Previous Article | Next Article 
Infect Immun, August 1998, p. 3867-3873, Vol. 66, No. 8
0019-9567/98/$04.00+0
Copyright © 1998, American Society for Microbiology. All rights reserved.
Identification and Characterization of a
Phase-Specific, Nuclear DNA Binding Protein from the Dimorphic
Pathogenic Fungus Histoplasma capsulatum
Fatima E.
Abidi,1
Haeri
Roh,2 and
Elizabeth J.
Keath3 *
Center for Molecular Studies, J. C. Self
Research Institute, Greenwood Genetics Center, Greenwood, South
Carolina 296461;
Department of Surgery,
Washington University School of Medicine, St. Louis, Missouri
631102; and
Department of Biology, Saint
Louis University, St. Louis, Missouri 631033
Received 11 February 1998/Returned for modification 24 March
1998/Accepted 13 May 1998
 |
ABSTRACT |
Genes expressed in the parasitic yeast (Y) phase of the dimorphic
fungal pathogen Histoplasma capsulatum which are
transcriptionally silent in the mycelial (M) phase have recently been
cloned and analyzed. To understand the molecular regulation of genes
involved in the transition to and maintenance of the Y phase, the
presumptive 5' regulatory regions of two Y phase-specific genes
(yps-3 and yps 21:E-9) were PCR amplified as
labelled probes to identify nuclear DNA binding proteins which may
influence phase-specific gene transcription. Protein-DNA interactions
were assessed by Southwestern blot analysis in which sodium dodecyl
sulfate-polyacrylamide gel electrophoresis-separated protein extracts
from Y and M phases of the virulent G217B strain of H. capsulatum were visualized by their capability for in situ
binding to the labelled 517-bp (G217B yps-3) or the 395-bp
(G217B yps 21:E-9) putative 5' regulatory regions. A 30-kDa
nuclear protein unique to the M-phase extracts of the highly virulent
G217B strain, but absent in the Y phase of the same organism, was
identified. In contrast, the low-virulence, thermal-sensitive Downs
strain of H. capsulatum lacked detectable p30 binding
activity in either yeast- or mycelial phase extracts, regardless of the
source of labelled probe (395-bp G217B yps 21:E-9 probe or
512-bp HindIII-EcoRI-labelled Downs
yps21:E-9). A decanucleotide motif, TCCTTTTTTT,
was identified in the upstream regulatory regions of these
yps genes, as well as in the putative
-tubulin promoter, and was conserved with 70 to 100% homology. This recognition sequence was sufficient for p30M binding with 32P-labelled ligated
oligonucleotides when used in the Southwestern assay. These findings
describe the first nuclear DNA binding factor identified in H. capsulatum which binds to target sequences in a phase-specific
manner, suggesting that p30M may govern aspects of gene transcription
in this pathogenic fungus, in which a temperature-sensitive switch
influences morphology and virulence.
 |
INTRODUCTION |
Histoplasma capsulatum is
the dimorphic fungal pathogen that is the etiologic agent of
histoplasmosis, the most common systemic mycosis in the midwestern
United States (23). Severe disease is rare in
immunocompetent individuals in regions where the disease is endemic,
but a life-threatening disseminated mycosis occurs in patients with
AIDS (7) or in individuals undergoing immunosuppressive therapy (34). H. capsulatum adopts either of two
morphologically distinct phases, which are controlled by environmental
temperatures and other cues (19, 23, 24, 31). At 25°C, or
environmental temperatures, the organism is a saprophyte in the
mycelial phase, but at elevated host temperatures of 37°C it converts
to a unicellular budding yeast in infected tissue (23). The
yeast phase, however, is found exclusively in infected tissues
(23) and is the form required for progressive infection
(25, 26). Thus, genes involved in the transition to or
maintenance of the parasitic yeast phase may be of prime importance in
exposing the relation of morphology to virulence in this organism.
By exploiting the unique characteristics of dimorphism in H. capsulatum, several distinct genes that are expressed in the yeast
phase at 37°C and that are transcriptionally silent in the mycelial
form of virulent strains, such as G217B and G222B, at 25°C have been
cloned by a subtraction-library strategy (16). For example,
the early expression of the yps-3 gene at day 1, following a
shift in temperature to 37°C of hyphal cultures of H. capsulatum, and its continued expression throughout the
temperature-induced transition to the Y phase appears to
correlate with virulence and temperature sensitivity in
nonisogenic strains (18). The genomic nucleotide sequence of
the yps-3 gene cloned from G217B and a partial cDNA isolated
from the yeast phase of the same strain have been reported
(17). More recently, a second yeast phase-specific gene from
H. capsulatum, yps 21:E-9, has been molecularly
cloned and sequenced (1, 16). In contrast to
yps-3, yps 21:E-9 exhibits a late pattern of
expression (day 11) when mycelia are induced to form yeast at 37°C
(1). However, since neither the nucleotide sequences of
yps-3 and yps 21:E-9 nor their predicted protein products are homologous to sequences currently in GenBank, the roles of
the proteins in dimorphism or virulence remain obscure.
The previous reports characterizing yps-3 and yps
21:E-9 have demonstrated high levels of yeast phase gene
expression in thermally tolerant, high-virulence strains of H. capsulatum (1, 16, 17, 18), including G217B. However,
this same cadre of yps genes were transcriptionally silent
in the low-virulence, temperature-sensitive Downs strain, although the
genes and much of their putative regulatory regions were retained and
even sequenced from the Downs genome (1, 17). These findings
may point to a deficiency in binding or expression of a
temperature-inducible regulatory protein in the low-virulence strain.
The expression of constitutive, tissue-specific, and inducible genes is
regulated by specific protein factors which interact with control
sequences of different genes or targets and govern their expression
(22, 28) in various cell types. For example, many upstream
activating sequence (UASs) have been determined, and the presence of
specific binding proteins interacting with these target elements
(27, 30) has been demonstrated in the yeast
Saccharomyces cerevisiae. Some regulatory genes, such as GAL4 and GCN4, encode the proteins that bind
specifically to the unique UASs of the GAL gene family and
additional genes under general amino acid control (2,
11-14). Alternatively, some cis-regulatory elements
(upstream repression sequences or silencers) repress the expression of
some genes, including those controlling the yeast mating type switch
(6, 10, 32). In this system, two nuclear binding factors
have been detected, and one of the genes, RAP1, has been
cloned. The RAP1 protein may be a regulatory control element which
controls several "housekeeping genes" in yeast (20, 21),
since the purified protein binds to the regulatory regions of
MAT
, as well as the consensus motif of the RPG
box found in the ENO1 UAS and the region upstream of the
ribosomal protein genes.
Although significant insights into gene regulation and control have
been made by using S. cerevisiae as a model system, no companion studies have employed any of the members of the pathogenic dimorphic fungi. To explore the molecular regulation of genes involved
in yeast morphology and virulence, the regulatory regions of the
yps genes of H. capsulatum obtained by
subtractive hybridization, and the corresponding sequences for the
TUB1 (
-tubulin) gene, were PCR amplified as labelled
probes to identify DNA binding proteins which may influence
phase-specific gene transcription. In this study, a 30-kDa protein
found in the nuclear mycelial-phase extracts of the highly virulent
G217B strain but absent in the yeast phase and in the cytosol was
identified. The characterization of this phase-specific, DNA binding
protein represents the first report of potential regulatory factors
which may govern aspects of gene transcription in this widely
distributed pathogenic fungus.
 |
MATERIALS AND METHODS |
Organisms and culture conditions.
Cultures of H. capsulatum G217B (ATCC 26032) and the temperature-sensitive Downs
strain (ATCC 38904) were maintained in GYE liquid medium containing 2%
(wt/vol) glucose and 1% (wt/vol) yeast extract. Mycelial-phase
organisms were maintained at 25°C, and yeast- phase organisms were
cultured in GYE supplemented with 8.4 µg of cysteine/liter at 37°C.
For the analysis of proteins during the conversion from mycelial to
yeast phase, hyphal cells were induced to form yeast at 37°C in
liquid culture.
Preparation of nuclear and cytoplasmic extracts from the yeast
and mycelial phases of two H. capsulatum strains.
Protein extracts were prepared from the yeast phases of the G217B and
Downs strains of H. capsulatum by modifications to protocols previously described for S. cerevisiae (20).
Briefly, exponentially growing yeast-phase cells were pelleted,
resuspended in 50 ml of TEB buffer (100 mM Tris-HCl [pH 8.0],
containing 10 mM EDTA and 0.5%
-mercaptoethanol) and incubated on
ice for 30 min. The cells were washed in spheroplast buffer containing
20 mM sodium phosphate buffer (pH 6.5), 1 M sorbitol, and 1 mM
phenylmethylsulfonyl fluoride (PMSF). The cells, in 12 ml of
spheroplast buffer, were subsequently treated with 1 mg of Zymolyase
100T (ICN) or, in some cases, the same concentration of yeast lytic
enzyme (Sigma Chemical Company) for 60 min at 30°C. Spheroplasts were
collected by centrifugation at 900 × g for 5 min and
then lysed in breakage buffer (10 mM Tris-HCl [pH 8.0], 1.5 mM
MgCl2, 15 mM KCl, 0.1 mM EDTA, 0.5 mM dithiothreitol
[DTT], 1 mM PMSF, and 0.1 µg of pepstatin A/ml (20). The
supernatant collected prior to lysis was retained as a cytoplasmic
fraction following dialysis. Nuclei were collected from the crude
lysate at 12,000 × g for 15 min, resuspended in
approximately 30 ml of breakage buffer, and then lysed by the addition
of 7.6 ml of 4 M ammonium sulfate. After centrifugation at 100,000 × g for 1 h, the recovered supernatant was diluted and
chromatographed through a DEAE-Sephadex column containing 0.3 M KCl.
Effluent proteins were collected and precipitated by the gradual
addition of solid ammonium sulfate to 80%, collected by
centrifugation, and then dialyzed against 50 mM Tris-HCl (pH 8.0), with
0.1 mM EDTA, 0.5 mM DTT, 50 mM ammonium sulfate, 0.1 mM PMSF, 0.1 µg
of pepstatin A/ml, and 10% glycerol. The nuclear extract was aliquoted
and stored at
80°C prior to use in Southwestern blot assays.
Protein extracts from the nuclear and cytosolic compartments of
mycelial-phase organisms were prepared by a variation of this protocol.
An exponentially growing mycelial culture maintained in GYE at 25°C
(500-ml volume) was harvested by filtration. The cells were transferred
to a prechilled mortar and pestle and ground under liquid nitrogen. The
hyphal dust was then transferred to 50 ml of spheroplast buffer and
processed as described above for the yeast-phase extracts.
Preparation of target DNA probes.
Target DNA sequences were
prepared by a two-step PCR amplification of G217B or Downs genomic DNA
with 5' and 3' primers flanking the putative regulatory regions. For
the yps-3 probe, 10 pM 5' (CGTAATGTGACGGGGGAG)
and 3' (CTCTTCCATCATTCCCATC) oligonucleotides described in Fig. 1 were annealed to 50 ng of G217B genomic DNA or to 50 ng of Downs genomic DNA with 100 µM
cold deoxynucleoside triphosphates in 1× TNK buffer (10 mM Tris-HCl
[pH 8.6], 50 mM KCl2, 1.5 mM MgCl2, 5 mM
NH4Cl) and amplified in a Perkin-Elmer Cetus thermocycler
under the following conditions: (i) 94°C, 2.5 min, 1 cycle; (ii)
94°C, 1 min; (iii) 55°C, 2 min; and (iv) 72°C, 2 min. Steps ii to
iv were repeated for 30 cycles. Following amplification, the 517-bp
fragment was purified on agarose gels, and with Gene Clean (BIO 101),
and then 1/10 of the recovered product (approximately 5 to 10 ng) was
reamplified under the same conditions in the presence of 2 µCi of
[32P]dATP and 100 µM all deoxynucleoside triphosphates.

View larger version (46K):
[in this window]
[in a new window]
|
FIG. 1.
Sequences of the putative 5' regulatory regions of the
genes utilized as probes in Southwestern analysis. The flanking (5' and
3') primers used for probe amplification are indicated by dashed lines.
(A) The previously described yeast phase-specific gene,
yps-3; (B) yps 21:E-9; (C) the limited 5'
regulatory region of the -tubulin gene (TUB1). Both
yps genes are expressed in the yeast phase of the virulent
strain G217B, but they are both silent in the yeast and mycelial phases
of the attenuated Downs strain. -Tubulin is expressed in both phases
of the Downs and G217B strains, with fivefold-higher transcript levels
detected in the mycelial phase (9). The transcriptional
start sites, determined by S1 mapping of G217B poly(A)+
RNA, for each yps gene is shown (underlined), as well as the
putative translational start sites (START) for all three sequences.
|
|
A similar two-step amplification was utilized to prepare
32P-labelled DNA from the 5' regulatory region of
yps
21:E-9 from
H. capsulatum G217B, as seen in Fig.
1,
using the 5' primer (CTGAATCAATCTAA)
and the 3' primer
(CTTCAAACTTGGCTTGACGTC). In the case of the
corresponding
Downs
yps 21:E-9 region, several nucleotide changes
were
observed in the 3' primer sequence (Fig.
1), which prevented
amplification with the primers designed for the upstream regulatory
region of G217B
yps 21:E-9. As a result, the
HindIII site of p2.0SH,
a pUC18 clone containing a
2.0-kb
HindIII-
SstI insert representing
the
5' region of the
yps 21:E-9 gene and potential regulatory
sequences from the Downs strain (
1), was end labelled with
T4 DNA polymerase. Following digestion of the labelled plasmid
with
EcoRI, a 500-bp
HindIII-
EcoRI
fragment containing the 5'
regulatory regions of the Downs
yps
21:E-9 gene was isolated from
1.2% agarose gels, purified with
Gene Clean, and used as labelled
target DNA.
The probe for the 5' regulatory region of the
TUB1
(

-tubulin) gene was prepared with the primers derived by the methods
of
Harris and coworkers (
8), as indicated in Fig.
1, with 50 ng
of G217B genomic DNA as the template.
Southwestern blot analysis of DNA binding proteins from H. capsulatum protein extracts. (i) SDS-polyacrylamide gel
electrophoresis and electroblot transfer conditions.
Protein
extracts (40 µg) prepared from the yeast and mycelial phases of
H. capsulatum strains were solubilized in 12.5% glycerol, 1.25% sodium dodecyl sulfate (SDS), 178 mM
-mercaptoethanol, 0.005% bromophenol blue, and 62.5% Tris-HCl (pH 6.8) and
electrophoresed with prestained protein markers (Amersham) in
discontinuous Laemmli polyacrylamide gels with an SDS-10%
polyacrylamide separating gel (1). When required, portions
of the gel were stained with 0.01% Coomassie brilliant blue in an
aqueous solution with 50% methanol and 1% acetic acid, followed by
destaining in 50% methanol-1% acetic acid, and photographed. For
membrane preparation, the unstained portions of the gel were
transferred to 0.45-µm-pore-size nitrocellulose (Schleicher and
Schuell) by electroblotting in 25 mM Tris-HCl (pH 8.3), 192 mM glycine,
and 20% (vol/vol) methanol at 4°C in a Hoeffer Transphore apparatus
overnight at 0.3 mA. Prestained protein markers were transferred
simultaneously for molecular mass estimation in Southwestern blots.
(ii) Conditions for in situ protein-DNA interactions.
Blots
were incubated with shaking in blocking buffer (10 mM Na-HEPES [pH
7.5], 70 mM NaCl, 10 mM MgCl2, 1 mM DTT, 0.1 mM EDTA) containing 0.25% low-fat skim milk at room temperature for 2 h with 5 µg of nonspecific competitor poly(dI-dC) DNA (Sigma)/ml. Labelled target DNA (105 cpm/ml) was added to the blocking
buffer, and incubation was continued for 1 h. The blot was
processed by washing three times in 25 ml of blocking buffer lacking
skim milk, exposed to XAR X-ray film, and developed.
(iii) Localization of sequence-specific protein binding in the 5'
regulatory region of yps 21:E-9.
The 395-bp target fragment
obtained by amplification of G217B genomic DNA with the 5' and 3'
primers of yps 21:E-9 was labelled by the inclusion of 2 µCi of [32P]dATP in the PCR mixture. The amplified
fragment was digested with DdeI (Promega) as recommended by
the manufacturer, and the subfragments were resolved on 8%
polyacrylamide gels. The 109-, 150-, and 136-bp labelled fragments were
processed by electroelution and used in Southwestern blots.
(iv) Preparation and ligation of oligonucleotide probes and
conditions for competition analysis.
The 10-mer oligonucleotides
(TCCTTTTTTT and its complement, AAAAAAGGA; 20 µg of each) were heated together in 44 µl of distilled H2O to 95°C for 2 min and then allowed to cool to room
temperature to anneal the complementary oligonucleotides. The annealed
material was ligated by the addition of 5 µl of 10× ligase buffer
and 20 U of T4 DNA ligase (Boehringer Mannheim) at room temperature
overnight to concatenate the blunted double-stranded oligonucleotides.
Ligation was subsequently assessed by electrophoresis on 1.2% agarose
gels with molecular size standards (a kilobase ladder from Bio-Rad Laboratories); concatemers were 150 to 350 bp in size.
Prepared Southwestern blots were permitted to interact overnight with
10
5 cpm (approximately 0.5 µg) of
32P-labelled DNA target/ml prepared from the 5' regulatory
region
of
yps 21:E-9 (the 365-bp probe from G217B) in the
absence or
presence of increasing amounts (1×, 0.5 µg; 5×, 2.5 µg; and 25×,
12.5 µg) of the ligated DNA site probe.
Nucleotide sequence accession numbers.
Accession numbers for
the G217B yps 21:E-9 DNA and the protein and the Downs
yps 21:E-9 upstream regulatory sequence are U83168 and
U83193, respectively.
 |
RESULTS |
Identification of a 30-kDa nuclear protein from H. capsulatum G217B mycelial extracts which binds to upstream
regulatory regions of yps-3 (G217B probe).
To evaluate
protein-DNA interactions which potentially influence transcription of
yeast phase-specific genes in H. capsulatum, protein
extracts from both nuclear and cytoplasmic compartments of the yeast
and mycelial phases of G217B (class 2) and Downs (class 1) strains were
prepared, electrophoresed on duplicate SDS-8% polyacrylamide gels,
and examined by staining (Fig. 2A) and
Southwestern blot analysis (Fig. 2B), using the 5' regions of
32P-labelled yps-3 DNA amplified from the
virulent G217B strain. As seen in Fig. 2A, a broad array of proteins
with apparent molecular masses in the 21.5- to 200-kDa range were found
in all prepared extracts. Some visible differences between the staining
patterns of the nuclear and cytoplasmic extracts of the same strain
were evident in the apparent 21.5- to 40-kDa range (Fig. 2A);
differences in the patterns were also noted in the same size range when
yeast and mycelial nuclear extracts obtained from the G217B or Downs strain were compared in this one-dimensional analysis. As seen in Fig.
2B, however, a discrete DNA binding activity was identified exclusively
in mycelial phase extracts prepared from G217B; it was absent in
nuclear extracts from the yeast or mycelial phases of the hypovirulent
Downs strain. This in situ DNA binding activity with an apparent
molecular mass of 30 kDa was detected only in nuclear extracts from
mycelia of virulent strains of H. capsulatum, including
G217B (Fig. 2B) and G222B and G186B (data not shown), and it was
designated p30M. Given the constraints of the Southwestern assay on
proteins under denaturing conditions, it is likely that p30M contacts
the 5' regulatory region of yps-3 (the G217B probe) as a
monomer or multimer of a single polypeptide with a 30-kDa molecular
mass.

View larger version (46K):
[in this window]
[in a new window]
|
FIG. 2.
Southwestern blot analysis of extracts prepared from the
yeast and mycelial phases of H. capsulatum strains. (A)
Nuclear (Nucl) and cytoplasmic (Cyto) extracts (40 µg) prepared from
the yeast and mycelial phases of the Downs and G217B strains were
electrophoresed on SDS-10% polyacrylamide gels, fixed, and stained
with Coomassie brilliant blue. (B) A second gel, electrophoresed in
parallel under the same conditions, was transferred by electroblotting,
blocked, and treated with 105 cpm of the PCR-amplified
target probe (395 bp of the 5' regulatory region of yps
21:E-9 in G217B)/ml for 2 h. The blot was washed and
autoradiographed to demonstrate a protein (designated p30M) of an
apparent molecular mass of 30 kDa from the mycelial phase nuclear
extracts of G217B which interacts with the 32P-labelled DNA
target in situ.
|
|
Attenuated Downs strain of H. capsulatum is deficient
in the production of biologically active p30M protein.
The ability
of yeast- and mycelial phase nuclear extracts from the Downs and G217B
strains to interact in cross-binding reactions with target probes
prepared from the same or heterologous DNA sources was evaluated by
Southwestern analysis. As seen in Fig. 3,
a 30-kDa protein found exclusively in mycelial phase extracts of G217B
(p30M) bound to target probes prepared from homologous DNA (393-bp
G217B yps 21:E-9 and 517-bp G217B yps-3 probes)
as well as labelled probes prepared from the same upstream regions from
the Downs strain (the end-labelled 512-bp
HindIII-EcoRI probe and the 560-bp Downs
yps-3 probe). However, extracts from the Downs strain failed
to demonstrate p30M binding in assays performed with heterologous
(G217B) or homologous probes amplified from Downs genomic DNA. The
findings pointed to a p30M deficiency in the low-virulence Downs
strain, since no biologically active protein capable of the protein-DNA
target interaction was observed.

View larger version (38K):
[in this window]
[in a new window]
|
FIG. 3.
Southwestern blot analysis of p30M binding with
32P-labelled target probes from various sources. Nuclear
extract (40 µg) prepared from the yeast (Y) and mycelial (M) phases
of the G217B and Downs strains of H. capsulatum were
electrophoresed on SDS-10% polyacrylamide gels, transferred, and
allowed to interact with the indicated DNA target probes. All probes
were prepared by PCR amplification, except for the Downs yps
21:E-9 probe, which required end labelling of the 512-bp
HindIII-EcoRI fragment at the
HindIII site.
|
|
p30M DNA binding activity localizes to a 150-bp DdeI
fragment in the upstream regulatory region of yps 21:E-9.
The probes used in the previous experiment (Fig. 3) ranged in size from
395 to 560 bp and might harbor single or multiple interaction sites for
the p30M protein. To dissect the molecular relationship of this
interaction, the 32P-labelled 395-bp yps 21:E-9
upstream regulatory region probe amplified from G217B was digested with
DdeI to provide three subfragments, which were used as
probes in the Southwestern assay. As seen in Fig.
4, the 136-bp DdeI 3' primer
fragment contains the putative ATG start codon while the central 150-bp
fragment bordered by DdeI sites contains the transcriptional
start site. The nuclear p30M protein from G217B extracts reacted
exclusively with the internal 150-bp DdeI probe from the
yps 21:E-9 regulatory region.

View larger version (43K):
[in this window]
[in a new window]
|
FIG. 4.
Localization of DNA binding activity to a 150-bp
DdeI fragment in the upstream regulatory region of yps
21:E-9. Nuclear (Nucl) and cytoplasmic (Cyto) extracts (40 µg)
from the mycelial phases of G217B and Downs were evaluated by
Southwestern analysis with 32P-labelled targets derived
from the 395-bp PCR-amplified yps 21:E-9 regulatory region
from G217B. The amplified probe was digested with DdeI to
liberate labelled fragments of 109, 150, and 136 bp. As indicated in
the diagram, the 135-bp fragment contains the ATG codon while the
transcription start site mapped by S1 analysis is within the 150-bp
fragment flanked by DdeI sites. The asterisk denotes the
location of the single TCCTTTTTTT motif observed in this DNA
ligand.
|
|
Binding sites for p30M were also mapped to at least two
DdeI-generated subfragments of the 517-bp G217B
yps-3 regulatory sequence
(data not shown) and prompted a
comparison of sequences within
these regions for any consensus motifs.
The decanucleotide motif
TCCTTTTTTT (TCC motif) was found to
be conserved at 80 to 100%
homology when the
yps 21:E-9
sequence from G217B was compared
with the G217B
yps-3
sequence (Table
1). The TCC motif was
only
found once within the 150-bp
DdeI fragment of
yps
21:E-9, consistent
with the mapping results shown in Fig.
4, at 13 nucleotides downstream
from the transcriptional start site and 130 nucleotides upstream
of the ATG start codon for the gene (Fig.
1 and
Table
1). The
same motif was conserved with respect to homology (100%)
and location
(between the transcriptional start site and the ATG codon)
in
the G217B
yps-3 sequence. Additional TCC consensus motifs
were
found upstream of the transcriptional start site mapped by S1
analysis in the
yps-3 gene (Fig.
1 and Table
1). Since
similar
regions amplified from Downs genomic DNA mediated binding to
p30M,
as seen in Fig.
3, it was significant that the motif was
conserved
with respect to position and homology (80%) in the Downs
sequences
of
yps-3 and
yps 21:E-9 (Fig.
1 and
Table
1), even though the
genes are not transcribed in this strain.
p30 recognizes the TCC decanucleotide motif.
To examine the
molecular basis for the interaction between p30M protein and DNA target
sequences, the putative recognition motif, TCCTTTTTT, and
its complement were annealed and ligated to form concatemers ranging in
size from 100 to 350 bp. The excess, cold, ligated material was used as
a target to challenge the binding of the 365-bp G217B yps
21:E-9 target DNA probe in Southwestern blots with yeast- and
mycelial phase nuclear extracts prepared from G217B and Downs. As seen
in Fig. 5, only p30M from the virulent G217B mycelial phase nuclear extract bound the probe in the absence of
competitor oligonucleotides: the competition analysis with excess
unlabelled double-stranded oligonucleotide demonstrated dose-response-dependent inhibition of probe binding. Experiments with
DNA ligand prepared by individually end labelling the complementary oligonucleotides which form the putative motif and ligating the labelled reaction products demonstrated direct binding of the target to
the 30-kDa protein (data not shown), confirming that the TCC motif is
recognized by the p30M DNA binding protein.

View larger version (46K):
[in this window]
[in a new window]
|
FIG. 5.
Competition of the p30M interaction with the
32P-labelled 395-bp G217B yps 21:E-9 target by
increasing amounts of unlabelled decanucleotide. Extracts from the
mycelial (M) and yeast (Y) phases of the Downs and G217B strains were
electrophoresed, blotted, and then evaluated for DNA binding to
labelled probe in the absence and presence of the cold, ligated
oligonucleotide (oligo) probe. The cold DNA ligand represented
concatemers of the TCCTTTTTTT sequence and its complement
and were ligated to an average range of 150 to 350 bp, as assessed by
agarose gel electrophoresis.
|
|
Steady-state levels of biologically active p30M diminish during the
mycelial phase-yeast phase transition.
To examine the fate of p30M
binding to target DNA probes during the phase transition, G217B mycelia
were induced to transform into yeast by shifting the temperature of
incubation to 37°C. Nuclear extracts were isolated at various time
points during the transition, electrophoresed in 40-µg sample
aliquots, and transferred to Southwestern blots for analysis with the
G217B yps 21:E-9 probe (395 bp) and with a comparably sized
probe (335 bp) from the putative regulatory regions of TUB1
(the
-tubulin gene) (8). The single
-tubulin gene is
expressed constitutively during the temperature-induced transition,
although fivefold-higher transcript levels are observed in the mycelial
phase (9). Cultures were visually monitored for morphologic
evidence of conversion prior to extract isolation. By day 11 following
the temperature shift-up, the culture contained 90% yeast, and the
transition was complete, with 100% yeast forms, at day 13. As seen in
Fig. 6, a 30-kDa-molecular-mass protein recognizes the yeast phase-specific regulatory regions (in yps 21:E-9), as well as motifs within the amplified TUB1
gene region. Binding of steady-state levels of p30M in the nuclear
extracts to either target appears to be maximal at day 1 of the
temperature-induced phase transition, with lowered or no detectable
binding observed later in the transition (day 11; yeast phase). An
additional protein with an apparent molecular mass of 44 kDa interacted
with the TUB1 (
-tubulin gene) regulatory region, but its
role in the regulation of housekeeping gene transcription is currently
unknown.

View larger version (54K):
[in this window]
[in a new window]
|
FIG. 6.
Southwestern analysis of nuclear extracts prepared from
mycelial phase-to-yeast phase transforming cultures of G217B. Mycelial
cells of strain G217B were induced to transform to the yeast phase at
37°C, and nuclear extracts were obtained from the terminal phases as
well as 1 day, 3 days, 8 days, and 11 days following the shift-up in
temperature. Proteins were electrophoresed in duplicate on SDS-10%
polyacrylamide gels; half of the gel was stained to verify protein
loading, and the remainder was transferred and evaluated for DNA
binding. The results shown are from separate Southwestern blots with
the 335-bp regulatory region of TUB1 (the -tubulin gene)
amplified from G217B and the 5' regulatory region of yps
21:E-9 amplified from G217B.
|
|
 |
DISCUSSION |
This study describes the first DNA binding protein identified from
the pathogenic dimorphic fungus H. capsulatum as a 30-kDa nuclear protein unique to the mycelial phase of the high-virulence strain G217B which binds to the 5' regulatory regions of the yeast phase-specific genes, yps-3 and yps 21:E-9. The
p30M protein from G217B binds to 32P-labelled target
sequences amplified from genomic DNA prepared from the homologous G217B
strain or from the temperature-sensitive low-virulence strain Downs,
indicating that slight changes in a decanucleotide consensus motif fail
to completely disrupt protein-DNA interaction. The Downs strain lacks
detectable p30M protein in nuclear extracts prepared from yeast and
mycelial phases in the Southwestern bioassay, regardless of the source
of labelled target probe. The Downs strain is thus deficient in the
expression of p30M protein or biologically active p30M; lack of this
nuclear, phase-specific DNA binding protein may contribute to the
absence of yps-3 and yps 21:E-9 transcription
which is observed in this low-virulence strain.
The binding activity of p30M was localized to a 150-bp DdeI
fragment in the 5' regulatory region of yps 21:E-9. A
decanucleotide motif, TCCTTTTTTT, was found in this region
that was also observed with 80 to 100% homology at three sites within
the putative regulatory region of yps-3. The position of the
decanucleotide motif is also conserved in the genes and is localized
between the transcriptional and translational start sites, where p30M
binding may influence gene expression as a repressor or activator.
Alterations in the TCCTTTTTTT motif found in the Downs
sequence (changes at the 3rd, 6th, or 10th position) did not abolish
the ability of p30M from G217B to recognize the target DNA. Cold,
unlabelled oligonucleotide ligated to form 150- to 350-bp concatemers
competes with 32P-labelled 365-bp yps 21:E-9
target probe amplified from G217B for binding to p30M, providing
evidence that the 10-bp motif is the binding site for p30M. Moreover,
recent studies have identified a 10-bp TCA motif, strikingly similar to
the H. capsulatum TCC sequence, in the regulatory regions of
over 20 plant genes that respond to chemical, thermal, or viral stress
(5); in these cases, the motif is recognized by a 40-kDa
protein which regulates the expression of essential housekeeping genes.
In a promoter-GUS deletion analysis of the parsley PR-2 gene, a 60-bp
region incorporating the T-rich 10-bp motif was crucial for
quantitative levels of GUS expression (33).
As with other types of regulated gene expression, transcriptional
induction in response to environmental cues or stress is mediated
through cis DNA sequence elements which are recognized by
trans-acting factors. In yeast, several families of genes, including those involved in the expression of specific mating types
(27), amino acid biosynthesis (11, 12), and
galactose utilization (2, 15), each contain their own common
oligonucleotide sequences upstream of their respective coregulated
genes. Both genetic and biochemical evidence on these yeast gene sets
indicates the requirement of the oligonucleotide sequences for
controlled gene expression mediated by interactions with protein
products of other regulatory loci (10, 11, 22, 27, 28).
However, the H. capsulatum TCCTTTTTTT motif is
also found in the regulatory regions of the constitutively expressed
- and
-tubulin genes, TUB1 and TUB2 (data
not shown), and is recognized by p30M protein. It is significant to
note that a T-rich region, similar to the consensus p30M motif, is one
of the sequences found in the tripartite upstream promoter element
which is essential for expression of S. cerevisiae ribosomal
protein genes (30). In yeast, this sequence may be involved
in the expression of a variety of other genes, including those encoding
histones (3), a negative regulator of Ty-controlled gene
expression (29), and the cytoskeletal protein actin
(4).
The findings indicate that p30M is highly expressed in the mycelial
phase of H. capsulatum at 25°C and binds to yps
sequences in situ. The position of the conserved pyrimidine-rich
decanucleotide motifs between the transcriptional and translational
start sites of the yeast phase-specific genes may suggest a potential
role for the p30M protein as a transcriptional repressor
(10), acting to inhibit gene expression. The inhibition of
gene expression is not complete, however, even when p30M levels are
presumably high, as the TUB1 and TUB2
housekeeping genes, which harbor the TCC motif, continue to be
expressed at higher levels in the hyphal phase (9). It may
be that the 47-kDa protein detected in Southwestern blots with the
upstream regulatory sequence target of the
-tubulin gene (Fig. 6)
activates housekeeping gene transcription (14, 15, 22) by
directly or indirectly limiting access of p30M to target sequences in
vivo. At 37°C, or during the transition of mycelia to yeast, p30M
levels appear to decline, and lack of the putative repressor may be
sufficient for the establishment of yeast phase-specific gene
expression. In recent studies, however, a 17-kDa protein from
yeast-phase extracts of H. capsulatum G217B, termed p17Y,
has been detected with the concatenated oligonucleotide site probe in
Southwestern blots by using the assay system described in this study
(29a). Since p30M and p17Y recognize the same
pyrimidine-rich motif, levels of both proteins may be important in
regulating yeast phase-specific gene expression. Bimodal control of
yps or tubulin gene expression may involve a consortium of
repressor p30M and activators p45 and p17Y, as well as other factors
not detected by the Southwestern assay system.
The results presented in this study indicate that p30M, a
Histoplasma nuclear protein which binds to the TCC motif, is
potentially a trans-acting transcriptional factor which may
be involved in both quantitative and qualitative regulation of gene
expression during the temperature-induced, yeast-to-mycelium
conversion. It is likely that the TCC motif and p30M play a role in
regulated expression of a number of fungal genes in response to
temperature or other host signals, in concert with other elements and
factors. DNA affinity-based purification of p30M and isolation of its
gene will be essential in dissecting the nature and function of this novel DNA binding protein. For example, the addition and expression of
the gene encoding p30M by transformation systems recently described for
Histoplasma (35-37) may be sufficient to restore
yeast phase-specific gene expression in the attenuated Downs strain.
Alternatively, the catalog of physiologic (19, 23, 25, 26)
and genetic (17, 18) differences between the Downs strain
and virulent Histoplasma strains like G217B may argue that a
significant number of Downs mutations prompt it to lower virulence. As
an alternative approach circumventing the issue of multiple changes in
the Downs genome that contribute to attenuation, construction of
chimeric promoter-reporter gene fusions in transformed G217B will be
informative for exploring the mechanism(s) by which this TCC motif or
other sequence elements modulate gene expression in this dimorphic
pathogenic fungus.
 |
ACKNOWLEDGMENTS |
We thank Judith Medoff, Robert Bolla, William Picking, and others
at Saint Louis University for encouragement and discussion.
This work was supported by Public Health Service grants AI28950 and
AI37540 from the National Institutes of Health to E.J.K. F.E.A.
and H.R. were also supported by graduate teaching and research assistantships from the Department of Biology and the Graduate School
of Saint Louis University.
 |
FOOTNOTES |
*
Corresponding author. Mailing address: Department of
Biology, Saint Louis University, 3507 Laclede Ave., St. Louis, MO
63103. Phone: (314) 977-3965. Fax: (314) 977-3658. E-mail:
keath{at}slu.edu.
Editor: T. R. Kozel
 |
REFERENCES |
| 1.
|
Abidi, F. E.
1995.
Characterization of a yeast phase specific gene (yps 21:E-9) and identification of a DNA binding protein from the dimorphic pathogenic fungus, Histoplasma capsulatum. Ph.D thesis.
University of Minnesota.
|
| 2.
|
Bram, R. J.,
N. F. Lue, and R. D. Kornberg.
1986.
A GAL family of upstream activating sequences in yeast: roles in both induction and repression of transcription.
EMBO J.
5:603-608[Medline].
|
| 3.
|
Choe, J.,
D. Kolodrubetz, and M. Grunstein.
1982.
The two yeast histone H2A genes encode similar protein subtypes.
Proc. Natl. Acad. Sci. USA
79:1484-1487[Abstract/Free Full Text].
|
| 4.
|
Gallwitz, D.,
F. Perrin, and R. Seidel.
1981.
The actin gene in yeast Saccharomyces cerevisiae: 5' and 3' end mapping, flanking and putative regulatory sequences.
Nucleic Acids Res.
9:6339-6350[Abstract/Free Full Text].
|
| 5.
|
Goldsbrough, A. P.,
H. Albrecht, and R. Stratford.
1993.
Salicylic acid-inducible binding of a tobacco nuclear protein to a 10 bp sequence which is highly conserved amongst stress-inducible genes.
Plant J.
3:563-571[Medline].
|
| 6.
|
Goodbourn, S.
1990.
Negative regulation of transcriptional initiation in eukaryotes.
Biochim. Biophys. Acta
1032:53-77[Medline].
|
| 7.
|
Graybill, J. R.
1988.
Histoplasmosis and AIDS.
J. Infect. Dis.
158:632-636.
|
| 8.
|
Harris, G. S.,
E. J. Keath, and J. Z. Medoff.
1989.
Characterization of alpha and beta tubulin genes in the dimorphic fungus, Histoplasma capsulatum.
J. Gen. Microbiol.
135:1817-1832[Medline].
|
| 9.
|
Harris, G. S.,
E. J. Keath, and J. Medoff.
1989.
Expression of - and -tubulin genes during dimorphic-phase transitions of Histoplasma capsulatum.
Mol. Cell. Biol.
9:2042-2049[Abstract/Free Full Text].
|
| 10.
|
Herschbach, B. M., and A. D. Johnston.
1993.
Transcriptional repression in eukaryotes.
Annu. Rev. Cell Biol.
9:479-511.
|
| 11.
|
Hinnebush, A. G., and G. R. Fink.
1983.
Repeated DNA sequences upstream from HIS 1 also occur at several other co-regulated genes in Saccharomyces cerevisiae.
J. Biol. Chem.
258:5238-5247[Abstract/Free Full Text].
|
| 12.
|
Hinnebush, A. G.,
G. Lucchini, and G. R. Fink.
1985.
A synthetic His4 regulatory element confers general amino acid control on the cytochrome c gene (CYC1) of yeast.
Proc. Natl. Acad. Sci. USA
82:498-502[Abstract/Free Full Text].
|
| 13.
|
Hope, I. A., and K. Struhl.
1986.
Functional dissection of a eukaryotic transcriptional activator protein, GCN 4 of yeast.
Cell
46:885-894[Medline].
|
| 14.
|
Hope, I. A., and K. Struhl.
1987.
GCN 4, a eukaryotic transcriptional activator protein, binds as a dimer to target DNA.
EMBO J.
6:2781-2784[Medline].
|
| 15.
|
Johnston, M., and R. W. Davis.
1984.
Sequences that regulate the divergent GAL1-GAL10 promoter in Saccharomyces cerevisiae.
Mol. Cell. Biol.
4:1440-1448[Abstract/Free Full Text].
|
| 16.
|
Keath, E. J.
1994.
Generation of subtraction libraries for phase specific genes in the dimorphic fungus, Histoplasma capsulatum, p. 391-397.
In
B. Maresca, and G. S. Kobayashi (ed.), Molecular biology of pathogenic fungi: a laboratory manual. Telos Press, New York, N.Y.
|
| 17.
|
Keath, E. J., and F. E. Abidi.
1994.
Molecular cloning and sequence analysis of yps-3, a yeast phase specific gene in the dimorphic fungal pathogen, Histoplasma capsulatum.
Microbiology
140:759-767[Abstract/Free Full Text].
|
| 18.
|
Keath, E. J.,
A. A. Painter,
G. S. Kobayashi, and G. Medoff.
1989.
Variable expression of a yeast-phase-specific gene in Histoplasma capsulatum strains differing in thermotolerance and virulence.
Infect. Immun.
57:1384-1390[Abstract/Free Full Text].
|
| 19.
|
Lambowitz, A. M.,
G. S. Kobayashi,
A. Painter, and G. Medoff.
1983.
Possible relationship of morphogenesis in pathogen fungus, Histoplasma capsulatum, to heat shock response.
Nature
303:806-808[Medline].
|
| 20.
|
Machida, M.,
Y. Jigami, and H. Tanaka.
1982.
Purification and characterization of a nuclear factor which binds specifically to the upstream activating sequences of S. cerevisiae enolase 1 gene.
Eur. J. Biochem.
184:305-311[Medline].
|
| 21.
|
Machida, M.,
H. Uemora,
Y. Jigami, and H. Tanaka.
1988.
The protein factor which binds to the upstream regulatory sequence of S. cerevisiae ENO1 gene.
Nucleic Acids Res.
16:1407-1422[Abstract/Free Full Text].
|
| 22.
|
Maniatis, T.,
S. Goodbourn, and J. A. Fischer.
1987.
Regulation of inducible and tissue specific gene expression.
Science
236:1237-1245[Abstract/Free Full Text].
|
| 23.
|
Maresca, B., and G. S. Kobayashi.
1989.
Dimorphism in Histoplasma capsulatum: a model for the study of cell differentiation in pathogenic fungi.
Microbiol. Rev.
54:186-209.
|
| 24.
|
Maresca, B.,
A. M. Lambowitz,
B. V. Kumar,
G. A. Grant,
G. S. Kobayashi, and G. Medoff.
1981.
Role of cysteine in regulating morphogenesis and mitochondrial activity in the dimorphic fungus Histoplasma capsulatum.
Proc. Natl. Acad. Sci. USA
78:4596-4600[Abstract/Free Full Text].
|
| 25.
|
Medoff, G.,
G. S. Kobayashi,
A. Painter, and S. Travis.
1987.
Morphogenesis and pathogenicity of Histoplasma capsulatum.
Infect. Immun.
55:1355-1358[Abstract/Free Full Text].
|
| 26.
|
Medoff, G.,
B. Maresca,
A. M. Lambowitz,
G. S. Kobayashi,
A. Painter,
M. Sacco, and L. Carratu.
1986.
Correlation between pathogenicity and temperature sensitivity in different strains of Histoplasma capsulatum.
J. Clin. Invest.
78:1638-1647.
|
| 27.
|
Miller, A. M.,
V. L. MacKay, and K. A. Nasmyth.
1985.
Identification and comparison of two sequence elements that confer cell-type specific transcription in yeast.
Nature
314:598-603[Medline].
|
| 28.
|
Mitchell, P. J., and R. Tjian.
1989.
Transcriptional regulation in mammalian cells by sequence specific DNA binding proteins.
Science
245:371-378[Abstract/Free Full Text].
|
| 29.
|
Roeder, G. S.,
C. Beard,
M. Smith, and S. Keranen.
1985.
Isolation and characterization of the SPT2 gene, a negative regulator of Ty-controlled yeast gene expression.
Mol. Cell. Biol.
5:1543-1553[Abstract/Free Full Text].
|
| 29a.
| Roh, H., and E. J. Keath. Unpublished data.
|
| 30.
|
Rotenberg, M. O., and J. L. Woolford, Jr.
1986.
Tripartite upstream promoter element essential for expression of Saccharomyces cerevisiae ribosomal protein genes.
Mol. Cell. Biol.
6:674-687[Abstract/Free Full Text].
|
| 31.
|
Sacco, M.,
B. Maresca,
G. S. Kobayashi, and G. Medoff.
1981.
Temperature and cyclic nucleotide induced phase transitions of Histoplasma capsulatum.
J. Bacteriol.
146:117-120[Abstract/Free Full Text].
|
| 32.
|
Shore, D., and K. Nasmyth.
1987.
Purification and cloning of a DNA binding protein from yeast that binds to both silencer and activator elements.
Cell
51:721-732[Medline].
|
| 33.
|
Van de Locht, U.,
I. Meier,
K. Hahlbrock, and I. Somssich.
1990.
A 125 bp promoter fragment is sufficient for strong elicitor mediated gene activation in parsley.
EMBO J.
9:2945-2950[Medline].
|
| 34.
|
Wheat, L. J.
1994.
Histoplasmosis: recognition and treatment.
Clin. Infect. Dis.
19:19-27.
|
| 35.
|
Woods, J. P., and W. E. Goldman.
1992.
In vivo generation of linear plasmids with addition of telomeric sequences by H. capsulatum.
Mol. Microbiol.
6:3603-3610[Medline].
|
| 36.
|
Woods, J. P., and W. E. Goldman.
1993.
Autonomous replication of foreign DNA in Histoplasma capsulatum: role of native telomeric sequences.
J. Bacteriol.
175:636-641[Abstract/Free Full Text].
|
| 37.
|
Worsham, P. L., and W. E. Goldman.
1990.
Development of a genetic transformation system for Histoplasma capsulatum: complementation of uracil auxotrophy.
Mol. Gen. Genet.
221:358-362[Medline].
|
Infect Immun, August 1998, p. 3867-3873, Vol. 66, No. 8
0019-9567/98/$04.00+0
Copyright © 1998, American Society for Microbiology. All rights reserved.
This article has been cited by other articles:
-
Deepe, G. S. Jr., Gibbons, R. S.
(2008). TNF-{alpha} Antagonism Generates a Population of Antigen-Specific CD4+CD25+ T Cells That Inhibit Protective Immunity in Murine Histoplasmosis. J. Immunol.
180: 1088-1097
[Abstract]
[Full Text]
-
Rooney, P. J., Klein, B. S.
(2004). Sequence Elements Necessary for Transcriptional Activation of BAD1 in the Yeast Phase of Blastomyces dermatitidis. Eukaryot Cell
3: 785-794
[Abstract]
[Full Text]
-
Nosanchuk, J. D., Gomez, B. L., Youngchim, S., Diez, S., Aisen, P., Zancope-Oliveira, R. M., Restrepo, A., Casadevall, A., Hamilton, A. J.
(2002). Histoplasma capsulatum Synthesizes Melanin-Like Pigments In Vitro and during Mammalian Infection. Infect. Immun.
70: 5124-5131
[Abstract]
[Full Text]
-
Ignatov, A., Keath, E. J.
(2002). Gel Shift Assay of Nuclear Extracts from Histoplasma capsulatum Demonstrates the Presence of Several DNA Binding Proteins. Infect. Immun.
70: 2238-2241
[Abstract]
[Full Text]