Previous Article | Next Article 
Infect Immun, August 1998, p. 3492-3500, Vol. 66, No. 8
0019-9567/98/$04.00+0
Copyright © 1998, American Society for Microbiology. All rights reserved.
Two-Dimensional Electrophoresis for Analysis of
Mycobacterium tuberculosis Culture Filtrate and Purification
and Characterization of Six Novel Proteins
Karin
Weldingh,1
Ida
Rosenkrands,1
Susanne
Jacobsen,2
Peter Birk
Rasmussen,1
Martin J.
Elhay,1 and
Peter
Andersen1 *
Department of TB Immunology, Statens Serum
Institut, Copenhagen,1 and
Department of
Biochemistry and Nutrition, Technical University of Denmark,
Lyngby,2 Denmark
Received 26 January 1998/Returned for modification 24 March
1998/Accepted 5 May 1998
 |
ABSTRACT |
Culture filtrate from Mycobacterium tuberculosis
contains molecules which promote high levels of protective immunity in
animal models of subunit vaccination against tuberculosis. We have used two-dimensional electrophoresis for analysis and purification of six
novel M. tuberculosis culture filtrate proteins (CFPs): CFP17, CFP20, CFP21, CFP22, CFP25, and CFP28. The proteins were tested
for recognition by M. tuberculosis-reactive memory cells from different strains of inbred mice and for their capacity to induce
a skin test response in M. tuberculosis-infected guinea pigs. CFP17, CFP20, CFP21 and CFP25 induced both a high gamma interferon release and a strong delayed-type hypersensitivity response,
and CFP21 was broadly recognized by different strains of inbred mice.
N-terminal sequences were obtained for the six proteins, and the
corresponding genes were identified in the Sanger M. tuberculosis genome database. In parallel we established a two-dimensional electrophoresis reference map of short-term culture filtrate components and mapped novel proteins as well as already-known CFP.
 |
INTRODUCTION |
For a number of years, efforts to
develop a subunit vaccine against tuberculosis (TB) have focused on
proteins released from growing mycobacteria into the extracellular
medium (3, 31). These released proteins are generally
believed to be responsible for the high efficacy of live vaccine,
Mycobacterium bovis BCG, and recognition of these molecules
may lead to early immunological detection of the infected macrophages
and control of the disease. Subunit vaccines based on mixtures of
culture filtrate proteins (CFPs) from Mycobacterium
tuberculosis have, in a number of studies, resulted in protective
immunity in animal models of TB (1, 25, 32, 39), and the
molecules are recognized strongly during M. tuberculosis
infection in various animal models (22, 31), as well as in
early stages of pulmonary TB in humans (11).
Culture filtrate is therefore an attractive source of candidate
antigens for a new vaccine and diagnostic reagents. Short-term culture
filtrate (ST-CF) from M. tuberculosis is composed of
numerous components, and so far only a minority of these have been
isolated and characterized. In total, approximately 15 proteins have
been purified from culture filtrate; most of them were initially
identified by use of murine monoclonal antibodies (MAbs) (13, 15,
19, 30). In general, these proteins have been isolated among the abundant culture filtrate components which are accessible for conventional purification (24, 30, 42). Studies of T-cell recognition and direct analysis of the potential of these molecules in
experimental vaccines have so far pointed to only a few culture filtrate antigens, notably Ag85 and ESAT-6, as candidate antigens for a
novel TB vaccine (2, 24). Attempts to screen human cellular
responses to separated CFPs, on the other hand, have demonstrated that
there are still numerous uncharacterized antigens of various molecular
masses to be identified (11).
In this study, we have focused on purifying new immunologically active
proteins from ST-CF by preparative two-dimensional electrophoresis
(2-DE). Eleven proteins were purified from ST-CF, and six of these
(CFP17, CFP20, CFP21, CFP22, CFP25, and CFP28) were previously
uncharacterized proteins. An analytical 2-DE reference system for CFPs
was established, in which previously characterized culture filtrate
antigens as well as the newly purified proteins were mapped. The genes
encoding the novel proteins were identified, and the biological
activities of the proteins were evaluated in animal models of TB.
 |
MATERIALS AND METHODS |
Bacteria and preparation of ST-CF.
ST-CF was produced as
described previously (3). Briefly, M. tuberculosis H37Rv (8 × 106 CFU/ml) was grown in
modified Sauton medium on an orbital shaker for 7 days. The culture
supernatants were sterile filtered and concentrated on a YM3 membrane
(Amicon, Danvers, Mass.).
Purification of native proteins from ST-CF.
ST-CF was
precipitated with ammonium sulfate at 80% saturation. The precipitated
proteins were removed by centrifugation and after being washed were
resuspended in buffer containing 8 M urea, 0.5% (wt/vol) CHAPS
{3-[(3-cholamidopropyl)-dimethyl ammonio]-1-propanesulfonate}, and 5% (vol/vol) glycerol. Protein (250 mg) was separated on a Rotofor
Isoelectric Cell (Bio-Rad, Richmond, Calif.) in a pH gradient with 3%
Biolyt 3/5 and 1% Biolyt 4/6 (Bio-Rad). Fractions 9 to 15 were pooled
and refractionated on the Rotofor in the same buffer. The fractions
obtained were analyzed by silver-stained sodium dodecyl
sulfate-polyacrylamide gel electrophoresis phosphate-buffered saline
(SDS-PAGE), and fractions with similar band patterns were pooled,
buffer exchanged to (PBS), and concentrated to 1 to 3 ml on a
Centriprep concentrator (Amicon) with a 3-kDa-cutoff membrane. An equal
volume of sample buffer (63 mM Tris-HCl [pH 6.8], 10% glycerol, 2%
SDS) was added, and the protein solution was boiled for 5 min before
further separation on a Prep-Cell column (Bio-Rad) in a matrix of 16%
polyacrylamide at 200 V overnight. Fractions containing pure proteins
were collected. Samples used for testing of in vivo or in vitro
biological activity were washed three times with PBS on a Centricon
concentrator (Amicon). The fractions were stabilized with 0.5% fetal
calf serum (Gibco Life Technology, Inchinnan, Scotland), and SDS was
removed by passing the sample twice through an Extracti-Gel D column
(Pierce, Rockford, Ill.).
Cloning, expression, and purification of rCFP22 and rCFP25.
All primers used for cloning and sequencing were synthesized with an
ABI-391 DNA synthesizer (Applied Biosystems).
By using the cfp22 and cfp25 gene sequences found
in the Sanger database, the following PCR primers were synthesized:
cfp22 forward, ACAGATCTGTAATGGCAGACTGTGAT; cfp22 reverse,
TTTTCCATGGTCAGGAGATGGTGATCGA; cfp25 forward,
ACAGATCTGCGCATGCGGATCCGTGT; and cfp25 reverse, TTTTCCATGGTCATCCGGCGTGATCGAG. Both forward primers create
BglII sites, and both reverse primers create NcoI
sites DNA fragments were obtained by PCR amplification of M. tuberculosis H37Rv chromosomal DNA with these primers and were
purified on agarose gels and cloned into the pT7Blue T vector (Novagen,
Abingdon, United Kingdom). Plasmid DNA was subcloned into the
expression vector pMCT6 (18) in frame with eight histidines
at the N termini of the expressed proteins, and the resulting clones
were sequenced.
Expression and metal affinity purification of recombinant CFP22
(rCFP22) and rCFP25 on a TALON column (Clontech Laboratories, Palo
Alto, Calif.) were done essentially as described by the manufacturers.
The recombinant protein preparations were pooled and dialyzed against 3 M urea in 10 mM Tris-HCl, pH 8.5. The dialyzed protein was further
purified by fast protein liquid chromatography (Pharmacia, Uppsala,
Sweden) with a 1-ml Mono-Q column and eluted with a linear 0 to 1 M
gradient of NaCl. Fractions were analyzed by SDS-PAGE and dialyzed
against 25 mM HEPES buffer, pH 8.5.
The lipopolysaccharide (LPS) contents in the rCFP22 and rCFP25
preparations were determined by the Limulus amoebocyte
lysate clot test (7).
SDS-PAGE, Western blot analysis, and 2-DE.
Analytical
SDS-PAGE was done with 10 to 20% gradient gels (16 by 16 by 0.075 cm)
as described by Laemmli (26) under reducing conditions
unless otherwise indicated. For calibration, low-molecular-weight standard mixtures (Bio-Rad) were run in parallel with the samples. The
gels were either silver stained (10) or transferred to
nitrocellulose (Schleicher and Schuell, Dassel, Germany) as previously
described (44). For immunoblot analysis, the nitrocellulose
membranes were incubated with mouse MAbs followed by alkaline
phosphatase-labeled rabbit antimouse antibodies (D314; DAKO, Glostrup,
Denmark). A panel of MAbs defining known CFPs was used: Hyb 76-8 (ESAT-6), Hyb 76-1 (GroES), K12 (MPT63), HBT2 (CFP20), L24.b3 (MPT64),
HYT6 (19-kDa lipoprotein), HYT27 (Ag85 complex), HBT12 (PstS), HBT10 (Ald), I10 (MPT32), and HAT3 (DnaK). The antibodies K12 and
I10 were kindly provided by M. Gennaro and G. Marchal,
respectively.
2-DE in polyacrylamide gels was carried out as described by
Hochstrasser et al. (23), except that in the first
dimension, Nonidet P-40 was replaced by Tween 80. The first-dimension
isoelectric focusing tube gels (14 by 0.15 cm) contained Biolyt 4/6 and
Biolyt 5/7 (2:3) (Bio-Rad). After the first-dimension electrophoresis, samples were separated on 10 to 20% gradient gels. The pI scale was
calibrated by measuring the pH of 0.5-cm pieces of focusing gel soaked
in 1 ml of degassed Milli Q water.
Identification of the positions of individual proteins in 2-DE analysis
of ST-CF was achieved by two methods: (i) comparative computer analysis
(Phoretix International, Newcastle, United Kingdom) of the 2-DE spot
pattern of ST-CF with and without addition of the purified protein and
(ii) immunoblotting with MAbs defining known CFPs as described above.
N-terminal sequencing.
For N-terminal sequencing, the
protein fractions were washed with Milli Q water on a Centricon
concentrator (Amicon) with a cutoff at 3 kDa, and 10 to 50 pmol was
applied to a polyvinylidene difluoride membrane in a ProSpin
concentrator (Applied Biosystems). The membrane was washed three times
with 20% methanol and subjected to N-terminal sequence analysis by
automated Edman degradation with a Procise 494 sequencer (Applied
Biosystems) as described by the manufacturer. The SWISSPROT database
was searched with FASTA algorithms (33).
Animals and experimental infections.
Female C57BL/10 mice
and congenic B10.BR mice (haplotype H-2k), and
B10.HTG mice (haplotype H-2g) were purchased
from Harlan Olac Ltd. (Bicester, United Kingdom).
Memory-immune mice were generated as previously described
(12). Briefly, mice received a primary infection with 5 × 104 CFU of M. tuberculosis H37Rv via the
lateral tail vein, after which they were treated with isoniazid (Merck,
Rahway, N.J.) and rifabutin (Farmatalia Carlo Erba, Milan, Italy) in
their drinking water for 2 months to clear the infection. The mice were
rested for a period of 4 to 6 months before challenge with
106 CFU of bacteria intravenously, and the animals were
sacrificed on day 4 postinfection.
Female outbred Ssc:AL strain guinea pigs were bred at Statens Serum
Institut (Copenhagen, Denmark) and were infected via an ear vein with
M. tuberculosis H37Rv in 0.2 ml of PBS containing 5 × 104 CFU.
Lymphocyte cultures.
Spleen lymphocytes were isolated from
memory-immune mice during the recall of protective immunity as
previously described (12). Briefly, cells were pooled from
three mice and cultured in microtiter wells (2 × 105
cells/200 µl) in RPMI 1640 medium supplemented with
-mercaptoethanol, penicillin-streptomycin, glutamine, and fetal calf
serum. Recombinant mouse interleukin-2 (2.5 U/ml; Genzyme, Cambridge,
Mass.) was added to all cultures. ST-CF, purified native proteins, and
recombinantly produced proteins were all buffer exchanged into PBS and
tested in various concentrations (0.5 to 8 µg/ml) in cultures
(results not shown). On the basis of these results, we chose to use the purified proteins at 2 µg/ml and ST-CF at 5 µg/ml throughout the study. Supernatants were harvested after 48 h of incubation, and gamma interferon (IFN-
) levels were quantified by enzyme-linked immunosorbent assay as described previously (12).
Experimental values are given as means of duplicate or triplicate
cultures ± standard errors. Toxicity tests were performed for all
protein preparations as follows. Twofold dilutions of the antigens (8 to 0.5 µg/ml) were tested for toxicity in coculture with a suboptimal concentration of concanavalin A (0.32 µg/ml). The proliferative responses were compared to those of cell cultures stimulated with concanavalin A alone, and no suppression of the response was observed at any of the antigen concentrations used.
Skin testing.
Four weeks after infection of the guinea pigs,
skin testing was performed with proteins diluted to 1 µg/ml in 0.1 ml
of PBS and injected intradermally in the shaved flanks. Tuberculin
purified protein derivative (PPD) RT23 (10 tuberculin units; Statens
Serum Institut) was used as a positive control. Reaction diameters were measured at 24 h after injection, and reaction diameters of less than 3 mm were considered negative.
 |
RESULTS |
Purification of M. tuberculosis CFPs by preparative
2-DE.
Single CFPs were purified by using a strategy based on
preparative 2-DE with isoelectric focusing as the first step followed by separation according to size in SDS-PAGE. Pilot experiments demonstrated that CFPs focused within a narrow pI range (pI 4 to 7),
with a large number of molecules with pIs of around 5.5. Isoelectric
focusing of ST-CF was done with a Rotofor Cell, and the pH range of 3.5 to 6.5 was chosen. The proteins were separated into 20 fractions; the
majority of the protein bands were in fractions within the pH range of
5 to 5.8, whereas the peripheral fractions had a lower protein content
but also a markedly different band composition (Fig.
1A). Fractions with similar band patterns
were combined into three pools as follows. Fractions 6 to 8 were
sampled as pool 1, and fractions 16 to 20 were sampled as pool 3. The remaining fractions, 9 to 15, were pooled and refractionated on the
Rotofor Cell. The resulting fractions in the pH range of 5.0 to 5.7 were collected and samples as pool 2. By this method three pools with
markedly different band composition were obtained and used for further
fractionation (Fig. 1B).

View larger version (63K):
[in this window]
[in a new window]
|
FIG. 1.
Fractionation of CFPs from M. tuberculosis by
preparative isoelectric focusing. (A) ST-CF was fractionated on a
Rotofor Cell, and each fraction was analyzed by SDS-PAGE and silver
staining. The fraction number is indicated below each lane, and the pHs
of selected fractions are indicated at the top. (B) The fractions were
pooled into three major pools. All fractions were analyzed by silver
staining after SDS-PAGE, and the protein profiles were compared to that
of ST-CF. Sizes of molecular mass (MW) markers (in kilodaltons) are
indicated at the left.
|
|
The proteins in each pool were separated according to size by
preparative SDS-PAGE on a Prep-Cell column. A polyacrylamide concentration of 16% was chosen, as it gives optimal resolution of
molecules below 35 kDa, a region previously demonstrated to contain
highly stimulatory molecules in animal models as well as in human
donors (2, 5, 11, 36). The fractions obtained were analyzed
by SDS-PAGE, and 10 fractions chosen for further investigation, as they
contained only one protein band (Fig. 2). These 10 single purified CFPs, with molecular masses of 8 to 30 kDa,
were tested by Western blot analysis with a panel of MAbs defining
previously characterized CFPs (results not shown). Five of the proteins
were identified as already-known proteins: ESAT-6, GroES, MPT63, MPT64,
and MPT59 (Fig. 2, lanes 2, 3, 4, 9, and 11, respectively). The
remaining five proteins appeared to be novel proteins and were
designated CFP17 (Fig. 2, lane 5), CFP20 (lane 6), CFP21 (lane 7),
CFP22 (lane 8), and CFP28 (lane 10). GroES, CFP17, and CFP20 were
obtained from pool 1; MPT63, CFP21, MPT64, and CFP28 were obtained from
pool 2; and ESAT-6, CFP22, and MPT59 were obtained from pool 3.

View larger version (89K):
[in this window]
[in a new window]
|
FIG. 2.
Purified CFPs obtained by preparative size separation.
Lane 1, protein profile of ST-CF; lanes 2 to 11, migrations of the
individual purified proteins. The proteins were separated by
nonreducing SDS-PAGE, which was followed by silver staining. Sizes of
molecular mass (MW) markers (in kilodaltons) are indicated at the
left.
|
|
CFP20 was recognized by MAbs HBT2 and HBT11. An antigen recognized by
these MAbs has previously been isolated by affinity chromatography, but
the protein has not been characterized (27, 48). None of the
other novel proteins were recognized by any of the MAbs available.
2-DE of CFPs.
Mycobacterial proteins are being identified at
an increasing rate, and analytical tools are needed to perform a
systematic evaluation of newly purified proteins and to distinguish
them from the already-characterized proteins. We have utilized the analytical power of 2-DE to establish a 2-DE map of ST-CF components in
which the positions of previously characterized CFPs as well as those
of the panel of novel CFPs were mapped. This was achieved by visual
inspection as well as computer-assisted evaluation of parallel 2-DE
gels with purified antigens, ST-CF, or purified antigens added to
ST-CF. The positions of the previously characterized proteins were also
confirmed by Western blotting with specific MAbs. The analysis
confirmed that CFP17, CFP20, CFP21, CFP22, and CFP28 all mapped as
previously uncharacterized proteins with molecular masses of 17 to 28 kDa (Fig. 3). Of the five proteins, CFP17, CFP20, CFP21, and CFP28 all focused at the expected molecular mass as a cluster of spots within a narrow pI range, indicating the
presence of only one protein in the preparation. All of the proteins
focused as more than one spot, which may be due to microheterogeneity caused by posttranslational modification, e.g., deamidation or oxidation of side chains, as previously observed for both mycobacterial and nonmycobacterial proteins (9, 17, 43). Interestingly, 2-DE analysis of the CFP22 preparation revealed that a protein of
slightly higher molecular mass was copurified and seen as a spot at 25 kDa and at a slightly lower pI (Fig. 3). The protein of 25 kDa was seen
only when a reducing agent was introduced in the SDS-PAGE analysis,
which explained the copurification of the two molecules during the
nonreducing separation on the Prep-Cell column. The preparation was
accordingly designated CFP22/25. All of this information was integrated
into a 2-DE reference map of ST-CF components (Fig.
4).

View larger version (57K):
[in this window]
[in a new window]
|
FIG. 3.
2-DE analysis of the novel CFPs. The CFP17, CFP20,
CFP21, CFP22/25, and CFP28 preparations were separated by 2-DE, which
was followed by silver staining. The migrations of the purified CFPs
are compared to the spot pattern of the complex mixture ST-CF. The
CFP22 preparation is seen to contain another molecule of 25 kDa. This
preparation was accordingly designated CFP22/25. MW, molecular masses
in kilodaltons.
|
|

View larger version (82K):
[in this window]
[in a new window]
|
FIG. 4.
2-DE pattern of M. tuberculosis CFPs. ST-CF
was analyzed by 2-DE in the pH range of 4 to 7. The proteins were
separated according to isoelectric point in the first dimension and
then by size in the second dimension. The gel was silver stained. The
positions of proteins mapped are indicated; known proteins are
designated by the most commonly used name, and the novel CFPs
identified in this study are marked by boxes. MW, molecular mass.
|
|
N-terminal sequence analysis and identification of the genes
encoding the novel proteins.
The five protein preparations were
transferred to polyvinylidene difluoride membranes, which were
subjected to N-terminal sequencing. CFP17, CFP20, CFP21, and CFP28 all
gave one main sequence, which is highly indicative of a pure protein
preparation. Fifteen amino acids were determined for each of the
proteins (Table 1). For the CFP22/25
preparation, N-terminal sequencing of the two individual bands
separated by reducing SDS-PAGE confirmed the existence of two protein
species with different N-terminal sequences.
Each of the six N-terminal sequences obtained was used for a homology
search of the Sanger M. tuberculosis database with the Blast
program. For CFP17, CFP20, CFP21, CFP22, and CFP25 the N-terminal amino
acid sequence was found to be identical to the deduced amino acid
sequence for an open reading frame identified in the Sanger database,
whereas no similarity for CFP28 was found in the database (Table 1).
The five open reading frames identified in the Sanger database were
examined and found to code for mature proteins ranging from 132 to 187 amino acids (Fig. 5). The first amino
acid identified in the mature CFP17, CFP20, CFP21, CFP22, and CFP25
were residues 31, 2, 33, 8, and 33 in the deduced sequences,
respectively. The stretch of deduced amino acids upstream of the
N-terminal sequences of the mature CFP17, CFP21, and CFP25 suggested
the presence of a putative leader sequence cleaved after secretion.
However, only the sequences of CFP21 and CFP25 had the typical
characteristics of a signal peptide (approximately 20 to 40 amino acids
with a stretch of largely hydrophobic residues) (46).

View larger version (51K):
[in this window]
[in a new window]
|
FIG. 5.
Deduced amino acid sequences of the CFPs. Full-length
sequences are shown for the proteins CFP17, CFP20, CFP21, CFP22, and
CFP25. The amino acids determined by N-terminal sequencing in this
study are in boldface.
|
|
The theoretical molecular weight and pI were calculated from the
sequences, and in each case the theoretical molecular weight and pI
were somewhat less than those observed (Table 1). This slight
difference may arise from the presence of urea in the first dimension
of the 2-DE, as previously described (30).
The identified sequences were used for homology searches in the EMBL
database with the TFASTA algorithm (33). None of the identified proteins were identical to previously described proteins from M. tuberculosis, whereas homology to proteins from
other bacteria was found for four of the proteins (Table 1).
CFP22 showed 90% identity in a 182-amino-acid overlap to a
peptidyl-prolyl isomerase from Mycobacterium leprae and is
most likely the M. tuberculosis homolog of this protein.
CFP20 exhibited identity to a number of outer cell wall proteins and
enzymes from other bacteria. CFP21 and CFP25 are homologous proteins
(43% in a 217-amino-acid overlap), and both are homologous to a
cutinase from fungi (29). In addition, the analysis of the
open reading frame for CFP21 revealed that this protein was encoded
within the translated region RD2, which is not present in some strains of M. bovis BCG (28).
Cloning and expression of rCFP22 and rCFP25.
CFP22 and CFP25
were purified together, and the biological activities of the individual
antigens therefore could not be evaluated. As CFP25 is present in only
trace amounts in ST-CF, purification and evaluation of this single
protein from culture filtrate was considered impractical. Therefore,
the genes encoding CFP22 and CFP25 were cloned, and the proteins were
expressed as recombinant proteins. cfp22- and
cfp25-containing DNA fragments were amplified from M. tuberculosis H37Rv chromosomal DNA by PCR with cfp22- and cfp25-specific primers and cloned into the
Escherichia coli expression vector pMCT6 in frame with eight
N-terminal histidine codons.
Recombinant, histidine-tagged rCFP22 and rCFP25 were expressed in
E. coli XL1Blue cells and purified by metal affinity
chromatography followed by anion-exchange (Mono-Q) chromatography,
concentration, and dialysis against a suitable buffer. The resulting
clones were sequenced and found to be 100% in agreement with the
cfp22 and cfp25 sequences obtained from the
Sanger database.
Before the proteins were used in immunological tests, the preparations
were analyzed for contamination with LPS. In both cases, LPS was
present in amounts that are not suspected to interfere with either
T-cell or skin test experiments (<1.0 ng of LPS/mg of rCFP22 and <25
ng of LPS/mg of rCFP25).
Immunological activities of the CFPs.
The immunological
activities of the six CFPs were investigated in mice and guinea pigs
infected with M. tuberculosis. Mice of three congenic
strains on the B10 background representing the H-2b, H-2k, and
H-2g-haplotypes were rendered memory immune by
primary M. tuberculosis infection followed by chemotherapy,
as previously described (2). Recognition of the purified
proteins by memory effector cell lymphocytes isolated at day 4 of
rechallenge was investigated. All molecules were recognized in the
C57BL/10 strain, and CFP17 and CFP21 were the most potent inducers of
IFN-
release, giving rise to 40 to 60% of the response to total
ST-CF (Tables 2 and
3). In the B10.BR mice, CFP20 and CFP21
induced the highest IFN-
release, although at a level somewhat lower
than that in the C57BL/10 mice (Table 2). For B10.HTG mice the amount
of IFN-
released in response to CFP17, CFP20, and CFP22/25 was
negligible; however, CFP21 also induced a marked IFN-
release in
this strain, almost at the level of ST-CF (Table 2). No IFN-
release
was detected when the antigens were tested in spleen cell cultures
isolated from naive mice (results not shown).
The response to the rCFP22 and rCFP25 was compared to that to the
native antigen preparations isolated from culture filtrate. The
recognition of these antigens in the mouse model and the ability to
induce a DTH response in guinea pigs infected with M. tuberculosis were evaluated (Table 3).
In these experiments rCFP25 was demonstrated to be responsible for the
activity of the mixed preparation, while rCFP22 induced neither IFN-
release nor a significant DTH reaction. The ranking of the antigens'
immunological activities in the C57BL/10 strain was in agreement with
the results of the other experiment (Table 2), confirming the high
reactivity of CFP17 and CFP21, both of which induced IFN-
release in
this model at levels above those for the well-known T-cell antigen
MPT59 (6.5 ± 0.1 ng/ml). In the guinea pig model CFP17 and CFP21
also demonstrated a high activity, but this model in addition
identified CFP20 and CFP25 as potent preparations which gave rise to
DTH reactions at levels comparable to those for PPD (Table 3). CFP28
induced a weak skin test reaction, and no responses to rCFP22 were
found. These experiments were repeated three times with the same
overall result, leading to the same relative ranking of the
immunological activities of the antigens.
Taken together, these data support the overall conclusion that CFP17,
CFP20, CFP21, and CFP25 are antigens strongly recognized in animals
infected with M. tuberculosis. CFP21, in particular, is
broadly recognized in animals of different major histocompatibility complex class II compositions.
 |
DISCUSSION |
The aim of the present study was to identify proteins from
M. tuberculosis with potential for use as a TB vaccine or
diagnostic reagents. ST-CF was used as the source of antigens, since
this preparation has been the basis of several successful studies of experimental subunit vaccines (reviewed in reference
14) and contains antigens recognized in the early
stage of M. tuberculosis infection in animals as well as in
humans (11, 36).
ST-CF is a complex mixture composed of a large number of components
present in different concentrations, ranging from proteins barely
detectable in silver-stained gels to components present in abundant
quantities. Using classical chromatographic methods, Nagai et al.
(30) were the first to isolate and characterize a number of
the major CFPs. More recently, conventional purification has resulted
in the identification of novel culture filtrate antigens (40, 42,
44), but such studies have also demonstrated that in many cases
antigens that are already known are obtained (21, 24). These
abundant CFPs were originally identified as the 33 major proteins in
ST-CF (3), but as demonstrated in this study as well as in
another very recent report (43), sensitive 2-DE allows the
detection of at least 150 different protein species. 2-DE separation
followed by direct excision of spots and N-terminal sequence analysis
is obviously an attractive and rapid method, but again this method has
the disadvantage that only proteins present in high quantities will be
obtained.
In this regard, ESAT-6 and the recently identified T-cell antigen CFP29
are both present only in very small amounts in culture filtrate but are
still very potent T-cell antigens (12, 36, 40, 44). It is
therefore clear that there is no direct correlation between the
relative representation of an antigen in culture filtrate and its
immunological relevance, as has been suggested elsewhere (21,
24), and this may reflect differences in the protein expression
in vivo and in vitro. We therefore decided to employ a preparative 2-DE
method in which a preseparation of proteins by isoelectric focusing
enables the subsequent purification of novel proteins, including
molecules present in only small quantities in culture filtrate.
Boesen et al. (11) showed that patients with minimal TB are
characterized by a strong cellular reactivity to a range of ST-CF
proteins, with a recognition of molecules ranging from 5 to 35 kDa.
This predominant recognition of low-mass CFPs prevails in different
species and has been reported for mice, guinea pigs, and cattle
infected with M. tuberculosis (12, 22, 36). We therefore optimized our size separation to enable maximal separation of
this region. Six proteins not previously described were obtained, and
four of these proteins, CFP17, CFP20, CFP21, and CFP25, were immunologically very active and induced either a high IFN-
release from murine memory effector cells or a pronounced DTH reaction. One of
the proteins purified, CFP20, was recognized by the MAbs HBT2 and
HBT11. This antigen has previously been purified by affinity chromatography and was found to induce a strong proliferative response
in humans and mice (4, 6, 27, 48), but until now no
biochemical or sequence data on this antigen have been available.
Interestingly, the present study led to the identification of CFP21,
which is encoded in the RD2 region of the genome, a region reported to
be absent from several strains of BCG (28). CFP21 elicited a
strong skin test reaction and was broadly recognized in genetically
different strains of inbred mice. The value of this protein as a
diagnostic reagent either alone or in combination with other antigens
also absent in BCG, such as MPT64 and ESAT-6, will be the subject of
future studies.
The establishment of 2-DE reference maps of mycobacterial proteins from
different subcellular locations will greatly complement the biochemical
and genetic characterization of M. tuberculosis proteins. In
the coming years the complete sequence of the M. tuberculosis genome (35) and the use of 2-DE to
characterize the proteome, i.e., the total set of expressed proteins,
will change TB research dramatically and allow a direct analysis of genes expressed under different conditions and of importance for host-parasite interactions. A recent report describes the resolution of
more than 600 spots in 2-DE analysis of a whole-cell extract of
M. tuberculosis (45), and another very recent
study has addressed this important subject by mapping a number of CFPs
defined by the World Health Organization standard panel of MAbs
(43). The results obtained in that study are generally in
good agreement with the 2-DE map presented in this study. In our early
culture filtrate, however, we cannot detect the KatG molecule found in abundant quantities in the culture filtrate used by Sonnenberg and
Belisle (43). This discrepancy could be explained by the different culture periods used in the two studies (7 versus 14 days),
as we can detect this protein in culture filtrates harvested at late
time points (data not shown). The reproducibility of 2-DE maps
established in different laboratories emphasizes the potential of this
method for future purification and characterization of mycobacterial
proteins in complex mixtures.
In the present study, the proteins CFP22 and CFP25 were copurified as
one band at 22 kDa by preparative SDS-PAGE performed under nonreducing
conditions. Separation of the recombinant CFP25 under reducing and
nonreducing conditions confirmed that the relative migration of the
nonreduced molecule is faster, reflecting a smaller total
hydrophodynamic volume. Analysis of the deduced sequence for CFP25
revealed the presence of four cysteines, and we propose, therefore,
that there are one or two internal disulfide bonds in this molecule.
ST-CF consists of proteins released from the bacterium into the medium
before significant autolysis of the bacterium has taken place
(3). Most proteins destined for translocation across the
cytoplasmic membrane, in both gram-negative and gram-positive bacteria,
are synthesized as preproteins containing an NH2-terminal signal sequence which is cleaved from the mature protein by specific peptidases (34, 46). However, several proteins without a
signal peptide have been found in ST-CF, e.g., superoxide dismutase, ESAT-6, and CFP29 (40, 44, 49). In this study only two of the six molecules identified, CFP21 and CFP25, contain the typical consensus sequence for a signal peptide (46).
Export of proteins lacking classical signal peptides has been described
for several bacterial species (for reviews, see references 37,
38, and 41), but not much is known about
the actual translocation of these proteins across the plasma membrane.
In E. coli, one signal peptide-independent pathway, the ABC
protein-mediated export mechanism, involves three proteins located in
the membrane. Both proteins secreted by this pathway, as well as the
Yop proteins secreted from yersiniae, contain particular sequences
involved in secretion but lacking the classical features of a signal
peptide (8, 47). Whether similar mechanisms exists in
mycobacteria is yet to be established, but a recent report indicated
that the signal for secretion in some cases may be encoded internally
in mycobacterial proteins (20). It is interesting that both
CFP17 and CFP22 are preceded by peptides apparently cleaved from the mature protein and that none of them have the characteristics of
typical signal peptides. These peptides could play a role in protein
secretion or, alternatively, may be cleaved off as a result of
nonspecific degradation.
Another possible explanation for the seven amino acids preceding the
CFP22 sequence found in ST-CF could be that the start codon of this
open reading frame is GTG (coding for Val in position 7) and not the
predicted ATG (coding for Met in position 1). If this is the case, then
the predicted first amino acid of the mature protein will be Thr (in
position 8), in agreement with the N-terminal sequence of the protein
present in ST-CF. Analysis of the DNA sequence upstream from the two
possible start codons did not clarify this, as no consensus
Shine-Dalgarno sequence could be identified (data not shown).
There is no doubt that although ST-CF is produced from very early
cultures, some autolysis will take place, leading to release of
proteins directly from the cytoplasm. CFP22 is 90% identical to an
M. leprae peptidyl-prolyl isomerase which functions as an intracellular housekeeping enzyme during protein synthesis (for a
review, see reference 16), and if this protein
serves the same function in M. tuberculosis, the small
amount of CFP22 in ST-CF must be a result of autolysis. In this regard,
it is noteworthy that CFP22 is not recognized in any of the
experimentally infected animal models used. This finding, together with
the strong recognition of the rest of the proteins isolated, supports
our present understanding that extracellular antigens are the main
targets recognized in the first phase of M. tuberculosis
infection, leading to early control of disease.
 |
ACKNOWLEDGMENTS |
This investigation received financial support from The European
Community (project no. TS3*CT94-0313 and BNH-4-CT97-2167) and the
Center for Advanced Food Research.
We are grateful to Charlotte Adamzcky Bak, Annette Hansen, Birgitte
Smedegaard, and Bente Isbye for excellent technical assistance.
 |
FOOTNOTES |
*
Corresponding author. Mailing address: Department of TB
Immunology, Statens Serum Institut, Artillerivej 5, DK-2300 Copenhagen S, Denmark. Phone: 45 32 68 34 62. Fax: 45 32 68 30 35. E-mail: tbimm{at}ssi.dk.
Editor: S. H. E. Kaufmann
 |
REFERENCES |
| 1.
|
Andersen, P.
1994.
Effective vaccination of mice against Mycobacterium tuberculosis infection with a soluble mixture of secreted mycobacterial proteins.
Infect. Immun.
62:2536-2544[Abstract/Free Full Text].
|
| 2.
|
Andersen, P.,
A. B. Andersen,
A. L. Sorensen, and S. Nagai.
1995.
Recall of long-lived immunity to Mycobacterium tuberculosis infection in mice.
J. Immunol.
154:3359-3372[Abstract].
|
| 3.
|
Andersen, P.,
D. Askgaard,
L. Ljungqvist,
J. Bennedsen, and I. Heron.
1991.
Proteins released from Mycobacterium tuberculosis during growth.
Infect. Immun.
59:1905-1910[Abstract/Free Full Text].
|
| 4.
|
Andersen, P.,
D. Askgaard,
L. Ljungqvist,
M. W. Bentzon, and I. Heron.
1991.
T-cell proliferative response to antigens secreted by Mycobacterium tuberculosis.
Infect. Immun.
59:1558-1563[Abstract/Free Full Text].
|
| 5.
|
Andersen, P., and I. Heron.
1993.
Specificity of a protective memory immune response against Mycobacterium tuberculosis.
Infect. Immun.
61:844-851[Abstract/Free Full Text].
|
| 6.
|
Andersen, P.,
L. Ljungqvist,
K. Haslov,
M. W. Bentzon, and I. Heron.
1991.
Proliferative response to seven affinity purified mycobacterial antigens in eight strains of inbred mice.
Int. J. Lepr. Mycobact. Dis.
59:58-67.
|
| 7.
|
Baek, L.
1983.
New, sensitive rocket immunoelectrophoretic assay for measurement of the reaction between endotoxin and Limulus amoebocyte lysate.
J. Clin. Microbiol.
17:1013-1020[Abstract/Free Full Text].
|
| 8.
|
Binet, R.,
S. Letoffe,
J. M. Ghigo,
P. Delepelaire, and C. Wandersman.
1997.
Protein secretion by Gram-negative bacterial ABC exporters a review.
Gene
192:7-11[Medline].
|
| 9.
|
Bini, L.,
M. Sanchez-Campillo,
A. Santucci,
B. Magi,
B. Marzocchi,
M. Comanducci,
G. Christiansen,
S. Birkelund,
R. Cevenini,
E. Vretou,
G. Ratti, and V. Pallini.
1996.
Mapping of Chlamydia trachomatis proteins by immobiline-polyacrylamide two-dimensional electrophoresis: spot identification by N-terminal sequencing and immunoblotting.
Electrophoresis
17:185-190[Medline].
|
| 10.
|
Blum, H.,
H. Beier, and H. J. Gross.
1987.
Improved silver staining of plant proteins, RNA and DNA in polyacrylamide gels.
Electrophoresis
8:93-99.
|
| 11.
|
Boesen, H.,
B. N. Jensen,
T. Wilcke, and P. Andersen.
1995.
Human T-cell responses to secreted antigen fractions of Mycobacterium tuberculosis.
Infect. Immun.
63:1491-1497[Abstract].
|
| 12.
|
Brandt, L.,
T. Oettinger,
A. Holm, and P. Andersen.
1996.
Key epitopes on the ESAT-6 antigen recognized in mice during the recall of protective immunity to Mycobacterium tuberculosis.
J. Immunol.
157:3527-3533[Abstract].
|
| 13.
|
Dobos, K. M.,
K. Swiderek,
K. H. Khoo,
P. J. Brennan, and J. T. Belisle.
1995.
Evidence for glycosylation sites on the 45-kilodalton glycoprotein of Mycobacterium tuberculosis.
Infect. Immun.
63:2846-2853[Abstract].
|
| 14.
|
Elhay, M. J., and P. Andersen.
1997.
Immunological requirements for a subunit vaccine against tuberculosis.
Immunol. Cell Biol.
74:595-603.
|
| 15.
|
Engers, H. D.,
J. Bennedsen,
T. M. Buchanan,
S. D. Chaparas,
G. Kadival,
O. Closs,
J. R. David,
J. van-Embden,
T. Godal,
A. S. Mustafa,
J. Ivanyi,
D. B. Young,
S. H. E. Kaufmann,
A. G. Khoenko,
A. H. J. Kolk,
M. Kubin,
J. A. Louis,
P. Minden,
T. M. Shinnick, and L. Trnka.
1986.
Results of a World Health Organization-sponsored workshop to characterize antigens recognized by Mycobacterium-specific monoclonal antibodies.
Infect. Immun.
51:718-720[Free Full Text].
|
| 16.
|
Hacker, J., and G. Fischer.
1993.
Immunophilins: structure-function relationship and possible role in microbial pathogenicity.
Mol. Microbiol.
10:445-456[Medline].
|
| 17.
|
Harboe, M.,
S. Nagai,
M. E. Patarroyo,
M. L. Torres,
C. Ramirez, and N. Cruz.
1986.
Properties of proteins MPB64, MPB70, and MPB80 of Mycobacterium bovis BCG.
Infect. Immun.
52:293-302[Abstract/Free Full Text].
|
| 18.
|
Harboe, M.,
T. Oettinger,
H. G. Wiker,
I. Rosenkrands, and P. Andersen.
1996.
Evidence for occurrence of the ESAT-6 protein in Mycobacterium tuberculosis and virulent Mycobacterium bovis and for its absence in Mycobacterium bovis BCG.
Infect. Immun.
64:16-22[Abstract].
|
| 19.
|
Harth, G.,
D. L. Clemens, and M. A. Horwitz.
1994.
Glutamine synthetase of Mycobacterium tuberculosis: extracellular release and characterization of its enzymatic activity.
Proc. Natl. Acad. Sci. USA
91:9342-9346[Abstract/Free Full Text].
|
| 20.
|
Harth, G., and M. A. Horwitz.
1997.
Expression and efficient export of enzymatically active Mycobacterium tuberculosis glutamine synthetase in Mycobacterium smegmatis and evidence that the information for export is contained within the protein.
J. Biol. Chem.
272:22728-22735[Abstract/Free Full Text].
|
| 21.
|
Harth, G.,
B. Y. Lee, and M. A. Horwitz.
1997.
High-level heterologous expression and secretion in rapidly growing nonpathogenic mycobacteria of four major Mycobacterium tuberculosis extracellular proteins considered to be leading vaccine candidates and drug targets.
Infect. Immun.
65:2321-2328[Abstract].
|
| 22.
|
Haslov, K.,
A. Andersen,
S. Nagai,
A. Gottschau,
T. Sorensen, and P. Andersen.
1995.
Guinea pig cellular immune responses to proteins secreted by Mycobacterium tuberculosis.
Infect. Immun.
63:804-810[Abstract].
|
| 23.
|
Hochstrasser, D. F.,
M. G. Harrington,
A. C. Hochstrasser,
M. J. Miller, and C. R. Merril.
1988.
Methods for increasing the resolution of two-dimensional protein electrophoresis.
Anal. Biochem.
173:424-435[Medline].
|
| 24.
|
Horwitz, M. A.,
B. W. Lee,
B. J. Dillon, and G. Harth.
1995.
Protective immunity against tuberculosis induced by vaccination with major extracellular proteins of Mycobacterium tuberculosis.
Proc. Natl. Acad. Sci. USA
92:1530-1534[Abstract/Free Full Text].
|
| 25.
|
Hubbard, R. D.,
C. M. Flory, and F. M. Collins.
1992.
Immunization of mice with mycobacterial culture filtrate proteins.
Clin. Exp. Immunol.
87:94-98[Medline].
|
| 26.
|
Laemmli, U. K.
1970.
Cleavage of structural proteins during the assembly of the head of bacteriophage T4.
Nature
227:680-685[Medline].
|
| 27.
|
Ljungqvist, L.,
A. B. Andersen,
P. Andersen,
K. Haslov,
A. Worsaae,
J. Bennedsen, and I. Heron.
1990.
Affinity purification, biological characterization and serological evaluation of defined antigens from Mycobacterium tuberculosis.
Trop. Med. Parasitol.
41:333-335[Medline].
|
| 28.
|
Mahairas, G. G.,
P. J. Sabo,
M. J. Hickey,
D. C. Singh, and C. K. Stover.
1996.
Molecular analysis of genetic differences between Mycobacterium bovis BCG and virulent M. bovis.
J. Bacteriol.
178:1274-1282[Abstract/Free Full Text].
|
| 29.
|
Martinez, C.,
P. De-Geus,
M. Lauwereys,
G. Matthyssens, and C. Cambillau.
1992.
Fusarium solani cutinase is a lipolytic enzyme with a catalytic serine accessible to solvent.
Nature
356:615-618[Medline].
|
| 30.
|
Nagai, S.,
H. G. Wiker,
M. Harboe, and M. Kinomoto.
1991.
Isolation and partial characterization of major protein antigens in the culture fluid of Mycobacterium tuberculosis.
Infect. Immun.
59:372-382[Abstract/Free Full Text].
|
| 31.
|
Orme, I. M.,
P. Andersen, and W. H. Boom.
1993.
T cell response to Mycobacterium tuberculosis.
J. Infect. Dis.
167:1481-1497[Medline].
|
| 32.
|
Pal, P. G., and M. A. Horwitz.
1992.
Immunization with extracellular proteins of Mycobacterium tuberculosis induces cell-mediated immune responses and substantial protective immunity in a guinea pig model of pulmonary tuberculosis.
Infect. Immun.
60:4781-4792[Abstract/Free Full Text].
|
| 33.
|
Pearson, W. R., and D. J. Lipman.
1988.
Improved tools for biological sequence comparison.
Proc. Natl. Acad. Sci. USA
85:2444-2448[Abstract/Free Full Text].
|
| 34.
|
Perlman, D., and H. O. Halvorson.
1983.
A putative signal peptidase recognition site and sequence in eukaryotic and prokaryotic signal peptides.
J. Mol. Biol.
167:391-409[Medline].
|
| 35.
|
Philipp, W. J.,
S. Poulet,
K. Eiglmeier,
L. Pascopella,
V. Balasubramanian,
B. Heym,
S. Bergh,
B. R. Bloom,
W. R. Jacobs, and S. T. Cole.
1996.
An integrated map of the genome of the tubercle bacillus, Mycobacterium tuberculosis H37Rv, and comparison with Mycobacterium leprae.
Proc. Natl. Acad. Sci. USA
93:3132-3137[Abstract/Free Full Text].
|
| 36.
|
Pollock, J. M., and P. Andersen.
1997.
Predominant recognition of the ESAT-6 protein in the first phase of interferon with Mycobacterium bovis in cattle.
Infect. Immun.
65:2587-2592[Abstract].
|
| 37.
|
Pugsley, A. P.
1993.
The complete general secretory pathway in gram-negative bacteria.
Microbiol. Rev.
57:50-108[Abstract/Free Full Text].
|
| 38.
|
Pugsley, A. P., and M. Schwartz.
1985.
Export and secretion of proteins by bacteria.
FEMS Microbiol. Rev.
32:3-38.
|
| 39.
|
Roberts, A. D.,
M. G. Sonnenberg,
D. J. Ordway,
S. K. Furney,
P. J. Brennan,
J. T. Belisle, and I. M. Orme.
1995.
Characteristics of protective immunity engendered by vaccination of mice with purified culture filtrate protein antigens of Mycobacterium tuberculosis.
Immunology
85:502-508[Medline].
|
| 40.
|
Rosenkrands, I.,
P. B. Rasmussen,
M. Carnio,
S. Jacobsen,
M. Theisen, and P. Andersen.
1998.
Identification and characterization of a 29-kilodalton protein from Mycobacterium tuberculosis culture filtrate recognized by mouse memory effector cells.
Infect. Immun.
66:2728-2735[Abstract/Free Full Text].
|
| 41.
|
Simonen, M., and I. Palva.
1993.
Protein secretion in Bacillus species.
Microbiol. Rev.
57:109-137[Abstract/Free Full Text].
|
| 42.
|
Sinha, R. K.,
I. Verma, and G. K. Khuller.
1997.
Immunobiological properties of a 30 kDa secretory protein of Mycobacterium tuberculosis H37Ra.
Vaccine
15:689-699[Medline].
|
| 43.
|
Sonnenberg, M. G., and J. T. Belisle.
1997.
Definition of Mycobacterium tuberculosis culture filtrate proteins by two-dimensional polyacrylamide gel electrophoresis, N-terminal amino acid sequencing, and electrospray mass spectrometry.
Infect. Immun.
65:4515-4524[Abstract].
|
| 44.
|
Sorensen, A. L.,
S. Nagai,
G. Houen,
P. Andersen, and A. B. Andersen.
1995.
Purification and characterization of a low-molecular-mass T-cell antigen secreted by Mycobacterium tuberculosis.
Infect. Immun.
63:1710-1717[Abstract].
|
| 45.
|
Urquhart, B. L.,
T. E. Atsalos,
D. Roach,
D. J. Basseal,
B. Bjellqvist,
W. L. Britton, and I. Humphrey-Smith.
1997.
Proteomic contigs of Mycobacterium tuberculosis and Mycobacterium bovis (BCG) using novel immobilised pH gradients.
Electrophoresis
18:1384-1392[Medline].
|
| 46.
|
von Heijne, G.
1985.
Signal sequences. The limits of variation.
J. Mol. Biol.
184:99-105[Medline].
|
| 47.
|
Wattiau, P.,
S. Woestyn, and G. R. Cornelis.
1996.
Customized secretion chaperones in pathogenic bacteria.
Mol. Microbiol.
20:255-262[Medline].
|
| 48.
|
Worsaae, A.,
L. Ljungqvist, and I. Heron.
1988.
Monoclonal antibodies produced in BALB.B10 mice define new antigenic determinants in culture filtrate preparations of Mycobacterium tuberculosis.
J. Clin. Microbiol.
26:2608-2614[Abstract/Free Full Text].
|
| 49.
|
Young, D. B.,
S. H. Kaufmann,
P. W. Hermans, and J. E. Thole.
1992.
Mycobacterial protein antigens: a compilation.
Mol. Microbiol.
6:133-145[Medline].
|
Infect Immun, August 1998, p. 3492-3500, Vol. 66, No. 8
0019-9567/98/$04.00+0
Copyright © 1998, American Society for Microbiology. All rights reserved.
This article has been cited by other articles:
-
Parker, S. K., Curtin, K. M., Vasil, M. L.
(2007). Purification and Characterization of Mycobacterial Phospholipase A: an Activity Associated with Mycobacterial Cutinase. J. Bacteriol.
189: 4153-4160
[Abstract]
[Full Text]
-
Warner, D. F., Mizrahi, V.
(2006). Tuberculosis Chemotherapy: the Influence of Bacillary Stress and Damage Response Pathways on Drug Efficacy. Clin. Microbiol. Rev.
19: 558-570
[Abstract]
[Full Text]
-
Sable, S. B., Kumar, R., Kalra, M., Verma, I., Khuller, G. K., Dobos, K., Belisle, J. T.
(2005). Peripheral Blood and Pleural Fluid Mononuclear Cell Responses to Low-Molecular-Mass Secretory Polypeptides of Mycobacterium tuberculosis in Human Models of Immunity to Tuberculosis. Infect. Immun.
73: 3547-3558
[Abstract]
[Full Text]
-
Weldingh, K., Rosenkrands, I., Okkels, L. M., Doherty, T. M., Andersen, P.
(2005). Assessing the Serodiagnostic Potential of 35 Mycobacterium tuberculosis Proteins and Identification of Four Novel Serological Antigens. J. Clin. Microbiol.
43: 57-65
[Abstract]
[Full Text]
-
Hovav, A.-H., Fishman, Y., Bercovier, H.
(2005). Gamma Interferon and Monophosphoryl Lipid A-Trehalose Dicorynomycolate Are Efficient Adjuvants for Mycobacterium tuberculosis Multivalent Acellular Vaccine. Infect. Immun.
73: 250-257
[Abstract]
[Full Text]
-
Tjalsma, H., Antelmann, H., Jongbloed, J. D.H., Braun, P. G., Darmon, E., Dorenbos, R., Dubois, J.-Y. F., Westers, H., Zanen, G., Quax, W. J., Kuipers, O. P., Bron, S., Hecker, M., van Dijl, J. M.
(2004). Proteomics of Protein Secretion by Bacillus subtilis: Separating the "Secrets" of the Secretome. Microbiol. Mol. Biol. Rev.
68: 207-233
[Abstract]
[Full Text]
-
Huard, R. C., Chitale, S., Leung, M., Lazzarini, L. C. O., Zhu, H., Shashkina, E., Laal, S., Conde, M. B., Kritski, A. L., Belisle, J. T., Kreiswirth, B. N., Lapa e Silva, J. R., Ho, J. L.
(2003). The Mycobacterium tuberculosis Complex-Restricted Gene cfp32 Encodes an Expressed Protein That Is Detectable in Tuberculosis Patients and Is Positively Correlated with Pulmonary Interleukin-10. Infect. Immun.
71: 6871-6883
[Abstract]
[Full Text]
-
Camus, J.-C., Pryor, M. J., Medigue, C., Cole, S. T.
(2002). Re-annotation of the genome sequence of Mycobacterium tuberculosis H37Rv. Microbiology
148: 2967-2973
[Abstract]
[Full Text]
-
Cole, S.T.
(2002). Comparative mycobacterial genomics as a tool for drug target and antigen discovery. Eur Respir J
20: 78S-86s
[Abstract]
[Full Text]
-
Recchi, C., Rauzier, J., Gicquel, B., Reyrat, J.-M.
(2002). Signal-sequence-independent secretion of the staphylococcal nuclease in Mycobacterium smegmatis. Microbiology
148: 529-536
[Abstract]
[Full Text]
-
Florczyk, M. A., McCue, L. A., Stack, R. F., Hauer, C. R., McDonough, K. A.
(2001). Identification and Characterization of Mycobacterial Proteins Differentially Expressed under Standing and Shaking Culture Conditions, Including Rv2623 from a Novel Class of Putative ATP-Binding Proteins. Infect. Immun.
69: 5777-5785
[Abstract]
[Full Text]
-
Olsen, I., Tryland, M., Wiker, H. G., Reitan, L. J.
(2001). AhpC, AhpD, and a Secreted 14-Kilodalton Antigen from Mycobacterium avium subsp. paratuberculosis Distinguish between Paratuberculosis and Bovine Tuberculosis in an Enzyme-Linked Immunosorbent Assay. CVI
8: 797-801
[Abstract]
[Full Text]
-
Dahl, J. L., Wei, J., Moulder, J. W., Laal, S., Friedman, R. L.
(2001). Subcellular Localization of the Intracellular Survival-Enhancing Eis Protein of Mycobacterium tuberculosis. Infect. Immun.
69: 4295-4302
[Abstract]
[Full Text]
-
Olsen, I., Reitan, L. J., Wiker, H. G.
(2000). Distinct Differences in Repertoires of Low-Molecular-Mass Secreted Antigens of Mycobacterium avium Complex and Mycobacterium tuberculosis. J. Clin. Microbiol.
38: 4453-4458
[Abstract]
[Full Text]
-
Betts, J. C., Dodson, P., Quan, S., Lewis, A. P., Thomas, P. J., Duncan, K., McAdam, R. A.
(2000). Comparison of the proteome of Mycobacterium tuberculosis strain H37Rv with clinical isolate CDC 1551. Microbiology
146: 3205-3216
[Abstract]
[Full Text]
-
Wiker, H. G., Wilson, M. A., Schoolnik, G. K.
(2000). Extracytoplasmic proteins of Mycobacterium tuberculosis - mature secreted proteins often start with aspartic acid and proline. Microbiology
146: 1525-1533
[Abstract]
[Full Text]
-
Musser, J. M., Amin, A., Ramaswamy, S.
(2000). Negligible Genetic Diversity of Mycobacterium tuberculosis Host Immune System Protein Targets: Evidence of Limited Selective Pressure. Genetics
155: 7-16
[Abstract]
[Full Text]
-
Gomez, M., Johnson, S., Gennaro, M. L.
(2000). Identification of Secreted Proteins of Mycobacterium tuberculosis by a Bioinformatic Approach. Infect. Immun.
68: 2323-2327
[Abstract]
[Full Text]
-
Skjot, R. L. V., Oettinger, T., Rosenkrands, I., Ravn, P., Brock, I., Jacobsen, S., Andersen, P.
(2000). Comparative Evaluation of Low-Molecular-Mass Proteins from Mycobacterium tuberculosis Identifies Members of the ESAT-6 Family as Immunodominant T-Cell Antigens. Infect. Immun.
68: 214-220
[Abstract]
[Full Text]
-
Manabe, Y. C., Chen, J. M., Ko, C. G., Chen, P., Bishai, W. R.
(1999). Conditional Sigma Factor Expression, Using the Inducible Acetamidase Promoter, Reveals that the Mycobacterium tuberculosis sigF Gene Modulates Expression of the 16-Kilodalton Alpha-Crystallin Homologue. J. Bacteriol.
181: 7629-7633
[Abstract]
[Full Text]
-
Rosenkrands, I., Weldingh, K., Ravn, P., Brandt, L., Hojrup, P., Rasmussen, P. B., Coates, A. R., Singh, M., Mascagni, P., Andersen, P.
(1999). Differential T-Cell Recognition of Native and Recombinant Mycobacterium tuberculosis GroES. Infect. Immun.
67: 5552-5558
[Abstract]
[Full Text]