Previous Article | Next Article 
Infection and Immunity, January 1999, p. 429-432, Vol. 67, No. 1
0019-9567/99/$04.00+0
Copyright © 1999, American Society for Microbiology. All rights reserved.
Virulence Properties of Escherichia coli
83972, a Prototype Strain Associated with Asymptomatic
Bacteriuria
Richard A.
Hull,1,*
Delbert C.
Rudy,2
William H.
Donovan,3,4
Inge E.
Wieser,3
Colleen
Stewart,5 and
Rabih O.
Darouiche5,6
Department of Microbiology and Immunology, Baylor College
of Medicine,1
Division of
Urology2 and
Department of Physical
Medicine and Rehabilitation,3 University of
Texas Health Science Center,
The Institute for Rehabilitation
and Research,4 and
Department of
Physical Medicine and Rehabilitation (Spinal Cord Injury
Service)5 and
Department of Medicine
(Infectious Disease Section),6 Baylor College of
Medicine and Veterans Administration Medical Center, Houston, Texas
Received 17 July 1998/Returned for modification 20 August
1998/Accepted 15 October 1998
 |
ABSTRACT |
Little is known about bacteria associated with asymptomatic
bacteriuria (ABU) with regard to urinary tract colonization mechanisms. In this study, virulence properties of Escherichia coli
83972, a strain that was isolated from a clinical ABU episode, were
examined. The genetic potential for expression of P and type 1 pili was demonstrated, and DNA sequences related to type 1C and G (UCA) pilus
genes were also detected. However, E. coli 83972 did not express D-mannose-resistant or
D-mannose-sensitive hemagglutination after growth under
standard conditions in vitro or upon isolation from the urine of
colonized test subjects. Limited uroepithelial cell adherence was
observed in vivo, and weak D-mannose-sensitive hemagglutination was detected after extended growth in urine in vitro.
 |
TEXT |
Urine of people who have structural
or functional abnormalities of the urinary tract is likely to contain
bacteria (38). Urine colonization often occurs in the
absence of clinical symptoms and is called asymptomatic bacteriuria
(ABU). In some patient groups, treatment of ABU is often not warranted
and the benign bacteria causing asymptomatic colonization may even be
beneficial in preventing infection by more antibiotic-resistant or
virulent organisms (8-10, 22, 26-29, 34, 37, 38).
Unfortunately, the ABU-associated bacterial strain that colonizes the
bladder is self-selecting, and physicians have little knowledge of the
potential for urovirulence of the organism. Usually the strain is
allowed to persist until it, or another invading strain, produces
symptoms of urinary tract infection (UTI). The inevitable variation in
virulence among such strains may account for the disparate reports
regarding the outcomes of treatment and nontreatment of ABU. A better
understanding of the virulence potential of the ABU-associated organism
and of its potential for long-term asymptomatic bladder colonization
would reduce the uncertainty involved in treatment decisions.
Studies by Andersson et al. (1) have identified an
Escherichia coli strain capable of long-term asymptomatic
bladder colonization. These researchers used E. coli 83972 to colonize eight volunteers who had a variety of underlying illnesses.
E. coli 83972 persisted in the urine of the volunteers
between 1 and 232 days (mean, 88 days). None of the volunteers
developed fever or any other symptom of systemic illness. A recent
study by Wullt et al. (40) confirmed this observation.
We have examined the prototypic ABU-associated bacterium, E. coli 83972, with respect to genetic and phenotypic properties that
may contribute to bacterial persistence in the urinary tract. E. coli 83972 was selected for study because of its demonstrated capacity for long-term asymptomatic human bladder colonization.
Adherence genotype of E. coli 83972.
E. coli
83972, serotype O nt/K5 (nt, nontypeable), is a wild-type
ABU-associated isolate that colonized the urinary tract of a girl in
Gothenburg, Sweden, for 3 years. Colony blot and Southern blot
hybridization analyses were used to identify adherence gene sequences
in E. coli 83972 that are associated with extraintestinal colonizations (23). Specific hybridization probes used for
detection of draABC, papEFG, and pilA
to -G genes have been described elsewhere (4, 12,
30). Probes specific for focH and sfaS were
prepared by PCR amplification of recombinant-DNA-containing strains
HB101(pPIL110-54) and HB101(pANN801-13) kindly provided by J. Hacker.
The sequences of PCR primers used were 5' GACGTGGATACGACGATTACTG
3' and 5' TACGCATAGGTATAGGTGAC 3'. The probe for
ucaA was prepared by PCR amplification of Proteus mirabilis HU1069 (6). Primer sequences were 5'
CTCATAAGCGATGGTGTAATGAACTGTAGC 3' and 5'
TATGACGGTACAATTACTTTTACTGGAAA 3'. The ucaA probe was used for detection of genetically related E. coli G pilus
genes. Hybridizations were conducted at high stringency (1× SSC [1×
SSC is 0.15 M NaCl plus 0.015 M sodium citrate], 68°C). The results are shown in Table 1. DNA sequences
related to four of six adherence gene families tested, including
pap, pil, foc, and uca,
were present.
View this table:
[in this window]
[in a new window]
|
TABLE 1.
Hybridization of E. coli 83972 with probes for
adhesin genes associated with E. coli causing
extraintestinal infections
|
|
In vitro adherence phenotype of E. coli 83972.
E.
coli 83972 was tested for expression of adherence by standard
hemagglutination (HA) assays following growth in vitro. Prior to
testing, strains were grown under conditions thought to optimize expression of the specific adhesion to be tested; i.e., bacteria were
passaged on L agar plates prior to assay of P or G pilus adherence or
were passaged as 48-h static cultures of broth or urine up to 10 times
prior to the assay of type 1 pilus adherence (15). E. coli G pili are genetically related to P. mirabilis Uca
pili but are also hemagglutinins (6, 32). Bacteria were collected from agar plates or liquid cultures and suspended in buffered
saline-gelatin (BSG) (8.5 g of NaCl, 0.3 g of
KH2PO4, 0.6 g of
Na2HPO4, 10 ml of 1% gelatin, 990 ml of
distilled water [pH 7.0]) at a concentration of 109 to
1010 per ml. Thirty-microliter samples of bacteria were
mixed with 30 µl of washed erythrocytes in BSG on a chilled glass
plate. The plate was incubated over ice with occasional rocking for 10 min or until HA was observed. Bacteria were tested for HA of sheep and
human erythrocytes in the presence of D-mannose for P and G
pili or HA of guinea pig erythrocytes in the absence of
D-mannose (MSHA) for type 1 pili. The results are also
shown in Table 1. MSHA of guinea pig erythrocytes was observed after
bacteria were passaged extensively in urine. No other HA phenotype was detected.
In vivo adherence phenotype of E. coli 83972.
As
part of an ongoing human bladder colonization study, the urine of seven
male volunteers who had neurogenic bladders subsequent to spinal cord
injury, and who had a history of recurrent UTI, was deliberately
colonized with E. coli 83972. The inoculation protocol has
been described previously (1). Study participants remained
bacteriuric with E. coli 83972 as the only colonizing bacterium for extended periods (>6 months). E. coli 83972 bacteria collected from the urine of volunteers were tested directly
for adherence phenotype, and exfoliated uroepithelial cells of
colonized volunteers were observed for attached bacteria. Urine (200 to 400 ml) was collected from test subjects who had ABU with E. coli 83972 for a minimum of 1 month. An additional urine sample
collected at the same time was sent to the clinical microbiology
laboratory for culture and sensitivity. If the results from the
clinical workup indicated that E. coli 83972 was present in
a mixed culture with any other bacteria, results from that experiment
were discarded. Within 1 h of collection, urine specimens were
centrifuged at 5,000 × g to collect suspended bacteria
and uroepithelial cells. The urine was discarded, and the pellet was
resuspended in 30 ml of BSG. The suspension was centrifuged at
1,500 × g for 10 min, and the supernatant containing
bacteria was transferred to a fresh tube. The pellet containing
uroepithelial cells was resuspended in 30 ml of BSG and centrifuged
again at 1,500 × g for 10 min (first wash). The
supernatant was discarded, and the pellet was washed three more times
with BSG. Washed cells were then examined for attached bacteria in a
phase-contrast microscope.
Bacteria in the first supernatant were collected by centrifugation at
5,000 × g and resuspended in BSG at a concentration of
109 to 1010 per ml. A 10-µl sample was
removed for determination of bacterial titer and to confirm that
E. coli 83972 was the only organism present. E. coli 83972 was differentiated from other potentially contaminating
E. coli strains based upon its unique colony morphology on
MacConkey agar. A minimum of 100 colonies were visually observed for
each experiment. In addition, whole-cell DNA samples obtained from five
typical colonies were compared with E. coli 83972 DNA by
restriction fragment length polymorphism analysis. The remainder of the
sample was used for HA tests by using the method described for in vitro
HA assays. Six separate experiments typically yielded negative results
for HA phenotypes for sheep, humans, and guinea pigs. Moderate
uroepithelial cell adherence was observed (4 of 40 cells had 1 to 10 bacteria attached). These data suggest that although E. coli
83972 possesses genes associated with three different hemagglutinins,
the phenotypes associated with these agglutinins are expressed weakly
or not at all. The negative adherence phenotypes may result from
incomplete or mutant adhesin genes in E. coli 83972 or from
down-regulation of adhesin gene expression. The following experiments
were done to determine if E. coli 83972 adherence genes are
potentially functional.
Adherence characteristics of cloned adherence genes.
We have
prepared recombinant DNA cosmid clones that contain the entire genetic
region representing each of the four E. coli 83972 adhesin
gene clusters (pil, pap, uca, and
foc) (13). The recombinant molecules were
transferred to a laboratory E. coli strain that does not
itself possess any of the adherence genes tested. Clones encoding
pap, pil, or uca were then tested for function by using a standard HA assay. As shown in Table
2, the recombinant DNA strains containing
pap or pil genes expressed adherence (HA) in
vitro. The uca clone did not express G pilus adherence.
These results show that E. coli 83972 possesses functional copies of both P and type 1 pilus genes.
View this table:
[in this window]
[in a new window]
|
TABLE 2.
Hemagglutination phenotype of recombinant-DNA-containing
E. coli carrying cloned adherence genes from E. coli 83972
|
|
DNA sequence analysis of the papG allele of strain
83972.
Several reports have suggested that different alleles of
the gene encoding the P adhesin, papG, may be associated
with different clinical syndromes (14, 16). We used DNA
sequence analysis of the papG83972 allele to determine its
similarity with the pap-1 (class I), pap-2
(prs) (class III), and pap-3 (class II) families of alleles. The results presented in Fig.
1 show that papG 83972 has
97% DNA sequence homology with the pap-2 allele, and the
products exhibit 95% protein sequence homology.

View larger version (42K):
[in this window]
[in a new window]
|
FIG. 1.
DNA sequence of the papG allele of strain
83972. Differences in the sequence of papG2 (prs)
are shown below the sequence.
|
|
E. coli 83972 is a bacterial isolate that has been shown
clinically and experimentally to persist in the human bladder for
extended periods without producing overt symptoms of infection.
In
1991,
E. coli 83972 was used to evaluate the contribution of
bacterial adherence to colonization of the human urinary tract
(
1). Initial characterization suggested that
E. coli 83972
did not express P or type 1 pili in vitro and did not
adhere in
vitro to human uroepithelial cells. It was thought to contain
DNA sequences related to
pil but not
pap genes.
Moreover, the
investigators found that upon introduction into
E. coli 83972
of functional
pil or
pap
adherence gene clusters as recombinant
plasmids, the recombinant
plasmid-containing derivatives exhibited
reduced persistence in the
bladder. They concluded that persistence
of
E. coli
bacteriuria was not determined by bacterial adherence.
Results of work
presented here, and of other published studies
demonstrating reduced in
vivo colonization by
E. coli strains
that overexpress
adhesin genes (
11,
25), suggest that other
conclusions are
possible.
Upon reexamination of the genetic potential for adherence of
E. coli 83972, we found that it possesses DNA sequences related
to
four bacterial adhesins associated with extraintestinal colonization.
Genes for P and type 1 pili were expressed poorly or not at all
when
tested in the
E. coli 83972 genetic background but were
fully
functional when tested as recombinant clones in a different host.
It is possible that genetically unlinked regulatory elements that
reduce expression of these adhesins under the in vitro and in
vivo test
conditions used exist in
E. coli 83972. Several regulatory
mechanisms that may control expression of either P or type 1 pili
in
E. coli 83972 have been described (
2,
3,
7,
20,
24,
31,
33,
39). Additional studies will be needed to
identify specific
mechanisms regulating in vitro and in vivo pilus
adherence gene
expression by
E. coli 83972 and of the role of
these
regulatory systems in promoting long-term asymptomatic bladder
colonization.
The
pap-83972 genes are most related to the
pap
allele that encodes class III specificity group P adhesin. P pilus
alleles
have been divided into three groups based upon receptor
specificity
of the adhesin they encode. Class I P adhesins use the Pk
antigen
as a human tissue receptor while class III P adhesins bind to
the LKE (Luke) antigen (
17,
18). Alleles encoding class III
pili are most often associated with
E. coli from cystitis or
ABU
(
14,
16), suggesting a potential role for class III pili
in
bladder
colonization.
Type 1 pili also promote bladder colonization in animal model studies.
In a murine model of ascending UTI,
E. coli mutants
defective in synthesis of type 1 pili exhibited significantly
reduced
persistence in the bladder and agents that prevent type
1 pilus
specific attachment also reduced colonization (
5,
19,
21,
35,
36). Based upon these observations and upon the
genetic potential
of
E. coli 83972 for adhesin synthesis, it is
possible that
P pili, type 1 pili, or both are required for persistence
of
E. coli 83972 in the human bladder. We are currently preparing
mutant
derivatives of
E. coli 83972 that lack the genetic capacity
for expression of either pilus type so that the role of each in
ABU may
be determined in direct in vivo human colonization
studies.
Nucleotide sequence accession number.
The sequence of
papG of E. coli 83972 has been deposited in
GenBank under accession no. AF097355.
 |
ACKNOWLEDGMENTS |
This work was supported by a grant from the Veterans Administration
and by a grant from the Paralyzed Veterans of America Spinal Cord
Research Foundation.
 |
FOOTNOTES |
*
Corresponding author. Mailing address: Department of
Microbiology and Immunology, Baylor College of Medicine, Houston, TX 77030. Phone: (713) 798-4926. Fax: (713) 798-7375. E-mail:
rhull{at}bcm.tmc.edu.
Editor:
P. E. Orndorff
 |
REFERENCES |
| 1.
|
Andersson, P.,
I. Engberg,
G. Lidin-Janson,
K. Lincoln,
R. Hull,
S. Hull, and C. Svanborg.
1991.
Persistence of Escherichia coli bacteriuria is not determined by bacterial adherence.
Infect. Immun.
59:2915-2921[Abstract/Free Full Text].
|
| 2.
|
Båga, M.,
M. Goransson,
S. Normark, and B. E. Uhlin.
1988.
Processed mRNA with differential stability in the regulation of E. coli pilin gene expression.
Cell
52:197-206[Medline].
|
| 3.
|
Braaten, B. A.,
J. V. Platco,
M. W. van der Woude,
B. H. Simons,
F. K. de Graaf,
J. M. Calvo, and D. A. Low.
1992.
Leucine-responsive regulatory protein controls the expression of both the pap and fan pili operons in Escherichia coli.
Proc. Natl. Acad. Sci. USA
89:4250-4254[Abstract/Free Full Text].
|
| 4.
|
Buchanan, K.,
S. Falkow,
R. A. Hull, and S. I. Hull.
1985.
Frequency among Enterobacteriaceae of the DNA sequences encoding type 1 pili.
J. Bacteriol.
162:799-803[Abstract/Free Full Text].
|
| 5.
|
Connell, H.,
W. Agace,
P. Klemm,
M. Schembri,
S. Marild, and C. Svanborg.
1996.
Type 1 fimbrial expression enhances Escherichia coli virulence for the urinary tract.
Proc. Natl. Acad. Sci. USA
93:9827-9832[Abstract/Free Full Text].
|
| 6.
|
Cook, S. W.,
M. Mody,
J. Valle, and R. Hull.
1995.
Molecular cloning of Proteus mirabilis uroepithelial cell adherence (uca) genes.
Infect. Immun.
63:2082-2086[Abstract].
|
| 7.
|
Goransson, M.,
K. Forsman,
P. Nilsson, and B. E. Uhlin.
1989.
Upstream activating sequences that are shared by two divergently transcribed operons mediate cAMP-CRP regulation of pilus-adhesin in Escherichia coli.
Mol. Microbiol.
3:1557-1565[Medline].
|
| 8.
|
Hansson, S.,
D. Cougant,
U. Jodal, and C. Svanborg-Eden.
1989.
Untreated asymptomatic bacteriuria in girls: I. Stability of urinary isolates.
Br. Med. J.
298:853-855.
|
| 9.
|
Hansson, S.,
U. Jodal,
K. Lincoln, and C. Svanborg-Eden.
1989.
Untreated asymptomatic bacteriuria in girls: II. Effect of phenoxymethylpenicillin and erythromycin given for intercurrent infections.
Br. Med. J.
298:856-859.
|
| 10.
|
Hansson, S.,
U. Jodal,
L. Noren, and J. Bjure.
1989.
Untreated bacteriuria in asymptomatic girls with renal scarring.
Pediatrics
84:964-968[Abstract/Free Full Text].
|
| 11.
|
Hull, R. A.,
B. Nowicki,
A. Kaul,
R. Runyan,
C. Svanborg, and S. I. Hull.
1994.
Effect of pap copy number and receptor specificity on virulence of fimbriated Escherichia coli in a murine urinary tract colonization model.
Microb. Pathog.
17:79-86[Medline].
|
| 12.
|
Hull, S. I., and R. A. Hull.
1986.
Linkage and duplication of copies of genes encoding P fimbriae and hemolysin in the chromosome of a uropathogenic Escherichia coli isolate, p. 157-163.
In
E. H. Kass, and C. Svanborg-Eden (ed.), Host parasite interactions in urinary tract infections. The University of Chicago Press, Chicago, Ill.
|
| 13.
|
Hull, S. I., and R. A. Hull.
1995.
Molecular cloning of adherence genes.
Methods Enzymol.
253:258-269[Medline].
|
| 14.
|
Johanson, I.-M.,
K. Plos,
B.-I. Marklund, and C. Svanborg.
1993.
Pap, papG and prsG DNA sequences in Escherichia coli from the fecal flora and the urinary tract.
Microb. Pathog.
15:121-129[Medline].
|
| 15.
|
Johnson, J. R.
1991.
Virulence factors in Escherichia coli urinary tract infection.
Clin. Microbiol. Rev.
4:80-128[Abstract/Free Full Text].
|
| 16.
|
Johnson, J. R.,
T. A. Russo,
J. J. Brown, and A. Stapleton.
1998.
papG alleles of Escherichia coli strains causing first episode or recurrent acute cystitis in adult women.
J. Infect. Dis.
177:97-101[Medline].
|
| 17.
|
Källenius, G.,
R. Möllby,
S. B. Svenson,
J. Winberg,
A. Lundblad,
S. Svensson, and B. Cedergren.
1980.
The Pk antigen as receptor for the hemagglutinin of pyelonephritogenic Escherichia coli in urinary tract infections.
Lancet
ii:1369-1372.
|
| 18.
|
Karr, J. F.,
B. J. Nowicki,
L. D. Truong,
R. A. Hull,
J. J. Moulds, and S. I. Hull.
1990.
pap-2-encoded fimbriae adhere to the P blood group-related glycosphingolipid stage-specific embryonic antigen 4 in the human kidney.
Infect. Immun.
58:4055-4062[Abstract/Free Full Text].
|
| 19.
|
Keith, B. R.,
L. Maurer,
P. A. Spears, and P. F. Orndorff.
1986.
Receptor-binding function of type 1 pili effects bladder colonization by a clinical isolate of Escherichia coli.
Infect. Immun.
53:693-696[Abstract/Free Full Text].
|
| 20.
|
Klemm, P.
1986.
Two regulatory fim genes, fimB and fimE, control the phase variation of type 1 fimbriae in Escherichia coli.
EMBO J.
5:1389-1393[Medline].
|
| 21.
|
Langermann, S.,
S. Palaszynski,
M. Branhart,
G. Auguste,
J. S. Parker,
J. Burlein,
P. Barren,
S. Koenig,
S. Leath,
C. H. Jones, and S. J. Hultgren.
1997.
Prevention of mucosal Escherichia coli infection by FimH-adhesin-based systemic vaccination.
Science
276:607-611[Abstract/Free Full Text].
|
| 22.
|
Lindberg, U.,
L. A. Hanson,
U. Jodal,
K. Lincoln, and S. Olling.
1975.
Asymptomatic bacteriuria in schoolgirls: II. Differences in Escherichia coli causing asymptomatic and symptomatic bacteriuria.
Acta Paediatr. Scand.
64:432-436[Medline].
|
| 23.
|
Maas, R.
1983.
An improved colony hybridization method with significantly increased sensitivity for detection of single genes.
Plasmid
10:296-298[Medline].
|
| 24.
|
McClain, M. S.,
I. C. Blomfield,
K. J. Eberhardt, and B. I. Eisenstein.
1993.
Inversion-independent phase variation of type 1 fimbriae in Escherichia coli.
J. Bacteriol.
175:4335-4344[Abstract/Free Full Text].
|
| 25.
|
McCormick, B. A.,
P. Klemm,
K. A. Krogfelt,
R. L. Burghoff,
L. Pallesen,
D. C. Laux, and P. S. Cohen.
1993.
Escherichia coli F18 locked `on' for expression of type 1 fimbriae is a poor colonizer of the streptomycin-treated mouse large intestine.
Microb. Pathog.
14:33-43[Medline].
|
| 26.
|
Mohler, I. L.,
D. L. Cowen, and R. C. Flanigan.
1987.
Suppression and treatment of urinary tract infection in patients with an intermittently catheterized neurogenic bladder.
J. Urol.
138:336-340[Medline].
|
| 27.
|
Montgomerie, J. Z.
1992.
Treatment of urinary tract infection in patients with spinal cord injury, p. 1-13.
In
The NIDRR Consensus Validation Conference resource papers: prevention and management of urinary tract infections among people with spinal cord injuries. The National Institute on Disability and Rehabilitation Research, Washington, D.C.
|
| 28.
|
Nicolle, L. E.
1994.
Urinary tract infections in the elderly.
J. Antimicrob. Chemother.
33:99-109.
|
| 29.
|
Nicolle, L. E.,
J. Bjornson,
G. K. M. Harding, and J. A. MacDonell.
1983.
Bacteriuria in elderly institutionalized men.
N. Engl. J. Med.
309:1420-1425[Abstract].
|
| 30.
|
Nowicki, B. J.,
C. Svanborg-Eden,
R. Hull, and S. Hull.
1989.
Molecular analysis and epidemiology of the DR hemagglutinin of uropathogenic Escherichia coli.
Infect. Immun.
57:446-451[Abstract/Free Full Text].
|
| 31.
|
Orndorff, P., and S. Falkow.
1984.
Identification and characterization of a gene product that regulates type 1 piliation in Escherichia coli.
J. Bacteriol.
160:61-66[Abstract/Free Full Text].
|
| 32.
|
Rhen, M.,
P. Klemm, and T. K. Korhonen.
1986.
Identification of two new hemagglutinins of Escherichia coli, N-acetyl-D-glucosamine-specific fimbriae and a blood group M-specific agglutinin, by cloning the corresponding genes in Escherichia coli K-12.
J. Bacteriol.
168:1234-1242[Abstract/Free Full Text].
|
| 33.
|
Schwan, W. R.,
H. S. Seifert, and J. L. Duncan.
1992.
Growth conditions mediate differential transcription of fim genes involved in phase variation of type 1 pili.
J. Bacteriol.
174:2367-2375[Abstract/Free Full Text].
|
| 34.
|
Stover, S. L.,
K. Lloyd,
K. B. Waites, and A. B. Jackson.
1989.
Urinary tract infection in spinal cord injury.
Arch. Phys. Med. Rehabil.
70:47-54[Medline].
|
| 35.
|
Svanborg-Eden, C.,
R. Freter,
L. Hagberg,
R. Hull,
S. Hull,
H. Leffler, and G. Schoolnik.
1982.
Inhibition of experimental urinary tract infection by an epithelial cell-surface receptor analogue.
Nature
298:560-562[Medline].
|
| 36.
|
Svanborg-Eden, C.,
L. Hagberg,
R. Hull,
S. Hull,
B. Magnusson, and L. Ohman.
1987.
Bacterial virulence versus host resistance in the urinary tract of mice.
Infect. Immun.
55:1224-1232[Abstract/Free Full Text].
|
| 37.
|
Tencer, J.
1988.
Asymptomatic bacteriuria a long term study.
Scand. J. Urol. Nephrol.
22:31-34[Medline].
|
| 38.
|
Warren, J. W.
1994.
Catheter-associated bacteriuria in long term care facilities.
Infect. Control Hosp. Epidemiol.
15:557-562[Medline].
|
| 39.
|
White-Ziegler, C.,
L. B. Blyn,
B. Braaten, and D. A. Low.
1990.
Identification of an Escherichia coli locus involved in thermoregulation of the pap operon.
J. Bacteriol.
172:1775-1782[Abstract/Free Full Text].
|
| 40.
|
Wullt, B.,
H. Connell,
P. Rollano,
W. Mansson,
S. Colleen, and C. Svanborg.
1998.
Urodynamic factors influence the duration of Escherichia coli bacteriuria in deliberately colonized cases.
J. Urol.
159:2057-2062[Medline].
|
Infection and Immunity, January 1999, p. 429-432, Vol. 67, No. 1
0019-9567/99/$04.00+0
Copyright © 1999, American Society for Microbiology. All rights reserved.
This article has been cited by other articles:
-
Klemm, P., Hancock, V., Schembri, M. A.
(2007). Mellowing Out: Adaptation to Commensalism by Escherichia coli Asymptomatic Bacteriuria Strain 83972. Infect. Immun.
75: 3688-3695
[Full Text]
-
Roos, V., Klemm, P.
(2006). Global Gene Expression Profiling of the Asymptomatic Bacteriuria Escherichia coli Strain 83972 in the Human Urinary Tract.. Infect. Immun.
74: 3565-3575
[Abstract]
[Full Text]
-
Roos, V., Schembri, M. A., Ulett, G. C., Klemm, P.
(2006). Asymptomatic bacteriuria Escherichia coli strain 83972 carries mutations in the foc locus and is unable to express F1C fimbriae. Microbiology
152: 1799-1806
[Abstract]
[Full Text]
-
Holden, N. J., Totsika, M., Mahler, E., Roe, A. J., Catherwood, K., Lindner, K., Dobrindt, U., Gally, D. L.
(2006). Demonstration of regulatory cross-talk between P fimbriae and type 1 fimbriae in uropathogenic Escherichia coli.. Microbiology
152: 1143-1153
[Abstract]
[Full Text]
-
Roos, V., Ulett, G. C., Schembri, M. A., Klemm, P.
(2006). The Asymptomatic Bacteriuria Escherichia coli Strain 83972 Outcompetes Uropathogenic E. coli Strains in Human Urine. Infect. Immun.
74: 615-624
[Abstract]
[Full Text]
-
Klemm, P., Roos, V., Ulett, G. C., Svanborg, C., Schembri, M. A.
(2006). Molecular Characterization of the Escherichia coli Asymptomatic Bacteriuria Strain 83972: the Taming of a Pathogen. Infect. Immun.
74: 781-785
[Abstract]
[Full Text]
-
Buckles, E. L., Bahrani-Mougeot, F. K., Molina, A., Lockatell, C. V., Johnson, D. E., Drachenberg, C. B., Burland, V., Blattner, F. R., Donnenberg, M. S.
(2004). Identification and Characterization of a Novel Uropathogenic Escherichia coli-Associated Fimbrial Gene Cluster. Infect. Immun.
72: 3890-3901
[Abstract]
[Full Text]
-
Holden, N. J., Gally, D. L.
(2004). Switches, cross-talk and memory in Escherichia coli adherence. J Med Microbiol
53: 585-593
[Abstract]
[Full Text]
-
Hull, R. A., Donovan, W. H., Del Terzo, M., Stewart, C., Rogers, M., Darouiche, R. O.
(2002). Role of Type 1 Fimbria- and P Fimbria-Specific Adherence in Colonization of the Neurogenic Human Bladder by Escherichia coli. Infect. Immun.
70: 6481-6484
[Abstract]
[Full Text]
-
Manning, S. D., Zhang, L., Foxman, B., Spindler, A., Tallman, P., Marrs, C. F.
(2001). Prevalence of Known P-Fimbrial G Alleles in Escherichia coli and Identification of a New Adhesin Class. CVI
8: 637-640
[Abstract]
[Full Text]
-
Graham, J. C., Leathart, J. B. S., Keegan, S. J., Pearson, J., Bint, A., Gally, D. L.
(2001). Analysis of Escherichia coli Strains Causing Bacteriuria during Pregnancy: Selection for Strains That Do Not Express Type 1 Fimbriae. Infect. Immun.
69: 794-799
[Abstract]
[Full Text]
-
Johnson, J. R., O'Bryan, T. T., Low, D. A., Ling, G., Delavari, P., Fasching, C., Russo, T. A., Carlino, U., Stell, A. L.
(2000). Evidence of Commonality between Canine and Human Extraintestinal Pathogenic Escherichia coli Strains That Express papG Allele III. Infect. Immun.
68: 3327-3336
[Abstract]
[Full Text]