Previous Article | Next Article 
Infection and Immunity, October 1999, p. 5033-5040, Vol. 67, No. 10
0019-9567/99/$04.00+0
Copyright © 1999, American Society for Microbiology. All rights reserved.
Cloning and Sequencing of the Genes Downstream of the
wbf Gene Cluster of Vibrio cholerae Serogroup
O139 and Analysis of the Junction Genes in Other
Serogroups
Shanmuga
Sozhamannan,1,*
Ying Kang
Deng,1
Manrong
Li,1
Alexander
Sulakvelidze,1
James B.
Kaper,2
Judith A.
Johnson,3,4
G. Balkrish
Nair,5 and
J. Glenn
Morris Jr.1,4
Division of Hospital Epidemiology, Department
of Medicine,1 Department of Microbiology
and Immunology,2 and Department of
Pathology,3 School of Medicine, University of
Maryland at Baltimore, and Department of Veterans Affairs,
Veterans Affairs Medical Center,4 Baltimore,
Maryland 21201, and National Institute of Cholera and
Enteric Diseases, Calcutta, India5
Received 12 April 1999/Returned for modification 25 June
1999/Accepted 7 July 1999
 |
ABSTRACT |
The DNA sequence of the O-antigen biosynthesis cluster
(wbf) of a recently emergent pathogen, Vibrio
cholerae serogroup O139, has been determined. Here we report the
sequence of the genes downstream of the O139 wbfX gene and
analysis of the genes flanking the wbf gene cluster in
other serogroups. The gene downstream of wbfX, designated
rjg (right junction gene), is predicted to be not required
for O-antigen biosynthesis but appears to be a hot spot for DNA
rearrangements. Several variants of the rjg gene (three
different insertions and a deletion) have been found in other
serogroups. DNA dot blot analysis of 106 V. cholerae
strains showed the presence of the left and right junction genes,
gmhD and rjg, respectively, in all strains.
Further, these genes mapped to a single I-CeuI fragment in
all 21 strains analyzed by pulsed-field gel electrophoresis, indicating
a close linkage. The insertion sequence element IS1358,
found in both O1 and O139 wb* regions, is present in 61%
of the strains tested; interestingly, where present, it is
predominantly linked to the wb* region. These results indicated a cassette-like organization of the wb* region,
with the conserved genes (gmhD and rjg)
flanking the divergent, serogroup-specific wb* genes and
IS1358. A similar organization of the wb*
region in other serogroups raises the possibility of the emergence of new pathogens by homologous recombination via the junction genes.
 |
INTRODUCTION |
Vibrio cholerae, the
etiological agent of clinical cholera, has more than 155 serogroups
based on the heat stable somatic O-antigen types (33). Of
all of these serogroups, only O1 has traditionally been associated with
cholera (4). Although other serogroups have not been
recognized as having epidemic potential, occasional outbreaks caused by
other serogroup strains have been recorded (44). In 1992, V. cholerae belonging to serogroup O139 emerged as an
epidemic strain (1, 2, 29, 32). Molecular epidemiological
analyses such as zymovar analysis, ribotyping, and pulsed-field gel
electrophoresis (PFGE) revealed that V. cholerae O139 Bengal
strains are virtually identical to Asian seventh-pandemic O1 El Tor
strains (5, 28). Furthermore, V. cholerae O139 strains had all of the standard virulence factors of O1 El Tor. Clinically, V. cholerae O1 and O139 Bengal cause cholera of
comparable severity in infected persons (6, 27). However, in
striking contrast to O1 strains, O139 strains are encapsulated
(20). The V. cholerae O139 serogroup antigen
includes an O-antigen capsule and lipopolysaccharide (LPS) (41,
45). The LPS of serogroup O139 does not contain any long
O-antigen side chain, whereas O1 strains have a core substituted with
an average of 17 repeat units of 4-NH2-4,6-dideoxymannose,
each substituted with 3-deoxy-L-glycero-tetronic acid
(23). The O139 LPS appears to be an efficiently substituted core polysaccharide (CPS), albeit with only one or two additional sugar
moieties (45). These changes have rendered the O139 organism immunologically distinct from the O1 El Tor strains, as evidenced by
the susceptibility of the individuals preexposed to O1 strains. In
cholera-endemic areas such as Bangladesh and India, cholera is most
common among children (16). In contrast, the majority of
O139 infections occurred in adults when O139 first emerged (11,
19).
The major genetic differences accounting for the phenotypically
distinct surface polysaccharide of O1 El Tor and O139 Bengal have been
determined. The genes responsible for the synthesis of O antigen are
present in a cluster designated wb* (rfb) region. It was shown that a large portion of DNA corresponding to the wbe (rfb) region of O1 strains is missing in O139
strains and that O139 has acquired a unique DNA region (7, 8,
42). Specifically, it was demonstrated that the serogroup O139
resulted from a 22-kb deletion of the wbe (rfb)
region of O1 and replacement with a 35-kb wbf region
encoding the O139 O-antigen (12). Several groups
collectively sequenced the O139-specific wbf
(rfb) region. The 14.363-kb sequence of the left part of the
wbf region, gmhD to gmd' (originally
designated otn), was reported by Bik et al. (8),
the 12.938-kb right part of the wbf region, wbfQ
to wbfX, was reported by Comstock et al. (12),
and the intermediate region was reported by Stroeher et al.
(38). The complete DNA sequence of the O1 wbe
region was previously determined by Stroeher et al. (35).
The sequenced wb* regions of V. cholerae O1 and
O139 and the V. anguillarum serogroups O1 and O2 all have
the gmhD gene at the left junction (8, 40). The
sequenced right junction of the O1 wbe cluster has a 30-bp
overlap with that of the O139 wbf right junction
(14). The intervening regions are divergent in the two
serogroups except for the presence of an insertion sequence (IS)
element, IS1358. The genes downstream of the right junction
were not sequenced, and it was assumed that they were not involved in
O-antigen biosynthesis. Favre et al. showed that the cloned O139 DNA
can express O139-specific antigens in Escherichia coli,
although characterization of the cloned DNAs, with respect to the size
of the insert and the genes present, was not reported (15).
We were interested in determining the role of the genes downstream of
wbfX in LPS/capsular polysaccharide (CPS) biosynthesis and
whether non-O1/non-O139 serogroups are similar with respect to genetic
organization of the wb* region. The broad objectives of this
study were to decipher the mechanism underlying the origin of O139 and
to explore the possibility of the future emergence of other pathogenic
V. cholerae strains by a similar mechanism. Two hypotheses
have been proposed to explain the emergence of V. cholerae
O139. The first hypothesis proposes that a transposition event mediated
by the IS element IS1358 resulted in the replacement of the
O1 wbe genes with the O139 wbf genes (26,
37-39). The second hypothesis involves a homologous
recombination event resulting in the replacement of the O1
wbe region en masse by the O139 wbf region
(12, 26, 40). Here, we present the sequence of the genes
downstream of wbfX and the analysis of the genes flanking the O-antigen region (gmhD and rjg) in other
serogroups. We show that all the serogroups we analyzed have an
organization of the wb* region that is similar to that of O1
and O139 strains. This result favors the latter hypothesis and raises
the possibility that pathogenic strains belonging to non-O1/non-O139
serogroups can emerge by homologous recombination via the junction genes.
 |
MATERIALS AND METHODS |
Bacterial strains, plasmids, media, and growth conditions.
The various bacterial strains, plasmids, and primers used in this study
are listed in Table 1. Growth of
bacterial cultures was done following standard laboratory practices.
Cultures were grown in Luria-Bertani broth (LB; pH 6.5) at 37°C, and
frozen stocks were maintained at
70°C in LB containing 50%
glycerol. For short-term storage, strains were maintained on LB plates
at room temperature. Antibiotics were used at the following
concentrations: ampicillin, 100 µg/ml; chloramphenicol, 25 µg/ml;
tetracycline, 12.5 µg/ml; rifampin, 100 µg/ml; streptomycin, 100 µg/ml; and gentamicin, 5 µg/ml. Nucleic acid manipulations were
carried out by standard molecular biological methods (22).
Plasmid DNA purification was done by using a QIAprep Spin Miniprep kit
(Qiagen, Inc.). DNA fragment purification was done with a Gene Clean
Spin kit (Bio 101, Inc.).
Sequence of the genes downstream of wbfX.
The DNA
sequence of the genes downstream of wbfX was obtained from a
subclone of pLC40, which is a cosmid clone and has a 21.5-kb
EcoRI insert of the V. cholerae O139
wbf region (12). pLC40 DNA was digested with
SstI, a 7.8-kb fragment was gel purified and redigested with
KpnI, and the resulting two fragments were cloned into
pBluescript SK(
). The clone with the larger fragment (5 kb) was
sequenced. DNA analysis was carried out with the DNASIS (Hitachi
Software Corporation) program, and protein homology search was done
using the National Center for Biotechnology Information BLAST server
program (3).
Dot blot analysis.
Distribution of the gmhD,
IS1358, and rjg genes in various V. cholerae strains was analyzed in dot blots. Minichromosomal DNA
preparations were made from various strains by using a Wizard genomic
DNA purification kit (Promega Corporation). Approximately 1 to 2 µg
of DNA was blotted onto a Zeta-Probe membrane by using a dot blot
apparatus (Bio-Rad Laboratories). The blot was hybridized with
nonradioactive probes prepared by an enhanced chemiluminescence using
the ECL labeling kit (Amersham Inc.). All probes were prepared by PCR
amplification of the genes, using the specific primers listed in Table
1.
PFGE.
PFGE was carried out by using published protocols
(25). Agarose plugs were prepared with the bacterial cells
and then treated with lysis buffer followed by protease treatment and
restriction endonuclease digestion overnight with I-CeuI at
37°C. The digested plugs were then run on a 1% agarose gel in the
CHEF DRII system (Bio-Rad Laboratories) at 14°C in 0.5×
Tris-borate-EDTA. The following electrophoretic conditions were used:
block 1, 6 V/cm2 for 12 h with 15- and 30-s (initial
and final switch times) pulses; block 2, 6 V/cm2 for
18 h with 13"-13" pulses.
Construction of a marked IS1358 element and in vivo
transposition assay.
IS1358 was PCR amplified from the
O139 chromosomal DNA and cloned into pCR2.1 vector. In the next step, a
deletion of the NdeI fragment within the IS element was
created and a Tetr fragment from pBR322
(AvaI-EcoRI) was introduced in the tnp
gene of IS1358. This inactivated the transposase gene. The
IS1358::Tetr was subcloned into a
pSC101 replicon (KpnI-NotI fragment of pCR2.1 IS::Tetr cloned into pWSK29
[43]). The tnp gene was amplified from the O139 chromosome by appropriate primers (Table 1) and cloned into the
expression vector pQE70. In this vector, the transposase is expressed
from the ptac promoter, and a compatible
replicon pREP-4 (Kanr), provides the lac
repressor. Transposase gene expression was induced by the addition of 1 mM isopropyl-
-D-thiogalactoside (IPTG). The donor strain
carried four plasmids: pSC101 IS::Tetr,
pQE70::tnp, pREP4 (lacIq),
and an F' derivative (pOX38-Genr). The recipient strain was
marked with Rifr (DH5
lac) or
Strr (NLC51). A mating-out assay, in which donor and
recipient cells were mixed and mated for 3 h and plated on
selective plates, was used to measure the transposition of
IS1358. The transfer of pOX38-Genr was measured
as Genr Rifr or Genr
Strr colonies, and transposition was measured as the
frequency of Tetr colonies among the Genr exconjugants.
Nucleotide sequence.
The sequence of the 4-kb DNA downstream
of wbfX is available as GenBank accession no. AF090685, and
the sequence of ISalg is available as GenBank accession no.
AF133213.
 |
RESULTS |
DNA sequence of the genes downstream of wbfX of
V. cholerae O139.
It was shown previously that the
O139 wbf region is about 35 kb in length and that at the
molecular level, O139 probably arose by the replacement of a 22-kb
wbe region of the serogroup O1 biotype El Tor strain. The
entire sequences of the O1 and O139 wb* regions have been
determined (8, 12, 35, 38). The sequenced O1 and O139
wb* regions contained only a 30-bp overlap at the right junction. The genes downstream of wbfX were not known, and
it was presumed that wbfX is the last gene of the
wbf cluster. In an effort to understand the mechanism of
acquisition of this unique O139 wbf region, i.e., the
presence of IS elements or phage attachment sites, we extended the
sequence 4 kb further downstream of the wbfX gene, into the
region shared by O1 and O139. For convenience, we have compiled all
published sequences with the new sequence and refer to the various
sites with a new numbering system. According to this numbering system,
the entire sequence is 41,221 bp in length. The O139-specific DNA
(35,807 bp) begins at position 1127, at the start of gmhD,
and it ends at position 36934, after wbfX.
Resequencing of the wbfX and wbfY region (open
reading frames [ORFs] formerly designated orf10 and
orf11 [12]) revealed an additional 233-bp
SstI fragment at the SstI site at position 11459 (35525 in the new numbering) in wbfX. This additional
sequence creates a new single ORF, wbfX, combining the
former wbfX and wbfY. The presence of the
SstI fragment was confirmed by PCR (11a). This
ORF has extensive homology to the epimerase/dehydratase found in
Pseudomonas aeruginosa and other bacterial species
(reference 10 and Table
2). Figure
1A shows the revised map of the ORFs of
the O139 wbf region.

View larger version (41K):
[in this window]
[in a new window]
|
FIG. 1.
(A) Revised ORF map of the V. cholerae O139
wbf region. The solid arrows at the top (rjg,
ybdG, and ycdW) and bottom (gmhD and
orf2) represent genes common to all serogroups. The entire
region is 41,221 bp in length, and the wbf region
(wbfA through wbfX) is 35,807 bp in length
starting from wbfA to wbfX. The map is not drawn
to scale. (B) DNA dot blot analysis of various serogroups of V. cholerae for the distribution of the three genes (gmhD,
IS1358, and rjg) common to serogroups O1 and
O139. The bars in panel A indicate positions of the hybridization
probes. The intensities of some of the hybridization spots in the
gmhD panel are weak, and these strains were reprobed
separately to show that they carry gmhD. All strains tested
were found to contain gmhD and rjg; only 61% of
the strains had IS1358.
|
|
The DNA downstream of
wbfX has been shown in hybridization
experiments to be present in both O1 and O139 strains (
12).
The
overall G+C content of the newly sequenced region downstream of
wbfX is about 49%, which is the chromosomal average for
V. cholerae (
21). This is greater than the
average G+C content of the
wbf region, which is 42%,
indicating that the downstream DNA is not
part of the
wbf
region. In the DNA shared by O1 and O139 serogroups,
three ORFs were
identified. Immediately downstream of
wbfX we
have
identified a gene, designated
rjg (right junction gene),
the
putative product of which has considerable homology to proteins
in
other bacterial species (Table
2). Interestingly, these proteins
have a
highly conserved VDALILTHAHIDH motif whose significance
is unknown. The
rjg product is predicted to be an mRNA 3'-end
processing
factor. Several variants of the
rjg gene that contain
IS
elements and an internal deletion have been found (see below).
These
rjg mutants presumably are inactive due to IS insertion
and
deletion, thus indicating the nonessential nature of this
gene.
Downstream of
rjg and transcribed in the opposite
orientation
is an ORF whose product has homology to the product of a
gene
designated
ybdG in the
pheP-nfnB intergenic
region of
E. coli K-12. The next ORF, for which only a
partial sequence was obtained,
encodes a product that has homology to
putative dehydrogenases
from various sources (Table
2). There is a
51-bp almost perfect
(50/51) direct repeat separating a 978-bp region
(TTGGTGTGAAATACCCCCTCCCG
TCCTCCCCCTAGAAGGGGGAGGGGTAAG
[variant base is underlined]) at the end of
rjg. The
O1-O139 homology
begins 17 bp into the
rjg gene. Hence, the
predicted N-terminal
amino acid sequences of the
rjg product
are different in the O1
and O139 serogroups (Fig.
2).

View larger version (44K):
[in this window]
[in a new window]
|
FIG. 2.
DNA sequence of the rjg gene (1,341 bp). The
first 17 bp (in lowercase) are different in O1 and O139 strains. The
highly conserved VDALILTHAHI motif in
rjg is indicated in boldface. The insertion sites of
IS1358 (at bp 90) in Smith serogroup O48, ISO22
(at bp 469) in O22, and ISalg (at bp 933) in O103 are
indicated by filled arrowheads. Deletions of 13 and 539 bp in Smith
serogroup O110 are underlined; an 18-bp deletion found in an O22 strain
is indicated in boldface.
|
|
Genes flanking the wbf region of O139 are conserved in
other serogroups.
We were interested in determining whether
non-O1/non-O139 V. cholerae strains have a cassette with a
genetic organization similar to that of the O1/O139 wb*
cluster, i.e., where gmhD and rjg genes flank the
wb* genes and IS1358. As a first step toward this
goal, we looked for the presence of gmhD, IS1358,
and rjg in other serogroups. Clinical and environmental
isolates belonging to various serogroups (67 Shimada serogroup strains
consisting of 24 O1/O139 and 43 non-O1/non-O139 strains and 39 Smith
serogroup strains) were examined by dot blot analysis (Fig. 1B). All
strains had gmhD and rjg, and IS1358
was present in 61% of the strains. The intensity of the hybridization
spots for gmhD and IS1358 varied in many strains,
reflecting either sequence variations or the presence of more than one
copy of the IS element. Consistent with this observation,
gmhD could not be amplified from all the strains by using
common PCR primers, most probably due to sequence variation (data not
shown). orf2, a gene downstream of gmhD and
rjg, could be amplified from all of the V. cholerae strains examined and showed uniform intensities in all
strains, indicating a high degree of conservation.
gmhD, IS1358, and rjg are
located in the same I-CeuI fragment.
We concluded from
the above results that gmhD and rjg genes are
present in all of the V. cholerae strains examined. This
result does not indicate whether they are closely linked as in the case of O1/O139 strains. We performed PFGE and hybridization analysis to
determine whether these genes map in the same fragment in
non-O1/non-O139 strains as they do in O1 and O139 strains. Chromosomal
DNAs were digested with the rarely cutting I-CeuI enzyme and
hybridized with gmhD and rjg probes. In all 21 strains examined, a single I-CeuI fragment hybridized with
the two probes (Fig. 3). The size of the
I-CeuI fragments varied from 150 to 250 kb.
IS1358 was present in 15 strains, and in 14 of these strains
it was located on the same fragment as gmhD and
rjg. The ISalg probe (see below) hybridized to
different fragments (data not shown). These results indicated that
gmhD and rjg genes are conserved in all the
strains and are probably arranged similarly flanking the O-antigen gene cluster.

View larger version (82K):
[in this window]
[in a new window]
|
FIG. 3.
PFGE of I-CeuI-digested chromosomal DNAs of
various V. cholerae strains. Lanes: S, ladder; 1, Vibrio vulnificus (V. vu); 2, V. cholerae serogroup O1 (classical 395); 3, O1 (El Tor E7946); 4, O1
(El Tor C6706); 5, O1 (El Tor N16961); 6, O5 (CO545); 7, O8 (CO845); 8, O10 (AS12/1); 9, O11 (CO639); 10, O11 (AM124); 11, O37 (S21); 12, O37
(Y276); 13, O39 (AM25); 14, O108 (CO603B); 15, O139 (AI1837); 16, O139
(Arg-3); 17, O144 (AM107); 18, O190 (AS67); 19 to 21, O-antigen untyped
(OUT) (AS416, CO668, and AS119, respectively; 22, E. coli
DH5 lac; 23, O9 (AM2). The bands that hybridized with the
gmhD and rjg probes are indicated by asterisks.
The IS1358 probe also hybridized to the same fragment in
strains where present except in an O10 strain where a different
fragment had IS1358 (indicated by a dot in lane 8).
|
|
Identification of novel IS elements in the rjg gene of
non-O1/non-O139 V. cholerae strains.
To confirm the
hybridization data, we analyzed the presence of the rjg gene
in a subset of 24 V. cholerae strains of various serogroups
by using PCR. One strain, belonging to the O103 serogroup, exhibited a
PCR product longer than the rest. Cloning and sequencing of this PCR
product identified the presence of an IS element, designated
ISalg, in the rjg gene of this strain. This
element showed extensive homology (86% at the DNA level) to an IS
element found in Vibrio alginolyticus which was shown
earlier to be homologous to IS911 of Shigella
dysenteriae (17). ISalg has a 22-bp
imperfect (16/22) inverted repeat at its ends with no obvious target
duplication at the site of insertion in the rjg gene. We
examined the presence of this element in other serogroups by DNA dot
blot analysis. This analysis showed that it is distributed in 69% (56 of 81) of the strains tested (data not shown). We examined whether
ISalg is present in the same locus in all of these strains
by PCR amplification of the rjg locus. It appeared that only
in an O103 strain was ISalg inserted in rjg.
During this analysis, we found three PCR products that differed in size
from the rest. Sequencing of these PCR products indicated the presence
of two other IS elements as well as a deletion in the rjg
gene in three different serogroups (Fig.
4). In serogroup O22 there was an IS
element designated ISO22 (48); it was distributed
in 6% (5 of 81) of the V. cholerae strains tested (data not
shown). In a Smith serogroup O48 strain, a copy of IS1358
(37) was present. In a Smith serogroup O110 strain, the
rjg gene had a large internal deletion. The DNA sequence of
the rjg ORF and the various insertion sites and the deletion endpoints in O110 strain are shown in Fig. 2. These results suggested that rjg is not an essential gene for cell viability and
that rjg is a hot spot for genetic rearrangements.

View larger version (52K):
[in this window]
[in a new window]
|
FIG. 4.
PCR analysis of the rjg gene in various
serogroups. The rjg genes from strains of various serogroups
were amplified by using rjg primers. The PCR products from
O1 and O139 strains were of the same size (about 1.3 kb). In three
other strains (O22, O103, and O48) there is an insertion, as seen by
the increase in the size of the amplified product. The PCR product from
the O110 strain is shorter, which indicated an internal deletion. The
asterisks in O110 and O48 are shown to indicate that they belong to O
serogroups based on the Smith typing system (34). Lane S,
1-kb ladder.
|
|
IS1358 present in V. cholerae O139 strain
appears to be an inactive element in E. coli.
The majority
(61%) of the V. cholerae strains analyzed contained
IS1358 most likely in the wb* region. It was
recently proposed that there are two copies of IS1358 in the
O139 wbf region, thus giving this region the structure of a
compound transposon and that at least this part of the O139
wbf cluster was transferred by an IS1358-based
compound transposon (37, 38). One of the prerequisites of
this hypothesis is the ability of IS1358 to transpose. The
observation that the IS1358 present in the O139
wbf region has an apparently intact transposase ORF
(37) suggested that it might be an active element. We were
interested in characterizing the transposition mechanism exhibited by
IS1358 in order to understand the origin of the O139
wbf region. We constructed a derivative of IS1358
containing a Tetr marker and an inducible source of the
transposase (see Materials and Methods). Using a conventional
mating-out assay and F' derivative pOX38-Genr as a target
for transposition, we measured the transposition of
IS1358::Tetr onto pOX38. The frequency
of pOX38 transfer ranged from 30 to 100%, and that of Tetr
colonies among the pOX38 exconjugants was less than 10
7
to 10
8, which was the background level (i.e., the
frequency observed in the absence of transposase expression). On
further analysis, these Tetr colonies were found to be the
donor mutants that acquired the counterselection resistance marker.
Hence, we could not detect any true transposition of IS1358.
The same tnp gene fragment in a T7 vector overexpressed the
transposase protein, as seen in sodium dodecyl sulfate-polyacrylamide
gels (data not shown). We conclude from these experiments that the
IS1358 is defective for transposition in E. coli
and presumably in V. cholerae as well. The requirement for
specific V. cholerae factors for transposition of this
element or the possibility that any cis element of
IS1358 necessary for transposition may have been inactivated
due to the insertion of Tetr marker cannot be ruled out at
this time. However, these results are consistent with a recent study
showing that IS1358 by itself is transposition defective
(cointegrate formation), although a composite transposon with two
IS1358 copies is capable of direct transposition
(13).
 |
DISCUSSION |
In this work we have defined the right junction of the
wb* gene cluster involved in the synthesis of O antigen. The
gene at the left junction of the wb* cluster,
gmhD, has been previously shown to be essential since
inactivation of this gene was lethal (36). Several lines of
evidence indicates that the right junction gene, rjg, is not
essential for cell viability or for LPS/CPS synthesis in V. cholerae. Four variants of the rjg gene have been found
that contain IS elements and an internal deletion. These rjg
mutants are presumably inactive, thus indicating the nonessential nature of this gene. The G+C content of the rjg gene (53%)
is well above the average G+C content of the wbf region
(42%), which indicates that it is not part of the wbf
region. Generally, it is known that the G+C content of the
wb* regions is less than that of the chromosomal average
(30). Based on sequence analysis, rjg does not
resemble any polysaccharide biosynthesis gene but rather seems to be an
mRNA 3'-end processing factor. Clones lacking the genes downstream of
wbfX produce essentially the same LPS/CPS structures in
E. coli (47). From these results, we conclude that the gmhD and rjg genes form the left and
right boundaries, respectively, of the O-antigen gene cluster. Analysis
of rjg in various serogroups suggests that it is a hot spot
for DNA rearrangements, since we have found three independent IS
elements and a deletion allele in this gene in a set of 81 strains. On
the other hand, the left junction genes gmhD and
orf2 are intact. Hence, rjg seems to function as
an anchor region for a variety of DNA transfer events, most likely in
creating diversity in the wb* region.
The emergence of V. cholerae serogroup O139 as an epidemic
strain represents the first known example of horizontal transfer of a
polysaccharide biosynthetic gene cluster in V. cholerae. Based on sequence analysis, three serogroups (O1, O22, and O139) appear
to have similar cassette-like organization of the wb*
cluster. Earlier it was shown that yet another pathogenic strain
(serogroup O37), which caused a local outbreak of cholera in Sudan in
1962, has a very similar genetic organization of wb* genes
(9). Data presented here suggest that many strains of
V. cholerae serogroups may possess a similar organization.
The O-antigen cluster resembles pathogenicity islands (PAIs) in many
respects; such a proposal has been advanced previously (24).
They both have a specific location on the chromosome. The
wb* cluster is located between gmhD
(rfaD) and rjg. The wb* genes have
varying G+C content, suggesting a horizontal transfer, although a
regulatory mechanism based on codon usage cannot be excluded. Like
PAIs, wb* gene clusters also have IS elements, which
suggests genetic rearrangements and horizontal transfer. The presence
or absence of pathogenicity islands determines the virulent or
avirulent nature of the organism. V. cholerae strains without a "wb* island" have not yet been found. However,
the wb* cluster makes a major contribution to virulence
since mutations in this region results in attenuation of virulence in
animal models (18). The different O-antigen clusters seem to
provide serogroup specificity and a mechanism to evade host immune
detection. For example, the majority of O139 infections occurred in
adults, who were presumably immune to O1 when O139 first emerged. As
the epidemic continued, the majority of the cases shifted back to
persons <15 years of age as people became immune (11, 19).
The absence of phage att-like sites in the O139
wbf cluster suggests that the mechanism and the mode of
horizontal transfer may be different from that of PAIs, which are
thought to be transferred as phages. Two mechanisms have been proposed
for the acquisition of O-antigen clusters: IS-mediated transposition
(26, 38, 39) and homologous recombination (11, 26,
38). It has been proposed that two copies of IS1358
are present in the O139 wbf region (a degenerate copy just
upstream of IS1358) and that this region was transferred as
a transposable element (38). However, we find no evidence of
a compound transposon or transposition of IS1358 in an
E. coli background. Recently, a composite transposon with
two copies of IS1358 has been shown to transpose, although the individual IS element has not been shown to transpose successfully (13). A preponderance of evidence suggests that the latter
mechanism most likely is operative in the transfer of large DNA
segments, although the vector for such a transfer is unknown. It could
be a generalized transducing phage or a conjugative plasmid
(26). Since the genes flanking the wb* region in
O1/O139 strains are conserved in all of the strains that we analyzed,
we conclude that O139 arose from an O1 El Tor strain by a double
homologous recombination event with DNA from a nonpathogenic donor that
had the O139 wbf cluster. The IS elements probably are
involved in local genetic rearrangements by transposing small gene
segments. It is also probable that IS elements provide portable regions of homology within nonhomologous regions, in order to facilitate genetic rearrangements (26). Such an event has been shown in the case of the wba genes of Salmonella enterica
(46). The preferential linkage of IS1358 to the
wb* region in the majority of the V. cholerae
strains that we analyzed further supports the idea that IS1358 was acquired by homologous recombination rather than
by transposition. A random transposition event is expected to deliver the IS element to any part of the chromosome. A major hurdle to any
horizontal transfer mechanism is that the transferred DNA has to
overcome barriers such as restriction and recombination in order to be
established in the recipient strain. Whatever the mechanism may be,
horizontal transfer of the wb* cluster led to the emergence
of a new pathogen from an already existing pathogen in a single step by
evading the host immune system. Our future studies will focus on these
mechanisms and the barriers to horizontal gene transfer in V. cholerae.
 |
ACKNOWLEDGMENTS |
We thank Nick Ambulos and Lisa Sadzewicz (UMAB Biopolymer
Laboratory) for automated sequencing. We thank De Qi Xu and Laurie Comstock for sharing unpublished data and Nancy L. Craig and Joseph Eric Peeters (Johns Hopkins University) for providing the E. coli strains used in the transposition assays. We thank Arnold
Kreger and Rick Blank for comments on the manuscript. V. cholerae AI1837 was kindly provided by M. John Albert
(International Center for Diarrheal Disease Research, Bangladesh).
This work was supported by PHS grants AI135729 to J.A.J., AI19716 to
J.B.K., and AI28856 to J.G.M. and by a VA/DOD grant on emerging
infectious diseases to J.G.M.
 |
FOOTNOTES |
*
Corresponding author. Mailing address: Division of
Hospital Epidemiology, Department of Medicine, University of Maryland
School of Medicine, 934-MSTF, 10 S. Pine St., Baltimore, MD 21201. Phone: (410) 706-5157. Fax: (410) 706-4581. E-mail:
ssozhama{at}medicine.umaryland.edu.
Editor:
D. L. Burns
 |
REFERENCES |
| 1.
|
Albert, M. J.,
A. K. Siddique,
M. S. Islam,
A. S. G. Faruque,
M. Ansaruzzaman,
S. M. Faruque, and R. B. Sack.
1993.
Large outbreak of clinical cholera due to Vibrio cholerae non-O1 in Bangladesh.
Lancet
341:704[Medline].
|
| 2.
|
Albert, M. J.,
M. Ansaruzzaman,
P. K. Bardhan,
A. S. G. Faruque,
S. M. Faruque,
M. S. Islam,
D. Mahalanabis,
R. B. Sack,
M. A. Salam,
A. K. Siddique,
M. D. Yunus, and K. Zaman.
1993.
Large epidemic of cholera-like disease in Bangladesh caused by Vibrio cholerae O139 synonym Bengal.
Lancet
342:387-390[Medline].
|
| 3.
|
Altschul, S. F.,
T. L. Madden,
A. A. Schaffer,
J. Zhang,
Z. Zhang,
W. Miller, and D. J. Lipman.
1997.
Gapped BLAST and PSI-BLAST: a new generation of protein database search programs.
Nucleic Acids Res.
25:3389-3402[Abstract/Free Full Text].
|
| 4.
|
Barua, D.
1992.
History of cholera, p. 1-36.
In
D. Barua, and W. B. Greenough III (ed.), Cholera. Plenum Publishing Corp., New York, N.Y.
|
| 5.
|
Berche, P.,
C. Poyart,
E. Abachin,
H. Lelievre,
J. Vandepitte,
A. Dodin, and J.-M. Fournier.
1994.
The novel epidemic strain O139 is closely related to pandemic strain O1 of Vibrio cholerae.
J. Infect. Dis.
170:701-704[Medline].
|
| 6.
|
Bhattacharya, S. K.,
M. K. Bhattacharya,
G. B. Nair,
D. Dutta,
A. Deb,
T. Ramamurthy,
S. Garg,
P. K. Saha,
P. Dutta,
A. Moitra,
B. K. Mandel,
T. Shimada,
Y. Takeda, and B. C. Deb.
1993.
Clinical profile of acute diarrhoea cases infected with the new epidemic strain of V. cholerae O139: designation of disease as cholera.
J. Infect. Dis.
27:11-15.
|
| 7.
|
Bik, E. M.,
A. E. Bunschoten,
R. D. Gouw, and F. R. Mooi.
1995.
Genesis of the novel epidemic Vibrio cholerae O139 strain: evidence for horizontal transfer of genes involved in polysaccharide synthesis.
EMBO J.
14:209-216[Medline].
|
| 8.
|
Bik, E. M.,
A. E. Bunschoten,
R. J. L. Willems,
A. C. Y. Chang, and F. R. Mooi.
1996.
Genetic organization and functional analysis of the otn DNA essential for cell-wall polysaccharide synthesis in Vibrio cholerae O139.
Mol. Microbiol.
20:799-811[Medline].
|
| 9.
|
Bik, M.,
R. D. Gouw, and F. R. Mooi.
1996.
DNA fingerprinting of Vibrio cholerae strains with a novel insertion sequence element: a tool to identify epidemic strains.
J. Clin. Microbiol.
34:1453-1461[Abstract].
|
| 10.
|
Burrows, L. L.,
D. F. Charter, and J. S. Lam.
1996.
Molecular characterization of the Pseudomonas aeruginosa serotype O5 (PAI) B-band lipopolysaccharide gene cluster.
Mol. Microbiol.
22:481-495[Medline].
|
| 11.
|
Cholera Working Group.
1993.
Large epidemics of cholera-like disease in Bangladesh caused by Vibrio cholerae O139 synonym Bengal.
Lancet
342:387-390.
|
| 11a.
| Comstock, L. E. Personal communication.
|
| 12.
|
Comstock, L. E.,
J. A. Johnson,
J. M. Michalski,
J. G. Morris, Jr., and J. B. Kaper.
1996.
Cloning and sequence of a region encoding a surface polysaccharide of Vibrio cholerae O139 and characterization of the insertion site in the chromosome of Vibrio cholerae O1.
Mol. Microbiol.
19:815-826[Medline].
|
| 13.
|
Dumontier, S.,
P. Trieu-Cuot, and P. Berche.
1998.
Structural and functional characterization of IS1358 from Vibrio cholerae.
J. Bacteriol.
180:6101-6106[Abstract/Free Full Text].
|
| 14.
|
Fallarino, A.,
C. Mavrangelos,
U. H. Stroeher, and P. A. Manning.
1997.
Identification of additional genes required for O-antigen biosynthesis in Vibrio cholerae O1.
J. Bacteriol.
179:2147-2153[Abstract/Free Full Text].
|
| 15.
|
Favre, D.,
S. J. Cryz, Jr., and J.-F. Viret.
1996.
Construction and characterization of a potential live oral carrier-based vaccine against Vibrio cholerae O139.
Infect. Immun.
64:3565-3570[Abstract].
|
| 16.
|
Glass, R. I.,
S. Becker,
M. I. Huq,
B. J. Soll,
M. U. Khan,
M. H. Merson,
J. V. Lee, and R. E. Black.
1982.
Endemic cholera in rural Bangladesh, 1966-1980.
Am. J. Epidemiol.
116:959-970[Abstract/Free Full Text].
|
| 17.
|
Hayashi, M.,
J. Fujii, and T. Unemoto.
1997.
Genetic defect of the sodium pump-defective mutant nap-1 from the marine Vibrio alginolyticus.
Biochem. Mol. Biol. Intl.
41:41-47[Medline].
|
| 18.
|
Iredell, J. R.,
U. H. Stroeher,
H. M. Ward, and P. A. Manning.
1998.
Lipopolysaccharide O-antigen expression and the effect of its absence on virulence in rfb mutants of Vibrio cholerae O1.
FEMS Immunol. Med. Microbiol.
20:45-54[Medline].
|
| 19.
|
Jesudason, M. V., and T. J. John.
1996.
The Vellore vibrio watch.
Lancet
347:1493-1494[Medline].
|
| 20.
|
Johnson, J. A.,
C. A. Salles,
P. Panigrahi,
M. J. Albert,
A. C. Wright,
R. J. Johnson, and J. G. Morris, Jr.
1994.
Vibrio cholerae O139 synonym Bengal is closely related to Vibrio cholerae El Tor but has important differences.
Infect. Immun.
62:2108-2110[Abstract/Free Full Text].
|
| 21.
|
Kaper, J. B.,
J. G. Morris, Jr., and M. M. Levine.
1995.
Cholera.
Clin. Microbiol. Rev.
8:48-86[Abstract].
|
| 22.
|
Maniatis, T.,
E. F. Fritsch, and J. Sambrook.
1982.
Molecular cloning: a laboratory manual.
Cold Spring Harbor Laboratory, Cold Spring Harbor, N.Y.
|
| 23.
|
Manning, P. A.,
U. H. Stroeher, and R. Morona.
1994.
Molecular basis for O-antigen biosynthesis in Vibrio cholerae O1: Ogawa-Inaba switching, p. 77-94.
In
I. K. Wachsmuth, P. A. Blake, and O. Olsvik (ed.), Vibrio cholerae and cholera: molecular to global perspectives. American Society for Microbiology, Washington, D.C.
|
| 24.
|
Mecsas, J., and E. J. Strauss.
1996.
Molecular mechanisms of bacterial virulence: type III secretion and pathogenicity islands.
Emerg. Infect. Dis.
2:271-288.
|
| 25.
|
Monaco, A. P.
1995.
Pulse field gel electrophoresis: a practical approach.
Oxford University Press, Oxford, England.
|
| 26.
|
Mooi, F. R., and E. M. Bik.
1997.
The evolution of epidemic Vibrio cholerae strains.
Trends Microbiol.
4:161-165.
|
| 27.
|
Morris, J. G., Jr.,
G. E. Losonsky,
J. A. Johnson,
C. O. Tacket,
J. P. Nataro,
P. Panigrahi, and M. M. Levine.
1995.
Clinical and immunological characteristics of Vibrio cholerae O139 Bengal infection in North American volunteers.
J. Infect. Dis.
171:903-908[Medline].
|
| 28.
|
Popovic, T.,
P. I. Fields,
O. Olsvik,
J. G. Wells,
G. M. Evins,
D. N. Cameron,
J. J. Farmer III,
C. A. Bopp,
K. Wachsmuth,
R. B. Sack,
M. J. Albert,
G. B. Nair,
T. Shimada, and J. C. Feeley.
1995.
Molecular subtyping of toxigenic Vibrio cholerae O139 causing epidemic cholera in India and Bangladesh, 1992-1993.
J. Infect. Dis.
171:122-127[Medline].
|
| 29.
|
Ramamurthy, T.,
S. Garg,
R. Sharma,
S. K. Bhattacharya,
G. B. Nair,
T. Shimada,
T. Takeda,
T. Karasawa,
H. Kurazano,
A. Pal, and Y. Takeda.
1993.
Emergence of novel strain of Vibrio cholerae with epidemic potential in southern and eastern India.
Lancet
341:703-704[Medline].
|
| 30.
|
Schnaitman, C. A., and J. D. Klena.
1993.
Genetics of lipopolysaccharide biosynthesis in enteric bacteria.
Microbiol. Rev.
57:655-682[Abstract/Free Full Text].
|
| 31.
|
Sharma, C.,
M. Thungapathra,
A. Ghosh,
A. K. Mukhopadhyay,
A. Basu,
R. Mitra,
I. Basu,
S. K. Bhattacharya,
T. Shimada,
T. Ramamurthy,
T. Takeda,
S. Yamasaki,
Y. Takeda, and G. B. Nair.
1998.
Molecular analysis of non-O1, non-O139 Vibrio cholerae associated with an unusual upsurge in the incidence of cholera-like disease in Calcutta, India.
J. Clin. Microbiol.
36:114-117.
|
| 32.
|
Shimada, T.,
G. B. Nair,
B. C. Deb,
M. J. Albert,
R. B. Sack, and Y. Takeda.
1993.
Outbreak of Vibrio cholerae non-O1 in India and Bangladesh.
Lancet
341:1347[Medline].
|
| 33.
|
Shimada, T.,
E. Arakawa,
K. Itoh,
T. Okitsu,
A. Matsushima,
Y. Asai,
S. Yamai,
T. Nakazato,
G. B. Nair,
M. J. Albert, and Y. Takeda.
1994.
Extended serotyping scheme for Vibrio cholerae.
Curr. Microbiol.
28:175-178.
|
| 34.
|
Smith, H. L.
1979.
Serotyping of non-cholera vibrios.
J. Clin. Microbiol.
10:85-90[Abstract/Free Full Text].
|
| 35.
|
Stroeher, U. H.,
L. E. Karageorgos,
R. Morona, and P. A. Manning.
1992.
Serotype conversion in Vibrio cholerae O1.
Proc. Natl. Acad. Sci. USA
89:2566-2570[Abstract/Free Full Text].
|
| 36.
|
Stroeher, U. H.,
L. E. Karageorgos,
R. Morona, and P. A. Manning.
1995.
In Vibrio cholerae serogroup O1, rfaD is closely linked to the rfb operon.
Gene
155:67-72[Medline].
|
| 37.
|
Stroeher, U. H.,
K. E. Jedani,
B. K. Dredge,
R. Morona,
M. H. Brown,
L. E. Karageorgos,
J. M. Albert, and P. A. Manning.
1995.
Genetic rearrangement of the rfb regions of Vibrio cholerae O1 and O139.
Proc. Natl. Acad. Sci. USA
92:10374-10378[Abstract/Free Full Text].
|
| 38.
|
Stroeher, U. H.,
G. Parasivam,
B. K. Dredge, and P. A. Manning.
1997.
Novel Vibrio cholerae O139 genes involved in lipopolysaccharide biosynthesis.
J. Bacteriol.
179:2740-2747[Abstract/Free Full Text].
|
| 39.
|
Stroeher, U. H., and P. A. Manning.
1997.
Vibrio cholerae serotype O139: swapping genes for surface polysaccharide biosynthesis.
Trends Microbiol.
5:178-180[Medline].
|
| 40.
|
Stroeher, U. H.,
K. E. Jedani, and P. A. Manning.
1998.
Genetic organization of the regions associated with surface polysaccharide synthesis in Vibrio cholerae O1, O139 and Vibrio anguillarum O1 and O2: a review.
Gene
223:269-282[Medline].
|
| 41.
|
Waldor, M. K.,
R. Colwell, and J. J. Mekalanos.
1994.
The Vibrio cholerae O139 serogroup antigen includes an O-antigen capsule and lipopolysaccharide virulence determinants.
Proc. Natl. Acad. Sci. USA
91:11388-11392[Abstract/Free Full Text].
|
| 42.
|
Waldor, M. K., and J. J. Mekalanos.
1994.
Vibrio cholerae O139 specific gene sequences.
Lancet
343:1366[Medline].
|
| 43.
|
Wang, R. F., and S. R. Kushner.
1991.
Construction of versatile low-copy number vectors for cloning, sequencing and gene expression in Escherichia coli.
Gene
100:195-199[Medline].
|
| 44.
|
World Health Organization.
1969.
Outbreak of gastro-enteritis by nonagglutinable (NAG) Vibrio.
Weekly Epidemiol. Rev.
44:1-28.
|
| 45.
|
Weintraub, A.,
G. Widmalm,
P.-E. Jansson,
M. Jansson,
K. Hultenby, and M. J. Albert.
1994.
Vibrio cholerae O139 Bengal possesses a capsular polysaccharide which may confer increased virulence.
Microb. Pathog.
16:235-241[Medline].
|
| 46.
|
Xiang, S.-H.,
M. Hobbs, and P. R. Reeves.
1994.
Molecular analysis of the rfb gene cluster of a group D2 Salmonella enterica strain: evidence for its origin from an insertion sequence-mediated recombination event between group E and D1 strains.
J. Bacteriol.
176:4357-4365[Abstract/Free Full Text].
|
| 47.
| Xu, D. Q. Personal communication.
|
| 48.
|
Yamasaki, S.,
T. Shimizu,
K. Hoshino,
S. Ho,
T. Shimada,
G. B. Nair, and Y. Takeda.
1998.
Vibrio cholerae genes for O-antigen synthesis, strain O22, complete cds. GenBank accession no. ABO12957.
.
|
Infection and Immunity, October 1999, p. 5033-5040, Vol. 67, No. 10
0019-9567/99/$04.00+0
Copyright © 1999, American Society for Microbiology. All rights reserved.
This article has been cited by other articles:
-
Nusrin, S., Gil, A. I., Bhuiyan, N. A., Safa, A., Asakura, M., Lanata, C. F., Hall, E., Miranda, H., Huapaya, B., Vargas G., C., Luna, M. A., Sack, D. A., Yamasaki, S., Nair, G. B.
(2009). Peruvian Vibrio cholerae O1 El Tor strains possess a distinct region in the Vibrio seventh pandemic island-II that differentiates them from the prototype seventh pandemic El Tor strains. J Med Microbiol
58: 342-354
[Abstract]
[Full Text]
-
Kotetishvili, M., Stine, O. C., Chen, Y., Kreger, A., Sulakvelidze, A., Sozhamannan, S., Morris, J. G. Jr.
(2003). Multilocus Sequence Typing Has Better Discriminatory Ability for Typing Vibrio cholerae than Does Pulsed-Field Gel Electrophoresis and Provides a Measure of Phylogenetic Relatedness. J. Clin. Microbiol.
41: 2191-2196
[Abstract]
[Full Text]
-
Li, M., Kotetishvili, M., Chen, Y., Sozhamannan, S.
(2003). Comparative Genomic Analyses of the Vibrio Pathogenicity Island and Cholera Toxin Prophage Regions in Nonepidemic Serogroup Strains of Vibrio cholerae. Appl. Environ. Microbiol.
69: 1728-1738
[Abstract]
[Full Text]
-
Faruque, S. M., Sack, D. A., Sack, R. B., Colwell, R. R., Takeda, Y., Nair, G. B.
(2003). Inaugural Article: Emergence and evolution of Vibrio cholerae O139. Proc. Natl. Acad. Sci. USA
100: 1304-1309
[Abstract]
[Full Text]
-
Zo, Y.-G., Rivera, I. N. G., Russek-Cohen, E., Islam, M. S., Siddique, A. K., Yunus, M., Sack, R. B., Huq, A., Colwell, R. R.
(2002). Genomic profiles of clinical and environmental isolates of Vibrio cholerae O1 in cholera-endemic areas of Bangladesh. Proc. Natl. Acad. Sci. USA
99: 12409-12414
[Abstract]
[Full Text]
-
Valvano, M. A., Messner, P., Kosma, P.
(2002). Novel pathways for biosynthesis of nucleotide-activated glycero-manno-heptose precursors of bacterial glycoproteins and cell surface polysaccharides. Microbiology
148: 1979-1989
[Full Text]
-
Li, M., Shimada, T., Morris, J. G. Jr., Sulakvelidze, A., Sozhamannan, S.
(2002). Evidence for the Emergence of Non-O1 and Non-O139 Vibrio cholerae Strains with Pathogenic Potential by Exchange of O-Antigen Biosynthesis Regions. Infect. Immun.
70: 2441-2453
[Abstract]
[Full Text]
-
Mukhopadhyay, A. K., Chakraborty, S., Takeda, Y., Nair, G. B., Berg, D. E.
(2001). Characterization of VPI Pathogenicity Island and CTX{phi} Prophage in Environmental Strains of Vibrio cholerae. J. Bacteriol.
183: 4737-4746
[Abstract]
[Full Text]