TEXT

Top Abstract Text References

Eleven capsular serotypes for Staphylococcus aureus have been described (13, 23). Capsule production by this bacterium falls into two distinct categories. Types 1 and 2 capsules, exemplified by strains M and Smith, consist of a prominent polysaccharide capsule which gives rise to mucoid colony formation. Production of the mucoid capsule has been associated with increased resistance to phagocytosis and enhanced virulence (19). However, few clinical isolates of S. aureus actually produce this prominent capsule. The mucoid strains of S. aureus, as well as nonmucoid isolates, produce a second type of capsule (27). This polysaccharide capsule is not readily apparent by colony morphology or by typical capsule-staining procedures. It has, therefore, been designated a microcapsule. A serotyping scheme based on the microcapsule has been developed, and the majority of human clinical isolates, approximately 80%, fall into serotypes 5 and 8 (1). Furthermore, preliminary studies indicate that these two serotypes predominate in animal mastitis isolates (20). The chemical compositions and structures of the various serotypes of microcapsules have been elucidated (7, 16-18). The genes encoding the type 1 capsule from strain M, the type 5 microcapsule from strains Newman and Reynolds, and the type 8 microcapsule from strain Becker have been cloned, and their DNA sequences have been determined (14, 22). Antibodies directed against the microcapsule have been shown to be opsonic and to be protective, in certain animals, of infection (6, 12, 21, 25).

Synthesis of microcapsules appears to be a regulated event. It has been reported that the degree of expression of the microcapsules is dependent on the composition of the growth medium, the stage of growth, and whether the organisms are cultured on solid or liquid medium (6, 15, 21, 24, 26). Microcapsule expression has been reported to be enhanced by growth in Columbia broth or agar, and this phenomenon has been attributed to the low-phosphate nature of this medium (5, 6, 15, 21). Giving further credence to this observation is the chemical composition of the microcapsule. The microcapsule contains acidic sugars which are usually associated, in other gram-positive bacteria, with teichuronic acids. In organisms such as Bacillus subtilis, growth under conditions of limiting phosphate is associated with a shift in synthesis of cell wall-associated teichoic acid to production of the acidic sugar-containing teichuronic acid (3, 4, 11, 28). The chemical similarity between teichuronic acid and microcapsules of S. aureus, as well as the enhanced expression of the microcapsule in Columbia medium, has led to the suggestion that microcapsule synthesis may be induced by limitation of environmental phosphate. To investigate this possibility, the expression of microcapsule in a semidefined phosphate-limited growth medium was assessed by gas chromatography-mass spectrometry (GC-MS) and liquid chromatography-mass spectrometry (LC-MS).

PCR-based serotype determination. Approximately 80% of S. aureus clinical isolates belong to serotype 5 or 8. The operons encoding these microcapsules have been cloned and sequenced (22). Analysis of the sequence has indicated that 4 determinants located in the central region of each operon, capH to capK, are sequence distinct, whereas the 12 determinants which flank these 4 are essentially identical in the two serotypes. The two serotypes can thus be distinguished based upon the four-gene unique regions. PCR primers have been designed to allow exact annealing to sequences flanking the unique sequences and thus to allow amplification of the serotype-unique sequences. The primer sequences are as follows: cap585, ATACTTGGAGGAAATGACGATG; cap583, CACTCATCTAATCGACGTCCT. PCR was performed under the following conditions. Initial denaturation of the template was done at 94°C for 3 min, followed by 35 cycles of amplification including denaturation of the template at 94°C for 30 s, primer annealing at 59°C for 45 s and then at 67°C for 30 s, and chain extension at 72°C for 5 min. A final extension at 72°C for 4 min was included. The resulting PCR products were digested with the restriction endonucleases SmaI (American Allied Biochemical) and Tth111I (Promega) to determine if the organism was serotype 5 or serotype 8. Results of such amplifications with strains 8325-4 (serotype 5), Becker (serotype 8), and DAW (a 1978 methicillin-resistant clinical isolate) are illustrated in Fig. 1. The expected PCR products are DNA fragments of 4,145 bp (serotype 5) and 4,327 bp (serotype 8). Furthermore, the serotype 5 fragment has a single Tth111I site which, after digestion, yields fragments of 2,921 and 1,225 bp. The serotype 8 fragment lacks a Tth111I cleavage site. The serotype 8 fragment possesses a single SmaI site, and cleavage with this endonuclease produces fragments of 2,740 and 1,587 bp. The serotype 5 fragment lacks a SmaI cleavage site. The PCR amplifications gave the expected patterns for the type 5 (8325-4) and type 8 (Becker) strains, and the DAW clinical isolate yielded a serotype 8-specific pattern.

View larger version (96K): [in this window] [in a new window]   FIG. 1.   PCR-based serotyping of strain DAW. capH- to capK-containing DNA fragments from serotype 5 strain 8325-4 (lanes 2, 5, and 8), serotype 8 strain Becker (lanes 4, 7, and 10), and the methicillin-resistant clinical isolate DAW (lanes 3, 6, and 9) were electrophoresed in a 0.8% agarose gel. The PCR fragments were digested with the restriction endonuclease Tth111I (lanes 5 to 7) or SmaI (lanes 8 to 10) or were not treated with a restriction endonuclease (lanes 2 to 4). Lane 1 contains the Supermarker (Bioworks) DNA size standard.

Carbohydrate analysis of strain DAW. Carbohydrate analysis was carried out on S. aureus DAW cells grown in phosphate-replete (10.5 mM total phosphate) and phosphate-deficient (0.023 mM total phosphate) semidefined media (28). B. subtilis W23 cells were grown in the same media to serve as controls for environmental phosphate levels. Under phosphate-limiting conditions, this organism shifts from synthesis of a ribitol-containing teichoic acid to a teichuronic acid (11, 28). Neutral and aminosugar profiles were determined by the alditol acetate method, as described previously (8, 9). Analysis of neutral and acidic sugars by LC-MS was performed by the method of Fox et al. (11). The major sugars observed for S. aureus DAW by GC-MS analysis were anhydroribitol (derived from ribitol by dehydration on hydrolysis), ribose, fucosamine, glucose, muramic acid, and glucosamine (Fig. 2). Glucosamine and glucose were found in high concentrations. Although these sugars can be present in teichoic acid, they are also found in other cellular constituents and thus were not quantified. For example, glucosamine (along with muramic acid) is present in peptidoglycan.

View larger version (14K): [in this window] [in a new window]   FIG. 2.   Carbohydrate profiles of S. aureus determined by GC-MS. (A) Cells grown in phosphate-rich medium. (B) Cells grown in phosphate-limited medium. Note that the levels of anhydroribitol and fucosamine (markers for teichoic acid and capsule, respectively) are unchanged between the two growth conditions. Other peaks: 1, glycerol; 2, ribose plus ribitol; 3, arabinitol (internal standard); 4, glucose; 5, muramic acid; 6, methylglucamine (internal standard); 7, glucosamine.

View larger version (16K): [in this window] [in a new window]   FIG. 3.   Carbohydrate profiles of B. subtilis determined by GC-MS. (A) Cells grown in phosphate-rich medium. (B) Cells grown in phosphate-limited medium. Note that the level of anhydroribitol (marker for teichoic acid) is markedly reduced under phosphate-limited growth conditions. Other peaks: 2, ribose plus ribitol; 3, arabinitol (internal standard); 4, glucose; 5, muramic acid; 6, methylglucamine (internal standard); 7, glucosamine.