TEXT

Top Abstract Text References

Urine of people who have structural or functional abnormalities of the urinary tract is likely to contain bacteria (38). Urine colonization often occurs in the absence of clinical symptoms and is called asymptomatic bacteriuria (ABU). In some patient groups, treatment of ABU is often not warranted and the benign bacteria causing asymptomatic colonization may even be beneficial in preventing infection by more antibiotic-resistant or virulent organisms (8-10, 22, 26-29, 34, 37, 38).

Unfortunately, the ABU-associated bacterial strain that colonizes the bladder is self-selecting, and physicians have little knowledge of the potential for urovirulence of the organism. Usually the strain is allowed to persist until it, or another invading strain, produces symptoms of urinary tract infection (UTI). The inevitable variation in virulence among such strains may account for the disparate reports regarding the outcomes of treatment and nontreatment of ABU. A better understanding of the virulence potential of the ABU-associated organism and of its potential for long-term asymptomatic bladder colonization would reduce the uncertainty involved in treatment decisions.

Studies by Andersson et al. (1) have identified an Escherichia coli strain capable of long-term asymptomatic bladder colonization. These researchers used E. coli 83972 to colonize eight volunteers who had a variety of underlying illnesses. E. coli 83972 persisted in the urine of the volunteers between 1 and 232 days (mean, 88 days). None of the volunteers developed fever or any other symptom of systemic illness. A recent study by Wullt et al. (40) confirmed this observation.

We have examined the prototypic ABU-associated bacterium, E. coli 83972, with respect to genetic and phenotypic properties that may contribute to bacterial persistence in the urinary tract. E. coli 83972 was selected for study because of its demonstrated capacity for long-term asymptomatic human bladder colonization.

Adherence genotype of E. coli 83972. E. coli 83972, serotype O nt/K5 (nt, nontypeable), is a wild-type ABU-associated isolate that colonized the urinary tract of a girl in Gothenburg, Sweden, for 3 years. Colony blot and Southern blot hybridization analyses were used to identify adherence gene sequences in E. coli 83972 that are associated with extraintestinal colonizations (23). Specific hybridization probes used for detection of draABC, papEFG, and pilA to -G genes have been described elsewhere (4, 12, 30). Probes specific for focH and sfaS were prepared by PCR amplification of recombinant-DNA-containing strains HB101(pPIL110-54) and HB101(pANN801-13) kindly provided by J. Hacker. The sequences of PCR primers used were 5' GACGTGGATACGACGATTACTG 3' and 5' TACGCATAGGTATAGGTGAC 3'. The probe for ucaA was prepared by PCR amplification of Proteus mirabilis HU1069 (6). Primer sequences were 5' CTCATAAGCGATGGTGTAATGAACTGTAGC 3' and 5' TATGACGGTACAATTACTTTTACTGGAAA 3'. The ucaA probe was used for detection of genetically related E. coli G pilus genes. Hybridizations were conducted at high stringency (1× SSC [1× SSC is 0.15 M NaCl plus 0.015 M sodium citrate], 68°C). The results are shown in Table 1. DNA sequences related to four of six adherence gene families tested, including pap, pil, foc, and uca, were present.

In vitro adherence phenotype of E. coli 83972. E. coli 83972 was tested for expression of adherence by standard hemagglutination (HA) assays following growth in vitro. Prior to testing, strains were grown under conditions thought to optimize expression of the specific adhesion to be tested; i.e., bacteria were passaged on L agar plates prior to assay of P or G pilus adherence or were passaged as 48-h static cultures of broth or urine up to 10 times prior to the assay of type 1 pilus adherence (15). E. coli G pili are genetically related to P. mirabilis Uca pili but are also hemagglutinins (6, 32). Bacteria were collected from agar plates or liquid cultures and suspended in buffered saline-gelatin (BSG) (8.5 g of NaCl, 0.3 g of KH₂PO₄, 0.6 g of Na₂HPO₄, 10 ml of 1% gelatin, 990 ml of distilled water [pH 7.0]) at a concentration of 10⁹ to 10¹⁰ per ml. Thirty-microliter samples of bacteria were mixed with 30 µl of washed erythrocytes in BSG on a chilled glass plate. The plate was incubated over ice with occasional rocking for 10 min or until HA was observed. Bacteria were tested for HA of sheep and human erythrocytes in the presence of D-mannose for P and G pili or HA of guinea pig erythrocytes in the absence of D-mannose (MSHA) for type 1 pili. The results are also shown in Table 1. MSHA of guinea pig erythrocytes was observed after bacteria were passaged extensively in urine. No other HA phenotype was detected.

In vivo adherence phenotype of E. coli 83972. As part of an ongoing human bladder colonization study, the urine of seven male volunteers who had neurogenic bladders subsequent to spinal cord injury, and who had a history of recurrent UTI, was deliberately colonized with E. coli 83972. The inoculation protocol has been described previously (1). Study participants remained bacteriuric with E. coli 83972 as the only colonizing bacterium for extended periods (>6 months). E. coli 83972 bacteria collected from the urine of volunteers were tested directly for adherence phenotype, and exfoliated uroepithelial cells of colonized volunteers were observed for attached bacteria. Urine (200 to 400 ml) was collected from test subjects who had ABU with E. coli 83972 for a minimum of 1 month. An additional urine sample collected at the same time was sent to the clinical microbiology laboratory for culture and sensitivity. If the results from the clinical workup indicated that E. coli 83972 was present in a mixed culture with any other bacteria, results from that experiment were discarded. Within 1 h of collection, urine specimens were centrifuged at 5,000 × g to collect suspended bacteria and uroepithelial cells. The urine was discarded, and the pellet was resuspended in 30 ml of BSG. The suspension was centrifuged at 1,500 × g for 10 min, and the supernatant containing bacteria was transferred to a fresh tube. The pellet containing uroepithelial cells was resuspended in 30 ml of BSG and centrifuged again at 1,500 × g for 10 min (first wash). The supernatant was discarded, and the pellet was washed three more times with BSG. Washed cells were then examined for attached bacteria in a phase-contrast microscope.

Adherence characteristics of cloned adherence genes. We have prepared recombinant DNA cosmid clones that contain the entire genetic region representing each of the four E. coli 83972 adhesin gene clusters (pil, pap, uca, and foc) (13). The recombinant molecules were transferred to a laboratory E. coli strain that does not itself possess any of the adherence genes tested. Clones encoding pap, pil, or uca were then tested for function by using a standard HA assay. As shown in Table 2, the recombinant DNA strains containing pap or pil genes expressed adherence (HA) in vitro. The uca clone did not express G pilus adherence. These results show that E. coli 83972 possesses functional copies of both P and type 1 pilus genes.

DNA sequence analysis of the papG allele of strain 83972. Several reports have suggested that different alleles of the gene encoding the P adhesin, papG, may be associated with different clinical syndromes (14, 16). We used DNA sequence analysis of the papG83972 allele to determine its similarity with the pap-1 (class I), pap-2 (prs) (class III), and pap-3 (class II) families of alleles. The results presented in Fig. 1 show that papG 83972 has 97% DNA sequence homology with the pap-2 allele, and the products exhibit 95% protein sequence homology.

View larger version (42K): [in this window] [in a new window]   FIG. 1.   DNA sequence of the papG allele of strain 83972. Differences in the sequence of papG2 (prs) are shown below the sequence.

Nucleotide sequence accession number. The sequence of papG of E. coli 83972 has been deposited in GenBank under accession no. AF097355.