and J. E. Donelson. 1995. A recombinant Leishmania chagasi antigen that stimulates cellular immune responses in infected mice. Infect. Immun. 63:2062-2069[Abstract].
56. Xu, D., S. J. McSorley, S. N. Chatfield, G. Dougan, and F. Y. Liew. 1995. Protection against Leishmania major infection in genetically susceptible BALB/c mice by gp63 delivered orally in attenuated Salmonella typhimurium (AroA- AroD-). Immunology 85:1-7[Medline].
57. Zarley, J. H., B. E. Britigan, and M. E. Wilson. 1991. Hydrogen peroxide-mediated toxicity for Leishmania donovani chagasi promastigotes. Role of hydroxyl radical and protection by heat shock. J. Clin. Invest. 88:1511-1521.


Infect Immun, July 1998, p. 3279-3289, Vol. 66, No. 7
0019-9567/98/$04.00+0
Copyright © 1998, American Society for Microbiology. All rights reserved.



This article has been cited by other articles: