Previous Article | Next Article ![]()
Infect Immun, August 1998, p. 3656-3665, Vol. 66, No. 8
Pasteur Merieux Connaught Canada Research
Centre, North York, Ontario, Canada M2R 3T4,1
and
Department of Microbiology and Infectious Diseases,
University of Calgary, Calgary, Alberta, Canada T2N
4N12
Received 24 February 1998/Returned for modification 31 March
1998/Accepted 1 June 1998
The lactoferrin receptor genes from two strains of Moraxella
catarrhalis have been cloned and sequenced. The lfr
genes are arranged as lbpB followed by lbpA, a
gene arrangement found in lactoferrin and transferrin receptor operons
from several bacterial species. In addition, a third open reading
frame, orf3, is located one nucleotide downstream of
lbpA. The deduced lactoferrin binding protein A (LbpA)
sequences from the two strains were found to be 99% identical, the
LbpB sequences were 92% identical, and the ORF3 proteins were 98%
identical. The lbpB gene was PCR amplified and sequenced
from a third strain of M. catarrhalis, and the encoded protein was found to be 77% identical and 84% similar to the other LbpB proteins. Recombinant LbpA and LbpB proteins were expressed from
Escherichia coli, and antisera raised to the purified
proteins were used to assess antigenic conservation in a panel of
M. catarrhalis strains. The recombinant proteins were
tested for the ability to bind human lactoferrin following gel
electrophoresis and electroblotting, and rLbpB, but not rLbpA, was
found to bind lactoferrin. Bactericidal antibody activity was measured,
and while the anti-rLbpA antiserum was not bactericidal, the anti-rLbpB
antisera were found to be weakly bactericidal. Thus, LbpB may have
potential as a vaccine candidate.
Moraxella
(Branhamella) catarrhalis is a human pathogen
that has only recently been recognized as a significant health problem (5). It is a commensal organism colonizing the respiratory tract in children and adults, with the highest incidence in young children and in adults of >60 years of age (10). It is the
third most common cause of otitis media and sinusitis in children,
after Streptococcus pneumoniae and Haemophilus
influenzae, and is responsible for an estimated 15 to 20% of
disease. In adults, M. catarrhalis infection can lead to
exacerbation of chronic bronchitis or development of pneumonia in
patients with pre-existing pulmonary disease. More rarely, it also
causes bacteremia and meningitis (10, 17, 23).
Otitis media affects approximately 70% of all children by the age of
three, with many children experiencing recurrent disease (2). Chronic otitis media can lead to hearing, speech, and cognitive impairment in children, since it tends to occur at a time
when language is developing. The incidence of M. catarrhalis-induced otitis media is variable depending upon the
population being studied, ranging from 7 to 20% in the United States,
(21), 0 to 10% in Greenland (16), and about 1%
in Spain (7). Antibiotic resistance, especially penicillin
resistance due to the expression of Iron restriction is a general host defense mechanism against microbial
pathogens, and in the human host, iron is sequestered by transferrin,
lactoferrin, hemoglobin, and other complex molecules. A number of
bacterial species, including Bordetella pertussis (22), Helicobacter pylori (9),
M. catarrhalis (33), Neisseria gonorrhoeae (1), Neisseria meningitidis
(29, 33), Prevotella nigrescens (8),
and Treponema spp. (34), have been shown to
express outer membrane proteins which specifically bind human lactoferrin. M. catarrhalis, N. gonorrhoeae, and
N. meningitidis utilize both transferrin and lactoferrin
binding complexes, and a single lactoferrin binding protein of ~105
kDa was originally identified in these organisms (33). The
lbpA genes from N. gonorrhoeae and N. meningitidis have been cloned and sequenced (1, 27), but until recently there was no evidence for the existence of an
lbpB gene (3, 13, 25, 28).
We report here the cloning and sequencing of the M. catarrhalis lactoferrin binding protein genes lbpA and
lbpB. The recombinant proteins were expressed in
Escherichia coli, and high-titer antibodies were raised.
Anti-rLbpA antiserum was not bactericidal, but anti-rLbpB antisera were
weakly bactericidal against the autologous and heterologous strains.
Recombinant DNA techniques.
Restriction endonucleases were
purchased from Boehringer Mannheim (Laval, Quebec, Canada), New England
Biolabs, Bethesda Research Laboratories, or Pharmacia and were used
according to the manufacturers' specifications. Oligonucleotides were
synthesized on an Applied Biosystems, Inc. (ABI), model 380B DNA
synthesizer and purified by chromatography (Oligonucleotide
Purification Cartridge; Perkin-Elmer, Culver City, Calif.). Other
recombinant DNA methods were performed according to Sambrook et al.
(32).
Bacterial strains and media.
M. catarrhalis otitis
media clinical isolates 4223 and 3 were kindly provided by T. Murphy
(State University of New York, Buffalo, N.Y.), strain Q8 was a gift
from M. Bergeron (University of Laval, Laval, Quebec, Canada), strain
VH19 was provided by V. Howie (University of Texas, Galveston, Tex.),
strain H-04 was from G. D. Campbell (Louisiana State University,
Shreveport, La.), and strain LES-1 was obtained from L. E. Stenfors (University of Tromso, Tromso, Norway). M. catarrhalis strains were maintained on Mueller-Hinton agar (Becton
Dickinson, Cockeysville, Md.) or grown in brain heart infusion (BHI)
medium (Difco, Detroit, Mich.) with or without the addition of
ethylenediamine-di(o-hydroxyphenylacetic acid) (EDDA)
(Sigma, St. Louis, Mo.), as described previously (15).
E. coli strains were grown in YT medium supplemented with 50 µg of ampicillin ml Purification of LbpA and protein sequence determination.
Native LbpA was purified by affinity chromatography under
high-stringency conditions with immobilized lactoferrin (3). The purified LbpA protein was digested overnight with cyanogen bromide;
then, fragments were separated by sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE) and submitted for sequence analysis on
an ABI model 477A protein sequencer. A 13-kDa protein fragment was
found to have the N-terminal sequence MVQYTYRKGKENKAH.
Generation of a probe for screening libraries.
A degenerate
oligonucleotide primer was prepared based upon the internal LbpA
sequence
QYTRKGENKA
5' CAA TAT ACI CGT/C AAA GGT/C GAA AAT/C AAA GC 3'
0019-9567/98/$04.00+0
Copyright © 1998, American Society for Microbiology. All rights reserved.
Cloning and Expression of the Moraxella
catarrhalis Lactoferrin Receptor Genes
![]()
ABSTRACT
Top
Abstract
Introduction
Materials & Methods
Results
Discussion
References
![]()
INTRODUCTION
Top
Abstract
Introduction
Materials & Methods
Results
Discussion
References
-lactamase, is very common in
clinical isolates of M. catarrhalis, reaching 80 to 85% in
United States and European isolates (24). A vaccine against
otitis media caused by M. catarrhalis is clearly needed.
![]()
MATERIALS AND METHODS
Top
Abstract
Introduction
Materials & Methods
Results
Discussion
References
1 as required.
-32P]dCTP (random-primed DNA labelling
kit; Boehringer Mannheim) and used to screen genomic libraries.
Construction and screening of genomic libraries. M. catarrhalis 4223 and Q8 EMBL3 libraries were prepared as described previously (20). Briefly, chromosomal DNA was partially digested with Sau3AI, and DNA fragments of 15 to 23 kb were purified. The DNA was cloned into BamHI-digested EMBL3 arms (Promega, Madison, Wis.) and packaged according to the manufacturer's instructions. The libraries in E. coli LE392 cells were plated, and plaques were lifted onto nitrocellulose membranes for hybridization with the labelled 2.2-kb lbpA PCR fragment. Several putative phage clones were obtained from each library, and phage DNA was prepared for further analysis. Restriction enzyme and Southern blot analyses indicated that at least a portion of lbpA was localized to a ~9-kb HindIII fragment from each phage clone. The Q8 HindIII fragment was subcloned into pBluescript, generating plasmid pLDW1, and the 4223 HindIII fragment was subcloned into pUC18, generating plasmid pLD1-8. Figure 1 illustrates the restriction map and gene placement within the M. catarrhalis lfr locus.
Sequencing of the lfr genes. Plasmid DNA was prepared from 50-ml overnight cultures by using the Qiagen Plasmid Midi kit (Qiagen Inc., Chatsworth, Calif.). DNA samples were sequenced on an ABI model 373A DNA sequencer using dye terminator chemistry. Oligonucleotide primers of 17 to 25 bases in length were used to sequence both strands of the DNA.
PCR amplification of the VH19 lbpB gene. Chromosomal DNA was prepared from M. catarrhalis VH19. Oligonucleotide primers were designed based upon the flanking sequence of the 4223 lbpB gene. The sense primer was 5' AAGCTTAGCATGATGGCATCGGCT 3', and the antisense primer was 5' TTAGCCCAAGGCAAATCTGGTGCA 3'. Two independent PCR amplifications were performed, as above, and specific 2.9-kb fragments were amplified and subcloned into pCR II (Invitrogen, Carlsbad, Calif.), generating plasmids pVH19pcr1 and pVH19pcr2 for sequence analysis. A third PCR amplification was performed without subcloning of the resultant DNA. PCR-amplified DNA was purified for direct sequencing with a Qiagen PCR purification kit.
Construction of clones expressing recombinant LbpA and LbpB. In order to express lbpA, 5' and 3' fragments of lbpA were generated by PCR amplification and were ligated to an internal 2.3-kb fragment to recreate a full-length gene. The primers used to amplify an ~200-bp 5' fragment to a BstEII site were MSKSIT 5' GGAATTCCAT ATG TCA AAA TCT ATC ACA AA 3'
(where an NdeI site is underlined) and LDAITVTAA 5' T TTA GAT GCC ATC ACG GTA ACC GCC GCC CC 3' 3' A AAT CTA CGG TAG TGC CAT TGG CGG CGG GG 5' (where the BstEII site is underlined). The primers used to amplify a 515-bp 3' fragment from an SphI site were GKLDLHAMTS 5' GGC AAA CTG GAT TTG CAT GCC ATG ACA TCA 3' (where the SphI site is underlined) and SLEMKF* 5' AGT CTT GAA ATG AAG TTT TAA 3' 3' TCA GAA CTT TAC TTC AAA ATT GCCCTAGGGC 5' (where a BamHI site is underlined). An NdeI site encompassing the ATG start codon and a BamHI site following the termination codon were added for cloning purposes. The PCR fragments were ligated with an internal 2.3 kb-BstEII-SphI fragment of lbpA and cloned into pT7-7, which had been digested with NdeI and BamHI. The resulting pT7-lbpA expression clones were designated pRD1A and pQW1A for 4223 and Q8, respectively. BL21(DE3) cells were transformed by electroporation for expression studies. By analogy with TbpB proteins, LbpB was assumed to be a lipoprotein, and constructs were designed for expression of LbpB with or without a lipopeptide signal sequence. There is a unique BglI site in lbpB. To express the full-length LbpB protein with leader sequence (construct A), an ~429-bp 5' fragment from the Met1 start codon to the BglI site was PCR amplified; to express the mature protein (construct B), an ~329-bp 5' fragment from the putative Cys32 start codon to the BglI site was PCR amplified. The sense primers were MSTVKTPH 5' GGAATTCCAT ATG AGT ACT GTC AAA ACC CCC CAC A 3' (where an NdeI site is underlined) for construct A and MCRSDDISVN 5' GGAATTCCAT ATG TGC CGC TCT GAT GAC ATC AGC GTC AAT 3' (where an NdeI site is underlined) for construct B, and the antisense primer was GKNLRGPI 5' GGT AAA AAC TTG CGT CAG CCC ATC 3' 3' CCA TTT TTG AAC GCA GTC GGG TAG 5' (where the BglI site is underlined). The Q8 lfr-containing plasmid pLDW1 was digested with BglI and EcoRI to release a 2.3-kb lbpB fragment, which was ligated with the NdeI-BglI PCR fragment and cloned into pT7-7, which had been digested with NdeI and EcoRI. The resulting plasmids, pQW2A and pQW2B, thus contained the Q8 lbpB gene encoding the full-length or mature LbpB proteins under control of the T7 promoter. The plasmids expressing the 4223 full-length or mature LbpB proteins were constructed in a similar manner and designated pRD2A and pRD2B. Plasmids were introduced into E. coli BL21(DE3) cells by electroporation.Purification of recombinant proteins.
The strain Q8 rLbpA
protein was expressed at about 10% of total protein as inclusion
bodies, but the strain 4223 rLbpA protein was expressed at
substantially lower levels. E. coli cells from a 500-ml
culture were resuspended in 40 ml of 50 mM Tris-HCl, pH 8.0, containing
5 mM 4-(2-aminoethyl)-benzenesulfonylfluoride protease inhibitor
(Calbiochem, La Jolla, Calif.) and 0.1 M NaCl and disrupted by
sonication (three times for 10 min each; 70% duty circle). The extract
was centrifuged at 20,000 × g for 30 min, and the
resultant supernatant, which contained >95% of the soluble proteins
from E. coli, was discarded. The remaining pellet was
further extracted in 40 ml of 50 mM Tris-HCl, pH 8.0, containing 0.5%
Triton X-100 and 10 mM EDTA. The mixture was stirred at 4°C for at
least 1 h and then centrifuged at 20,000 × g for
30 min, and the supernatant containing residual soluble proteins and
the majority of the membrane proteins was discarded. The resultant pellet was further extracted in 40 ml of 50 mM Tris-HCl, pH 8.0, containing 1% octylglucoside. The mixture was stirred at 4°C for at
least 1 h and then centrifuged at 20,000 × g for
30 min. The supernatant containing residual contaminating proteins was
discarded. The resultant pellet obtained after the above extractions
contained the inclusion bodies. The recombinant LbpA protein (rLbpA)
was solubilized in 50 mM Tris-HCl, pH 8.0, containing 6 M guanidine and
5 mM dithiothreitol (DTT). After centrifugation, the resultant supernatant was further purified on a Superdex 200 gel filtration column equilibrated in 50 mM Tris-HCl, pH 8.0, containing 2 M guanidine
and 5 mM DTT. The fractions were analyzed by SDS-PAGE, and those
containing purified rLbpA were pooled. Triton X-100 was added to the
pooled rLbpA fraction to a final concentration of 0.1%. The fraction
was dialyzed overnight at 4°C against phosphate-buffered saline (PBS)
and then centrifuged at 20,000 × g for 30 min. The purified rLbpA was stored at
20°C.
Lactoferrin binding and transferrin binding assays.
Human
lactoferrin (Sigma) was conjugated to horseradish peroxidase (HRP) by
using an EZ-Link maleimide-activated HRP kit (Pierce, Rockford, Ill.)
according to the manufacturer's instructions. Briefly, 1 mg of human
lactoferrin, resuspended in 1 ml of PBS, was mixed with 20 µl of SATA
solution (Pierce) to form SATA derivative. The solution was incubated
for 30 min and then deacetylated for 2 h at room temperature.
Separation of the deacetylated human lactoferrin derivative from
hydroxylamine-HCl and by-products was achieved with a desalting column
(1 by 10 cm). Fractions (500 µl) were collected; those containing
deacetylated human lactoferrin were pooled, and the protein
concentration (about 0.5 mg ml
1) was confirmed by
measuring at A280. The protein pool (1 ml) was
added to 1 mg of EZ-Link maleimide-activated HRP and incubated for
1 h at room temperature. The resulting conjugate was used for the
lactoferrin binding assay.
Immunization of animals and immunoassays.
Groups of two
guinea pigs (Hartley outbred; Charles River, LaSalle, Quebec) were
immunized intramuscularly on day 1 with 5 µg of purified rLbpA or
rLbpB protein emulsified in complete Freund's adjuvant. Animals were
boosted on days 14 and 29 with the same doses of protein emulsified in
incomplete Freund's adjuvant. Serum samples were collected on day 42 for determination of bactericidal activity. Anti-Lbp antibody titers in
guinea pig immune sera were determined by antigen-specific
enzyme-linked immunosorbent assays (ELISAs), as previously described
(40). Microtiter wells (Nunc-MAXISORB; Nunc, Roskilde,
Denmark) were coated with 50 µl of protein (0.5 µg
ml
1). The reactive titer of an antiserum was defined as
the reciprocal of the highest dilution consistently showing a twofold
increase in absorbance at 450 nm over that obtained with the preimmune serum samples.
Whole-cell ELISAs. M. catarrhalis 4223 was grown in the presence of EDDA, as described above. Cell pellets were collected by centrifugation, washed with PBS, and resuspended in 50 mM carbonate-bicarbonate buffer, pH 9.6. The optical density of the suspension was adjusted to 0.5 at 490 nm, and 200 µl of a 1:100 dilution of whole bacteria was used to coat microtiter wells. The plates were air-dried at 37°C overnight and then blocked with PBS-0.1% bovine serum albumin (BSA) at 37°C for 1 h (250 µl per well). After three washes with PBS-0.1% Tween 20, 200 µl of antisera at an appropriate dilution (in PBS-0.1% gelatin) was added to the wells and further incubated at 37°C for 2 h. Affinity-purified F(ab')2 fragment of donkey anti-guinea pig immunoglobulin G (H+L) antibodies conjugated to HRP (Jackson ImmunoResearch Laboratories) was used as reporter. The reactions were developed with tetramethylbenzidine-H2O2 (ADI), and absorbancies were measured at 450 nm (with 540 nm as a reference wavelength) in a Flow Multiskan MCC microplate reader (ICN Biomedicals).
Antigenic conservation of LbpA and LbpB in M. catarrhalis strains. To demonstrate the iron-dependent expression of the lbpA and lbpB genes, representative M. catarrhalis strains were grown in BHI with or without 25 µM EDDA. Whole-cell lysates were separated by SDS-PAGE and electrophoretically transferred to a nitrocellulose membrane. Guinea pig anti-Q8 rLbpA, anti-Q8 rLbpB, and anti-4223 rLbpB antisera were used as first antibodies, and HRP-conjugated protein G (Zymed Laboratories, San Francisco, Calif.) was used as reporter.
To assess antigenic conservation, approximately 90 M. catarrhalis strains obtained from North America or Finland were grown in BHI plus 25 µM EDDA, and immunoblots were probed with guinea pig anti-4223 rLbpB antibody, as described above.Bactericidal antibody assay.
The bactericidal antibody assay
was performed as previously described (39). Briefly, the
M. catarrhalis strains were grown to an optical density at
578 nm of 0.5 in BHI medium containing 25 µM EDDA. The bacteria were
diluted so that 150 to 450 CFU were added to each reaction. Guinea pig
anti-rLbpA or anti-rLbpB antisera and prebleed controls were heated to
56°C for 30 min to inactivate endogenous complement and were diluted
with veronal buffer containing 0.1% BSA (VBS). Guinea pig complement
(BioWhittaker, Walkersville, Md.) was diluted 1:10 in VBS. Twenty-five
microliters each of diluted antiserum, bacteria, and complement was
added to duplicate wells of a 96-well microtiter plate (Nunc). The
plates were incubated at 37°C for 60 min with gentle shaking at 70 rpm on a rotary platform. Fifty microliters of each reaction mixture
was plated onto Mueller-Hinton agar plates (Becton Dickinson) which
were incubated at 37°C for 24 h, and then at room temperature
for 24 h, before the bacteria were counted. Antisera were
determined to be bactericidal if
50% of bacteria were killed
compared with preimmune serum controls. Assays were performed at least
twice, and two different guinea pig antisera were tested against the
autologous strains.
Nucleotide sequence accession numbers. The sequence data in this report have been submitted to the GenBank database under accession no. AF043131 through AF043133.
| |
RESULTS |
|---|
|
|
|---|
Cloning of the M. catarrhalis lfr genes. In order to clone the M. catarrhalis lactoferrin receptor genes, native LbpA protein was purified from strain 4223 by affinity chromatography under high-stringency conditions with immobilized lactoferrin (3) and submitted for N-terminal sequence analysis. The N terminus was found to be blocked, so the protein was digested with cyanogen bromide and the N-terminal sequence was obtained from an internal 13-kDa fragment. The sequence, MVQYTYRKGKENKAH, was not found in M. catarrhalis TbpA (manuscript submitted) or in other known TbpA or LbpA proteins. Based upon this unique LbpA sequence, a degenerate sense primer was designed for PCR amplification of part of the lbpA gene. An antisense PCR primer was designed based upon the sequence LEMKF, which has been found at the carboxyl terminus of all known LbpA and the related TbpA proteins. By using these primers, specific 2.2-kb fragments were PCR amplified from strain 4223 and Q8 chromosomal DNA. Partial sequence analysis determined that the fragments were not from the M. catarrhalis tbpA gene (manuscript submitted). The 2.2-kb fragment was used as a probe to screen M. catarrhalis 4223 and Q8 chromosomal libraries in EMBL3. Putative phage clones containing approximately 16-kb inserts were identified, and the lbpA gene was localized to a ~9-kb HindIII fragment by restriction enzyme and Southern blot analyses. The 9-kb HindIII fragments from the strain 4223 and Q8 libraries were subcloned, generating plasmids pLD1-8 and pLDW1, respectively.
Analysis of the nucleotide sequence of the lfr
genes.
The inserts from pLD1-8 and pLDW1 were sequenced, and three
complete open reading frames (ORFs) and one partial ORF were
identified. The gene arrangement was lbpB-lbpA-orf3, with
a fourth partial ORF located downstream (Fig.
1). The coding sequence of the
lbpB gene was approximately 2.7 kb, and putative promoter
elements were identified upstream of lbpB (Fig.
2A). The potential
10 and ribosome
binding site (RBS) sequences were more widely spaced than those found
in E. coli consensus sequences. The separation of these two
elements is greater in the Q8 lbpB sequence than in the 4223 lbpB sequence due to the presence of an extra 11 nucleotides (italicized in Fig. 2A). A putative Fur binding site was identified overlapping the
10 region of the lbpB promoter (Fig. 2B).
The intergenic distance between lbpB and lbpA was
184 bp, and there was a second possible promoter region upstream of
lbpA, which more closely resembles consensus E. coli promoters. The coding sequence of the lbpA gene
was approximately 3.0 kb, and the intergenic distance between
lbpA and the orf3 gene was only a single
nucleotide. Possible consensus sequences for promoter elements were
identified upstream of orf3, within the coding sequence of
lbpA. The coding sequence of orf3 was 1.6 kb, and
the intergenic sequence between orf3 and orf4 was
583 bp. Promoter elements were identified upstream of orf4.
|
|
Analysis of the deduced amino acid sequences of the lactoferrin binding proteins. The M. catarrhalis Q8 and 4223 lbpA genes encode proteins of molecular mass 110.8 kDa that are 99% identical, with only seven different residues between them. Compared with known LbpA sequences from N. meningitidis (27, 28) and N. gonorrhoeae (1), there is about 32% sequence identity and 50% sequence similarity between the M. catarrhalis and the neisserial LbpA proteins (Fig. 3). The main differences between the M. catarrhalis and neisserial LbpA proteins are several small inserts, particularly in the N-terminal 80 amino acids and between residues 593 and 858. The deduced sequences of the LbpA proteins can be aligned with peptide sequences derived from purified native M. catarrhalis 141 LbpA (4). For the first peptide, 19 of 20 residues are identical, and for the second peptide, 16 of 16 residues are identical (Fig. 3).
|
|
|
Expression of rLbpA and rLbpB from E. coli and protein purification. The lbpA and lbpB genes were cloned into plasmid pT7-7 (37), and the recombinant proteins were expressed in E. coli BL21(DE3) cells. Strain Q8 rLbpA was expressed at about 10% of total proteins as inclusion bodies, but the strain 4223 rLbpA protein was expressed at much lower yield and was not studied further. Two rLbpB proteins were expressed: one from the ATG start codon, which included the signal sequence, and the other as the mature protein starting from the cysteine residue. The mature LbpB proteins from strains Q8 and 4223 were made at 5 to 10% of total proteins as inclusion bodies, but the rLbpB proteins with the leader sequence were made in very low yield and were not studied further. The recombinant ORF3 protein could not be expressed in E. coli.
The Q8 rLbpA, Q8 rLbpB, and 4223 rLbpB proteins were purified by the same procedure. Briefly, the cell pellet from an induced bacterial culture was lysed by sonication and enriched for inclusion bodies, and the recombinant proteins were purified by gel filtration (Fig. 6). The rLbpB proteins were found to bind human lactoferrin (Fig. 7B) but not human transferrin (Fig. 7C). Under the same conditions, rLbpA and rTbpB did not bind human lactoferrin (Fig. 7B).
|
|
Immunogenicity and antigenic conservation of LbpA and LbpB. Both rLbpA and rLbpB were found to be immunogenic. Immunoblot analysis of M. catarrhalis isolates showed that eight of eight strains examined expressed an approximately 105-kDa protein recognized by anti-rLbpA antibody, and all of the approximately 90 strains tested expressed a protein recognized by anti-rLbpB antibodies. Representative immunoblots are shown in Fig. 8. The M. catarrhalis LbpB proteins were surprisingly homogenous in molecular mass, with about 57% of strains expressing an LbpB protein that comigrated with LbpA and the remainder of the strains expressing a slightly smaller protein (Fig. 8A). Both the LbpA and LbpB proteins appeared to be expressed constitutively in M. catarrhalis, although an increase in expression was observed with iron restriction (Fig. 8B and C). There was also weak recognition, by anti-LbpB antibody, of approximately 85- to 90-kDa protein bands in some strains grown under iron-reduced conditions (Fig. 8C). The anti-rLbpA and anti-rLbpB antibody titers were measured by ELISA, and the anti-rLbpB titers were found to be very high (Table 1).
|
|
Bactericidal antibody activity.
Bactericidal antibody assays
were performed with guinea pig antisera. Two guinea pig antisera were
tested against the autologous strain, and in each case they were found
to be equivalent. Neither of the two guinea pig anti-Q8 rLbpA antisera
killed strain Q8, even at antibody dilutions of only 1:8. When
bactericidal activity was defined as
50% killing, a 1:64 dilution of
anti-4223 rLbpB antiserum and a 1:16 dilution of anti-Q8 rLbpB
antiserum were bactericidal against their autologous strains. A 1:32
dilution of anti-4223 rLbpB antiserum also killed strain Q8, and a 1:16 dilution of anti-Q8 rLbpB killed strain 4223. Anti-4223 rLbpB antiserum
at a dilution of 1:64 was used to screen for bactericidal activity
against four additional heterologous strains, VH-19, LES-1, H-04, and
3, and was found to kill three of them (Table 2).
|
| |
DISCUSSION |
|---|
|
|
|---|
Bacterial transferrin and lactoferrin receptors are heterodimeric complexes of proteins, TbpA-TbpB and LbpA-LbpB, known to be functionally and genetically related (13). In order to clone the M. catarrhalis lfr genes and not the tfr genes, a specific lbpA probe was generated. PCR primers were designed based upon an internal cyanogen bromide fragment of affinity-purified M. catarrhalis LbpA and the conserved carboxyl-terminal sequence LEMKF, thus far identified in all TbpA and LbpA proteins. By this approach, specific 2.2-kb lbpA gene fragments were amplified from strains 4223 and Q8 and these were used to probe the gene libraries and clone the complete lfr loci. The sense primer used to PCR amplify the 4223 and Q8 lbpA fragments had two codons missing (Y at position 6 and K at position 10) due to an error in transcribing the N-terminal sequence analysis report. The fact that a fragment of the lbpA gene could still be cloned was probably due to the two-step process of first generating a PCR fragment and then using that as the probe for the libraries.
The N. meningitidis and H. influenzae tfr operons
are comprised of the tbpB and tbpA genes arranged
in tandem with a single promoter region upstream of tbpB.
The intergenic distance between the tbpB and tbpA
genes ranges from 13 to 87 bp. Pettersson et al. (28)
proposed that the N. meningitidis lactoferrin binding proteins may also be encoded on an operon having the gene arrangement lbpB-lbpA, especially since the lbpB and
lbpA genes overlap. In M. catarrhalis, the
lfr genes are arranged as tandem genes, with lbpB
followed by lbpA at an intergenic distance of 184 bp. The putative lbpB promoter sequences have an unusually large
separation between the putative
10 and RBS sequences, especially in
the Q8 locus, which contains an extra 11 nucleotides in this region. Promoter elements can be readily identified upstream of M. catarrhalis lbpA, suggesting that lbpB and
lbpA may be independently transcribed. Of particular
interest in the cloned lfr locus is the presence of a third
gene immediately downstream of lbpA, which is apparently unique to M. catarrhalis. Since the orf3 gene was
cloned from two independent libraries, it is unlikely to be an
experimental artifact. Potential promoter elements for orf3
can be identified within the lbpA gene. What role ORF3 may
have, if any, in the lactoferrin receptor protein complex is unknown.
Expression of the tfr and lfr genes has been
shown to be inducible under iron repression in vitro, a process thought
to mimic the iron-restricted environment in the human host. From our
data, there is a basal level of expression of the M. catarrhalis
lfr genes observed in iron-sufficient medium, with an enhanced
expression evident upon iron restriction. These data confirm the dot
blot experiments of Schryvers and Lee, who showed that M. catarrhalis expressed low levels of transferrin and lactoferrin
binding proteins under iron-sufficient growth conditions
(33). The product of the ferric uptake regulation
(fur) gene is thought to be responsible for this regulation
of gene expression, and Fur binding sequences have been identified in
the
10 region of the promoters for both the N. meningitidis and H. influenzae tbpB genes (12,
19). A potential Fur binding sequence was identified upstream of
N. meningitidis lbpA; however, Pettersson et al.
(28) were unable to demonstrate its functionality. In the
case of N. meningitidis lfr, which is probably an operon, it
seems likely that the Fur binding sequence is located upstream of
lbpB, rather than lbpA, and will be identified
once the complete N. meningitidis lbpB sequence is known.
Compared with the consensus sequence for Fur binding sites
(14), a homologous sequence can be identified in the
10
region of the M. catarrhalis strain Q8 lbpB
promoter, but there is no obvious consensus sequence in the
10 region
of the lbpA promoter. There are 11 nucleotides missing in
the 4223 lbpB promoter region which are located within the
putative Fur binding site of the Q8 lbpB promoter. The loss
of these nucleotides in 4223 lbpB results in the loss of the
Fur binding site and suggests another iron regulation mechanism for
4223 LbpB.
When the lactoferrin binding proteins from N. meningitidis, N. gonorrhoeae, and M. catarrhalis were first described, a single Lbp protein of an approximate molecular mass 105 kDa was identified (33). Subsequently, an 84-kDa protein isolated by low-stringency binding to lactoferrin was identified as LbpB (3). However, Bonnah et al. have recently demonstrated that the 84-kDa protein is CopB, and a 95-kDa protein has been identified as LbpB (4). Our data demonstrate clearly that, in some strains, the LbpA and LbpB proteins comigrate (Fig. 8A). The LbpA protein is quite homogeneous at about 105 kDa (Fig. 8B), and in 51 of the 90 strains examined, the LbpB protein comigrates with LbpA. In the remainder of the strains, the LbpB protein is apparently slightly smaller, but overall there is very little size heterogeneity for the M. catarrhalis LbpB proteins. This is in contrast to the TbpB proteins, which have been shown to be quite variable in size, ranging from about 68 to 88 kDa for N. meningitidis (30) and from about 60 to 90 kDa for H. influenzae (20), although less size heterogeneity was observed for the N. gonorrhoeae TbpB proteins, at 78 to 86 kDa (6).
The M. catarrhalis LbpA proteins were found to be 99% identical to each other. The N. meningitidis LbpA proteins from strains BNCV and H44/76 have been shown to be 95% identical to each other (27, 28) and 94% identical to the N. gonorrhoeae LbpA protein (1). Thus, as was previously found for the transferrin binding proteins, in which TbpA was highly conserved within a species, the LbpA proteins are also highly conserved. When compared with the neisserial LbpA proteins, there are several small inserts found in the M. catarrhalis LbpA proteins. Compared to the TbpA-LbpA topology model described by Gray-Owen and Schryvers (13), these inserts occur within the N-terminal periplasmic tail and extracellular loops 7, 9, 10, and 11.
Based upon the sequence variability of known TbpB proteins, it was expected that the LbpB proteins would show significant sequence variability; however, the three M. catarrhalis LbpB proteins showed surprising similarity, with strains Q8 and 4223 having 92% identical LbpB proteins. Strain Q8 was originally isolated from patient sputum in Montreal, Quebec, Canada; strain 4223 was isolated from middle ear fluid from a patient in Buffalo, N.Y.; and strain VH19 was isolated from middle ear fluid from a patient in Galveston, Tex. Strains Q8 and 4223 are also phenotypically distinct (39). The M. catarrhalis LbpB proteins show limited homology with the partial sequences of the putative N. meningitidis LbpB proteins. There is also very little homology with the known TbpB proteins, with the exception of short scattered sequences, the most notable being NRFVG at positions 390 to 394 and LEGGFYG at positions 430 to 436 (25). The conservation of these scattered residues (underlined) in bacterial TbpB proteins and in M. catarrhalis LbpB suggests that they may play a functional role in these iron-binding molecules. There is an unusually high content of Asp and Asn residues in LbpB, with a region of 50 residues that is ~54% Asp and another region of 26 residues that is ~42% Asn. The purpose of such concentrations of identical residues is unknown, but the fact that they are conserved among the three encoded LbpB proteins in this study suggests that they serve some function. Another unique feature of the M. catarrhalis LbpB proteins is the presence of a conserved RGD motif. This sequence is well established as a site for attachment of bacteria to eukaryotic cells (31), suggesting that the M. catarrhalis LbpB protein may act as an adhesin. An RGD motif has not been identified in any of the published TbpB sequences, and it will be interesting to see whether it is present in LbpB proteins from other species.
When the H. influenzae Rd genome was sequenced, it was found that there were several copies of transferrin or lactoferrin binding-like proteins (11). To demonstrate that we had indeed cloned the M. catarrhalis lfr genes and not a variant of the tfr genes, we tested the binding of the recombinant Lbp proteins to human lactoferrin. As demonstrated for transferrin binding proteins where only the TbpB protein binds to human transferrin after gel electrophoresis and electroblotting, only the LbpB, not the LbpA protein, specifically bound human lactoferrin. Since lactoferrin is known to be a sticky molecule, we also demonstrated that rTbpB did not bind to human lactoferrin under the same conditions. In addition, a corollary experiment was performed in which it was shown that only rTbpB, not rLbpA or rLbpB, bound human transferrin. Finally, the internal peptide sequences identified by Bonnah et al. (4) from M. catarrhalis 141 LbpA can be found in our sequences (Fig. 3). These data clearly demonstrate that we have cloned the lbpA and lbpB genes of M. catarrhalis.
The most unique finding in the M. catarrhalis lfr locus is the presence of the third gene, orf3. The putative ORF 3 protein has no homology to known proteins in the databases, and it contains an internal repeat of the tetramer DGLG. Such repeats sometimes represent phenotypic switches used to regulate virulence factors (35). We had hoped to be able to generate anti-rORF3 antibodies in order to determine whether ORF3 is expressed in M. catarrhalis, but we were unable to express the recombinant protein.
Guinea pigs immunized with purified rLbpA or rLbpB proteins elicited
high-titer antibodies. There is no animal model for otitis media caused
by M. catarrhalis, but a bactericidal antibody assay has
been established (39). The clumping nature of M. catarrhalis strains makes this assay difficult to perform, so the
data is only qualitative, not quantitative. The anti-Q8 rLbpA antibody was not bactericidal against its autologous strain. Since native LbpA
protein is a transmembrane protein, it is possible that antibody raised
to inclusion body-derived rLbpA protein would not recognize the native
protein in intact organisms. However, in whole cell ELISAs, it was
demonstrated that both anti-rLbpA and anti-rLbpB antisera recognized
intact cells at titers ranging from 400 to 1,600 (data not shown). The
anti-rLbpB antisera were weakly bactericidal, although the anti-4223
rLbpB antiserum appeared to be slightly more potent than the anti-Q8
rLbpB antiserum against their autologous strains. Heterologous strains
were screened with a 1:64 dilution of anti-4223 rLbpB antiserum, and an
arbitrary cutoff of
50% killing was defined as bactericidal
activity. The heterologous strains that were tested were chosen based
upon the diversity of their geographic origins and the inclusion of a
mixture of molecular masses and anatomical sources. The data in Table 2 show that anti-4223 rLbpB antiserum was able to kill three of five
heterologous strains by this stringent definition. There does not
appear to be any correlation between the antibacterial activity of
anti-4223 rLbpB and any other factor.
In this study, we have characterized the genes of the M. catarrhalis lfr locus and found that there are three closely spaced genes encoding conserved proteins. The lbpA and lbpB genes show some homology to other bacterial lbpA, tbpA, and tbpB genes, but the nature and function of the third gene is unknown. Recombinant LbpA and LbpB proteins were produced as inclusion bodies, and the purified proteins were used to generate high-titer antibodies. The anti-rLbpA antibody was not bactericidal, but the anti-rLbpB antibodies were bactericidal for autologous and heterologous strains of M. catarrhalis. Thus, rLbpB proteins may represent candidate vaccine antigens to protect against M. catarrhalis disease.
| |
ACKNOWLEDGMENTS |
|---|
We thank Bill Bradley for oligonucleotide synthesis, Diane England for DNA sequencing, and Manjit Haer, Wayne Williams, and Wan Xu-Li for excellent technical assistance.
| |
FOOTNOTES |
|---|
* Corresponding author. Mailing address: Pasteur Merieux Connaught Canada Research Centre, 1755 Steeles Ave. W., North York, Ontario, Canada M2R 3T4. Phone: (416) 667-2932. Fax: (416) 667-2740. E-mail: sloosmore{at}ca.pmc-vacc.com.
Editor: P. E. Orndorff
| |
REFERENCES |
|---|
|
|
|---|
| 1. | Biswas, G. D., and P. F. Sparling. 1995. Characterization of lbpA, the structural gene for a lactoferrin receptor in Neisseria gonorrhoeae. Infect. Immun. 63:2958-2967[Abstract]. |
| 2. | Bluestone, C. D. 1989. Modern management of otitis media. Pediatr. Clin. North Am. 36:1371-1377[Medline]. |
| 3. | Bonnah, R. A., R. H. Yu, and A. B. Schryvers. 1995. Biochemical analysis of lactoferrin receptors in the Neisseriaceae: identification of a second bacterial lactoferrin receptor protein. Microb. Pathog. 19:285-297[Medline]. |
| 4. | Bonnah, R. A., R.-H. Yu, H. Wong, and A. B. Schryvers. 1998. Biochemical and immunological properties of lactoferrin binding proteins from Moraxella (Branhamella) catarrhalis. Microb. Pathog. 24:89-100[Medline]. |
| 5. |
Catlin, B. W.
1990.
Branhamella catarrhalis: an organism gaining respect as a pathogen.
Clin. Microbiol. Rev.
3:293-320 |
| 6. |
Cornelissen, C. N.,
G. D. Biswas,
J. Tsai,
D. K. Paruchuri,
S. A. Thompson, and P. F. Sparling.
1992.
Gonococcal transferrin binding protein 1 causes Escherichia coli to bind to human transferrin.
J. Bacteriol.
174:5788-5797 |
| 7. | del Castillo, F., A. Garcia-Perea, and F. Baquero-Artigao. 1996. Bacteriology of acute otitis media in Spain: a prospective study based on tympanocentesis. Pediatr. Infect. Dis. J. 15:541-543[Medline]. |
| 8. | de Lillo, A., and J. F. Fierro. 1997. Identification of a lactoferrin-binding protein in Prevotella nigrescens. FEMS Microbiol. Lett. 150:61-64[Medline]. |
| 9. | Dhaenens, L., F. Szczebara, and M. O. Husson. 1997. Identification, characterization, and immunogenicity of the lactoferrin-binding protein from Helicobacter pylori. Infect. Immun. 65:514-518[Abstract]. |
| 10. |
Enright, M. C., and H. McKenzie.
1997.
Moraxella (Branhamella) catarrhalis clinical and molecular aspects of a rediscovered pathogen.
J. Med. Microbiol.
46:360-371 |
| 11. |
Fleischmann, R. D.,
M. D. Adams,
O. White,
R. A. Clayton,
E. F. Kirkness,
A. R. Kerlavage,
C. J. Bult,
J.-F. Tomb,
B. A. Dougherty,
J. M. Merrick,
K. McKenney,
G. Sutton,
W. FitzHugh,
C. Fields,
J. D. Gocayne,
J. Scott,
R. Shirley,
L.-I. Liu,
A. Glodek,
J. M. Kelley,
J. F. Weidman,
C. A. Phillips,
T. Spriggs,
E. Hedblom,
M. D. Cotton,
T. R. Utterback,
M. C. Hanna,
D. T. Nguyen,
D. M. Saudek,
R. C. Brandon,
L. D. Fine,
J. L. Fritchman,
J. L. Fuhrmann,
N. S. M. Geoghagen,
C. L. Gnehm,
L. A. McDonald,
K. V. Small,
C. M. Fraser,
H. O. Smith, and J. C. Venter.
1995.
Whole-genome random sequencing and assembly of Haemophilus influenzae Rd.
Science
269:496-512 |
| 12. | Gray-Owen, S. D., S. Loosmore, and A. B. Schryvers. 1995. Identification and characterization of genes encoding the human transferrin-binding proteins from Haemophilus influenzae. Infect. Immun. 63:1201-1210[Abstract]. |
| 13. | Gray-Owen, S. D., and A. B. Schryvers. 1996. Bacterial transferrin and lactoferrin receptors. Trends Microbiol. 4:185-191[Medline]. |
| 14. |
Griggs, D. W., and J. Konisky.
1989.
Mechanism for iron-regulated transcription of the Escherichia coli cir gene: metal-dependent binding of Fur protein to the promoters.
J. Bacteriol.
171:1048-1054 |
| 15. | Harkness, R. E., M.-J. Guimond, B.-A. McBey, M. H. Klein, D. H. Percy, and B. A. Croy. 1993. Branhamella catarrhalis pathogenesis in SCID and SCID/beige mice. APMIS 101:805-810[Medline]. |
| 16. | Homoe, P., J. Prag, S. Farholt, J. Henrichsen, A. Hornsleth, M. Kilian, and J. S. Jensen. 1996. High rate of nasopharyngeal carriage of potential pathogens among children in Greenland: results of a clinical survey of middle-ear disease. Clin. Infect. Dis. 23:1081-1090[Medline]. |
| 17. | Ioannidis, J. P. A., M. Worthington, J. K. Griffiths, and D. R. Snydman. 1995. Spectrum and significance of bacteremia due to Moraxella catarrhalis. Clin. Infect. Dis. 21:390-397[Medline]. |
| 18. | Laemmli, U. K. 1970. Cleavage of structural proteins during the assembly of the head of bacteriophage T4. Nature 227:680-685[Medline]. |
| 19. | Legrain, M., V. Mazarin, S. W. Irwin, B. Bouchon, M.-J. Quentin-Millet, E. Jacobs, and A. B. Schryvers. 1993. Cloning and characterization of Neisseria meningitidis genes encoding the transferrin-binding proteins Tbp1 and Tbp2. Gene 130:73-80[Medline]. |
| 20. | Loosmore, S. M., Y.-P. Yang, D. C. Coleman, J. M. Shortreed, D. M. England, R. E. Harkness, P. S.-C. Chong, and M. H. Klein. 1996. Cloning and expression of the Haemophilus influenzae transferrin receptor genes. Mol. Microbiol. 19:575-586[Medline]. |
| 21. | McCarty, J. M. 1995. Bacterial susceptibility and tympanocentesis in acute otitis media. Pediatr. Infect. Dis. J. 14:S45-S50. |
| 22. |
Menozzi, F. D.,
C. Gantiez, and C. Locht.
1991.
Identification and purification of transferrin- and lactoferrin-binding proteins of Bordetella pertussis and Bordetella bronchiseptica.
Infect. Immun.
59:3982-3988 |
| 23. | Meyer, G. A., T. R. Shope, N. J. Waeker, Jr., and F. H. Lanningham. 1995. Moraxella (Branhamella) catarrhalis bacteremia in children. Clin. Pediatr. 34:146-150. |
| 24. |
Nissinen, A.,
P. Gronroos,
P. Huovinen,
E. Herva,
M.-L. Katila,
T. Klaukka,
S. Kontiainen,
O. Liimatainen,
S. Oinonen, and P. H. Makela.
1995.
Development of -lactamase-mediated resistance to penicillin in middle-ear isolates of Moraxella catarrhalis in Finnish children, 1978-1993.
Clin. Infect. Dis.
21:1193-1196[Medline].
|
| 25. |
Ogunnariwo, J. A., and A. B. Schryvers.
1996.
Rapid identification and cloning of bacterial transferrin and lactoferrin receptor protein genes.
J. Bacteriol.
178:7326-7328 |
| 26. | Ogunnariwo, J. A., T. K. W. Woo, R. Y. C. Lo, G. C. Gonzalez, and A. B. Schryvers. 1997. Characterization of the Pasteurella haemolytica transferrin receptor genes and the recombinant receptor proteins. Microb. Pathog. 23:273-284[Medline]. |
| 27. |
Pettersson, A.,
P. van der Ley,
J. T. Poolman, and J. Tommassen.
1993.
Molecular characterization of the 98-kilodalton iron-regulated outer membrane protein of Neisseria meningitidis.
Infect. Immun.
61:4724-4733 |
| 28. | Pettersson, A., V. Klarenbeek, J. van Deurzen, J. T. Poolman, and J. Tommassen. 1994. Molecular characterization of the structural gene for the lactoferrin receptor of the meningococcal strain H44/76. Microb. Pathog. 17:395-408[Medline]. |
| 29. |
Pettersson, A.,
A. Maas, and J. Tommassen.
1994.
Identification of the iroA gene product of Neisseria meningitidis as a lactoferrin receptor.
J. Bacteriol.
176:1764-1766 |
| 30. | Rokbi, B., G. Maitre-Wilmotte, V. Mazarin, L. Fourrichon, L. Lissolo, and M. J. Quentin-Millet. 1995. Variable sequences in a mosaic-like domain of meningococcal tbp2 encode immunoreactive epitopes. FEMS Microbiol. Lett. 132:277-283[Medline]. |
| 31. | Ruoslahti, E., and M. D. Pierschbacher. 1986. Arg-Gly-Asp: a versatile cell recognition signal. Cell 44:517-518[Medline]. |
| 32. | Sambrook, J., E. F. Fritsch, and T. Maniatis. 1989. Molecular cloning: a laboratory manual, 2nd ed. Cold Spring Harbor Laboratory, Cold Spring Harbor, N.Y. |
| 33. | Schryvers, A. B., and B. C. Lee. 1989. Comparative analysis of the transferrin and lactoferrin binding proteins in the family Neisseriaceae. Can. J. Microbiol. 35:409-415[Medline]. |
| 34. | Staggs, T. M., M. K. Greer, J. B. Baseman, S. C. Holt, and V. V. Tryon. 1994. Identification of lactoferrin-binding proteins from Treponema pallidum subspecies pallidum and Treponema denticola. Mol. Microbiol. 12:613-619[Medline]. |
| 35. | Stern, A., M. Brown, P. Nickel, and T. F. Meyer. 1986. Opacity genes in Neisseria gonorrhoeae: control of phase and antigenic variation. Cell 47:61-71[Medline]. |
| 36. | Struye, M., M. Moons, and J. Tommassen. 1991. Carboxy-terminal phenylalanine is essential for the correct assembly of a bacterial outer membrane protein. J. Mol. Biol. 218:141-148[Medline]. |
| 37. |
Tabor, S., and S. S. Richardson.
1985.
A bacteriophage T7 RNA polymerase/promoter system for controlled exclusive expression of specific genes.
Proc. Natl. Acad. Sci. USA
82:1074-1078 |
| 38. | Wu, H. C., and M. Tokunaga. 1986. Biogenesis of lipoproteins in bacteria. Curr. Top. Microbiol. Immunol. 125:127-157[Medline]. |
| 39. | Yang, Y. P., L. E. Myers, U. McGuinness, P. Chong, Y. Kwok, M. H. Klein, and R. E. Harkness. 1997. The outer membrane protein, CD, extracted from Moraxella (Branhamella) catarrhalis is a potential vaccine antigen that induces bactericidal antibodies. FEMS Immunol. Med. Microbiol. 17:187-199[Medline]. |
| 40. | Yang, Y. P., R. S. Munson, Jr., S. Gross, P. Chong, R. E. Harkness, L. Gisonni, O. James, Y. Kwok, and M. H. Klein. 1997. Effect of lipid modification on the physicochemical, structural, antigenic and immunoprotective properties of Haemophilus influenzae outer membrane protein P6. Vaccine 15:976-987[Medline]. |
This article has been cited by other articles:
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Copyright © 2009 by the American Society for Microbiology. For an alternate route to Journals.ASM.org, visit: http://intl-journals.asm.org | More Info»