This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow An erratum has been published
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowReprints and Permissions
Right arrow Copyright Information
Right arrow Books from ASM Press
Right arrow MicrobeWorld
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Appelmelk, B. J.
Right arrow Articles by Kusters, J. G.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Appelmelk, B. J.
Right arrow Articles by Kusters, J. G.

 Previous Article  |  Next Article 

Infection and Immunity, October 1999, p. 5361-5366, Vol. 67, No. 10
0019-9567/99/$04.00+0
Copyright © 1999, American Society for Microbiology. All rights reserved.

Phase Variation in Helicobacter pylori Lipopolysaccharide due to Changes in the Lengths of Poly(C) Tracts in alpha 3-Fucosyltransferase Genes

Ben J. Appelmelk,1,* Steve L. Martin,2 Mario A. Monteiro,3 Chris A. Clayton,2 Andrew A. McColm,2 Pengyuan Zheng,1,dagger Theo Verboom,1 Janneke J. Maaskant,1 Dirk H. van den Eijnden,4 Cornelis H. Hokke,4 Malcolm B. Perry,3 Christina M. J. E. Vandenbroucke-Grauls,1 and Johannes G. Kusters1

Departments of Medical Microbiology1 and Medical Chemistry,4 Vrije Universiteit, Medical School, 1081 BT Amsterdam, The Netherlands; Glaxo Wellcome Medicines Research Centre, Stevenage, United Kingdom2; and Institute of Biological Sciences, National Research Council, Ottawa, Canada3

Received 11 March 1999/Returned for modification 15 June 1999/Accepted 16 July 1999


    ABSTRACT
Top
Abstract
Introduction
Materials and Methods
Results
Discussion
References

The lipopolysaccharide (LPS) of Helicobacter pylori expresses the Lewis x (Lex) and/or Ley antigen. We have shown previously that H. pylori LPS displays phase variation whereby an Lex-positive strain yields variants with different LPS serotypes, for example, Lex plus Ley or nonfucosylated polylactosamine. H. pylori has two alpha 3-fucosyltransferase genes that both contain poly(C) tracts. We now demonstrate that these tracts can shorten or lengthen randomly, which results in reversible frameshifting and inactivation of the gene products. We provide genetic and serological evidence that this mechanism causes H. pylori LPS phase variation and demonstrate that the on or off status of alpha 3-fucosyltransferase genes determines the LPS serotypes of phase variants and clinical isolates. The role of the alpha 3-fucosyltransferase gene products in determining the LPS serotype was confirmed by structural-chemical analysis of alpha 3-fucosyltransferase knockout mutants. The data also show that the two alpha 3-fucosyltransferase genes code for enzymes with different fine specificities, and we propose the names futA and futB to designate the orthologs of the H. pylori 26695 alpha 3-fucosyltransferase genes HP0379 and HP0651, respectively. The data also show that the alpha 3-fucosylation in H. pylori precedes alpha 3-fucosyltransferase, an order of events opposite to that which prevails in mammals. Finally, the data provide an understanding at the molecular level of the mechanisms underlying LPS diversity in H. pylori, which may play an important role in adaptation to the host.


    INTRODUCTION
Top
Abstract
Introduction
Materials and Methods
Results
Discussion
References

Helicobacter pylori causes lifelong infection in humans and is involved in diverse diseases: gastritis, gastric and duodenal ulcer, gastric adenocarcinoma, and mucosa-associated lymphoid tissue lymphoma (16). Through which mechanism(s) H. pylori is able to persist chronically is not known, but possibly molecular mimicry plays a role (2, 3). In mimicry of the host, H. pylori lipopolysaccharide (LPS) expresses Lewis blood group antigens (Fig. 1). Polymeric Lewis x (Lex), Ley, or both (5, 6) are expressed most often, but Lea, H type 1, and the i antigen can also be present (21). The expression of Lewis antigens appears to be a highly conserved feature, and only a few strains lack these epitopes (29); this is striking because genetically H. pylori is very diverse (17). This conservation might be related to the restricted ecological niche of H. pylori: the human stomach. Gastric mucosal epithelial cells also express Lewis antigens. Molecular mimicry (2, 3) might mediate evasion by the microorganism of host immune attack and allow colonization to persist. A similar mimicry is seen in the ferret, where both Helicobacter mustelae and the host express blood group A (22, 25). Thus, Helicobacter seems capable of expressing an LPS serotype similar and adapted to that of the host. Data supporting this concept were obtained from both human studies (38) and experimental infection studies where, depending on the Lewis phenotype of the host, the infecting H. pylori strain expressed mainly Lex or mainly Ley (39). These data suggest that H. pylori LPS Lewis antigen expression may change, depending on the host. The mechanisms responsible for these phenotypical changes were the subject of this study.


View larger version (21K):
[in this window]
[in a new window]
  		FIG. 1.   Structures of Lewis blood group antigens and H. pylori LPS. Gal, D-galactose; Fuc, L-fucose; GlcNAc, N-acetyl-D-glucosamine. The general structure of H. pylori LPS is O-antigen-core-lipid A.

Previously we have shown that H. pylori LPS displays phase variation (4). This is the occurrence of spontaneous, high-frequency (up to 0.5%), reversible on-off switching of LPS epitopes. Bacterial cells of the parent strain NCTC 11637 that express Lex can yield phase variants (variant K4.1) that express the nonfucosylated i antigen; back switches from K4.1 to the alpha 3-fucosylated parent phenotype are also observed. Other variants strongly express both Lex and Ley (variant 1c) or related epitopes (4).

Phase variation in the LPSs of Neisseria spp. (40) and Haemophilus influenzae (27) is well documented and is caused by reversible on-off switching of LPS biosynthesis genes. On-off switching occurs during replication due to a strand slip mechanism which changes the length of polynucleotide repeats, for example, of G tracts present in certain glycosyltransferase genes of Neisseria spp. (40). Changes in these polynucleotide tracts introduce translational frameshifts, leading to the production of inactive truncated gene products, i.e., the gene is switched off. Subsequent changes during replication may switch the gene back on by restoring the reading frame and restoring production of an active gene product. The consequence is a variable LPS phenotype. There is evidence which suggests that the LPS phase variation in Neisseria spp. plays an adaptive role and generates microorganisms that either adhere better to host cells or are more resistant to being killed by complement (34). Phase variation in H. pylori LPS causes considerable changes in Lewis antigen expression and might be responsible for the changes in Lewis antigen expression observed in vivo (39). The molecular mechanisms of H. pylori LPS phase variation are unknown.

H. pylori requires a series of enzymes to synthesize LPS O antigen containing an Lex polymer plus an Ley terminus: alpha 3- and alpha 2-fucosyltransferases that link fucose to C-3 of N-acetylglucosamine (GlcNAc) and C-2 of galactose (Gal), respectively; GlcNAc transferases (GlcNAcT) and Gal transferases (GalT) that form the main polylactosamine O chain are also required. Two H. pylori alpha 3-fucosyltransferase genes (HP0379 and HP0651 in strain 26695; JHP 1002 and 596 in strain J99) have been identified, cloned, and expressed (1, 13, 18, 31). An alpha 2-fucosyltransferase gene (HP0093/94 in strain 26695; JHP 86 in strain J99) was also identified and characterized (7, 28, 35). These genes contain poly(C) tracts: in strain 26695, both alpha 3-fucosyltransferase genes contain C13 tracts, while the alpha 2-fucosyltransferase gene contains a C14 tract (31). C tracts are also found in the homologous genes in strain J99 (1). Another feature of alpha 3-fucosyltransferase genes is the presence of oligonucleotide repeats at the 3' end. We hypothesized that the LPS phase variation in H. pylori is caused by (reversible) inactivation of glycosyltransferases through translational frameshifts due to the presence of these C tracts.

In the present paper, we provide evidence that length changes in the poly(C) tracts of alpha 3-fucosyltransferase genes indeed lead to phase variation in the LPS of H. pylori. The on or off status of the two alpha 3-fucosyltransferase genes determined the LPS serotypes of selected phase variants and clinical isolates. The data show that the two alpha 3-fucosyltransferase gene products have different specificities and, by analogizing with the nomenclature for eukaryotic fucosyltransferases (8a), we propose the names futA and futB to designate the orthologs of the H. pylori 26695 alpha 3-fucosyltransferase genes HP0379 and HP0651, respectively. The role of futA and futB gene products was confirmed through the structural-chemical and serological analysis of mutant strains in which one or both alpha 3-fucosyltransferase genes were inactivated. Our results provide a molecular basis for an understanding of how H. pylori might adapt to the host.


    MATERIALS AND METHODS
Top
Abstract
Introduction
Materials and Methods
Results
Discussion
References

Bacterial strains. Strain NCTC 11637 and the LPS phase variants 2b, K4.1, K5.1, and 1c have been described before (4, 5). NCTC 11637 and variant 2b express mainly Lex. Variant K4.1 expresses the i antigen. Variant K5.1, derived from strain K4.1, expresses mainly Lex and represents a back switch to the serotype of the parent strain. Variant 1c expresses Lex and Ley. Strain P466 (6) was obtained from T. Boren; strain 26695 (31) was obtained from S. Krakowka; strain 4187E was described before (19); strain J223 was obtained from H. P. Wirth (21); strain N6 was obtained from A. Labigne; strain J99 was obtained from R. Alm (1); and strain SS-1 was obtained from A. Lee. Bacteria were grown in brucella broth supplemented with 10% newborn-calf serum as described before (4).

Monoclonal antibodies and ELISA. The monoclonal antibodies (MAbs) used in this study and their specificities are shown in Table 1. For enzyme-linked immunosorbent assays (ELISAs), polystyrene 96-well microtiter plates were coated at 7.5 × 106 CFU/ml with bacteria washed in phosphate-buffered saline, and the bacteria were tested for reactivity with MAbs (1 µg/ml) as described before (4). In indicated cases, titrations were done with MAbs diluted in serial twofold steps.

                              
View this table:
[in this window]
[in a new window]
  		TABLE 1.   MAbs used in this study

Fucosyltransferase assays. alpha 3-Fucosyltransferase activity was determined as follows (18, 26). Bacterial cell extract (12.5 µl) was incubated with 20 µM GDP-fucose (Sigma), 100,000 cpm of GDP-[3H]fucose (Amersham), 5 mM N-acetyllactosamine (Sigma), 5 mM MnCl2, 1 mM ATP, buffered to pH 7.2 with 50 mM HEPES-NaOH in a total volume of 50 µl. Reaction mixtures were incubated for 1 h at 37°C, and the reactions were stopped by the addition of 1 ml of mixed-bed resin slurry AG1-X8 (Cl- form; Bio-Rad) at 1:4 (wt/vol) in water. The mixtures were then vortexed briefly and centrifuged for 5 min at 20,000 × g at room temperature. The radioactivity in 600 µl of supernatant was measured by scintillation counting. Allowance was made for nonspecific breakdown of labeled nucleotide sugar and transfer to endogenous acceptors by performing control reactions in the absence of acceptor.

DNA sequencing. Poly(C) tracts and terminal repeats of the alpha 3-fucosyltransferase genes futA (HP0379 orthologs) and futB (HP0651 orthologs) were sequenced with several primers in both strands. The following primers were used: HPFT-3 (TGGCAAACCCTCTTTTCAAAG), HPFT-4 (GTGTAATGCTGACTTAAAAT), HPFT-5 (TAGCCCTAATCAAGCCTTTG), HPFT-12 (TGTGCTGAGTTTGGATCCATATGTTCCAACCCCTATTA), HPFT-13 (TTCTAAAGTGGATTCTGAAAT), HPFT-14 (GAGTGGGCGAAAGAGAGATTG), HPFT-15 (CCTAAATTAGCTTAAAGGATAACC), HPFT-16 (GCGATGATAGCGCAAGGGGTTTGA), HPFT-17 (AAGGCATTCTCAAATAACGATC), HPFT-18 (GAATTTTTTAACCCATCTCCC), HPFT-19 (AGAGGACATGCTCAAAAACCC), Kanr-F (CTATGAAGCGCCATATTTAA), and Kanr-R (TTTAGACATCTAAATCTAGG). Sequencing was carried out on alpha 3-fucosyltransferase gene fragments amplified by PCR. DNA fragments containing futA were amplified from H. pylori genomic DNA with primers HPFT-15 and HPFT-16 and sequenced with primers HPFT-3, HPFT-4, HPFT-12, HPFT-15, and HPFT-17 [poly(C) region] and HPFT-9, HPFT-11, HPFT-16, and HPFT-18 (terminal zipper-like repeat region). futB was amplified with HPFT-5 and HPFT-3 or HPFT-5 and HPFT-19 and sequenced with HPFT-3, HPFT-4, HPFT-17, HPFT-5, and HPFT-12 [poly(C) region] and HPFT-9, HPFT-11, and HPFT-19 (terminal zipper-like repeat region). DNA sequencing reactions were performed with AmpliTaq FS with dye terminators (Perkin-Elmer Cetus) and analyzed on an Applied Biosystems 373 automated sequencer. As the sequencing of polynucleotide C tracts is prone to errors (15), the relevant region of alpha 3-fucosyltransferase genes from each strain was sequenced several times with template DNA from separate PCR amplifications. The sequence data were compiled with the Lasergene software package (DNASTAR). The final assessment of C-tract length was done by one of us (S.L.M.), unaware of serological information.

Construction of alpha 3-fucosyltransferase knockout mutants. (i) Mutagenesis of cloned H. pylori alpha 3-fucosyltransferase genes. The source of the futB gene was clone p15M19, previously isolated from an H. pylori plasmid gene (18). The plasmid was linearized at the unique BssHII site within the futB gene, blunt ended with Klenow polymerase, and dephosphorylated with shrimp alkaline phosphatase (Amersham-Pharmacia Biotech). A Campylobacter coli chloramphenicol (Cm) resistance marker cassette (36), excised from a clone in pUC20 with HincII, was ligated to the linearized p15M19, and the resulting plasmid was used to transform Escherichia coli XL1-Blue (Stratagene) to chloramphenicol resistance. The futA gene was amplified from H. pylori 26695 genomic DNA by PCR with primers positioned approximately 1 kb from each end of futA, i.e., HP0379 in the published sequence (5'-TTCTAAAGTGGATTCTGAAAT-3' and 5'-GAGTGGGCGAAAGAGAGATTG-3'). The fragment was cloned into pGEM T-easy (Promega). The resulting plasmid, designated pHP0379, was linearized with AccB7I at the unique site within the futA gene, blunt-ended with T4 polymerase plus all four deoxynucleoside triphosphates, and dephosphorylated with shrimp alkaline phosphatase. A C. coli kanamycin (Km) resistance marker (32) was obtained as a 1.4-kb EcoRI fragment from a clone containing the amplified cassette in pGEM. The fragment was blunt ended with Klenow polymerase plus all four deoxynucleoside triphosphates and ligated to the linearized pHP0379, and the resulting plasmid was used to transform E. coli XL1-Blue to kanamycin resistance. Correct insertion of the Cmr marker into pHP0651 and of Kmr into pHP0379 was confirmed by restriction mapping and nucleotide sequencing; the resulting plasmids were designated pHP0651::Cmr and pHP0379::Kmr, respectively.

(ii) Homologous recombination in H. pylori. futA and futB were inactivated by homologous recombination with the above-mentioned plasmids, which contain disrupted copies of the respective genes, flanked on either side by approximately 1 kb of homologous sequence. DNA was introduced by electroporation. For selection of the transformants, suspensions were spread onto Columbia chocolate agar plates containing 20 µg of chloramphenicol/ml (in the case of futB disruptants) or 20 µg of kanamycin/ml (for futA disruptants). Single colonies were streaked on fresh antibiotic-containing plates, and transformants were grown. A double-knockout mutant (4187E-KO379/651) was produced by inactivating futB in an established futA-disrupted (Kanr) strain. Genomic DNA from all transformants was analyzed by PCR and Southern hybridization to confirm that the recombination had occurred at the intended location.

Structural analysis of LPS. Methylation linkage analysis and fast atom bombardment-mass spectrometry (FAB-MS) of purified LPS of strain 4187E and its alpha 3-fucosyltransferase knockout mutants was performed. Methylation linkage analysis was carried out by the NaOH-dimethyl sulfoxide-CH3I procedure (9) and with characterization of permethylated alditol acetate derivatives by gas-liquid chromatography-MS in the electron impact mode. Methylated material was used for positive-ion FAB-MS, which was performed on a Jeol JMS-AX505H mass spectrometer with thioglycerol as the matrix. A 6-kV Xenon beam was used to produce pseudomolecular ions, which were then accelerated to 3 kV, and their mass was analyzed. Product ion scan was performed on metastable ions created in the first free field with a source pressure of 5 × 10-5 torr. The interpretation of positive-ion mass spectra of the permethylated LPS derivatives was done as previously described (10).


    RESULTS
Top
Abstract
Introduction
Materials and Methods
Results
Discussion
References

Molecular mechanisms of reversible phase variation from Lex to i antigen and back to Lex. The molecular genetic mechanisms underlying the phase variation of NCTC 11637 to variant K4.1 were investigated; K4.1 switches back to K5.1, which has a serotype similar to those of NCTC 11637 and phase variant 2b (Table 2). NCTC 11637 expresses polymeric Lex, as measured by the strong reactivity with MAb 54.1F6A. MAb 6H3, specific for monomeric Lex, did not react; strain NCTC 11637 also weakly expresses Ley and strongly expresses H type 1. In addition, it reacts weakly with 3C10, a MAb specific for H type 2; no nonfucosylated polylactosamines (i.e., i antigen) could be detected. In contrast, phase variant K4.1 mainly expresses i antigen and H type 1 but does not express Lex or Ley. DNA sequence analysis revealed that in both the parent, NCTC 11637, and the variant K4.1, the poly(C) repeat in futB contains nine C residues (C9) (Table 2). However, the futA genes differ in repeat length: the phase variant has an additional C residue (C11) relative to NCTC 11637 (C10). Predicted translations of both the futA and futB genes reveal that full coding integrity is maintained with a C10 repeat while expansion or reduction by one residue introduces a frameshift which truncates the coding sequence. Thus, NCTC 11637 has one intact alpha 3-fucosyltransferase (futA) and expresses Lex and Ley while in the phase variant K4.1 both genes are truncated and alpha 3-fucosylated epitopes cannot be produced. The connection between polynucleotide repeat length and Lex/y serotype is further illustrated by a second variant, K5.1, derived from K4.1 itself. The poly(C) repeat lengths of futB and futA in K5.1 were found to be C9 and C10, respectively, i.e., K5.1 represents a reversion to the NCTC 11637 genotype. One would therefore expect K5.1 to show an Lex/y serotype similar to that of NCTC 11637, as indeed was found to be the case (Table 2). We conclude from these results that phase-variable expression of Lex/y epitopes in NCTC 11637 and variants K4.1 and K5.1 is the result of changes in poly(C) repeat length in futA. It is interesting that switching of the alpha 3-fucosyltransferase genes appears to have some effect on alpha 2-fucosylation. Loss of Lex and Ley expression in variant K4.1 relative to NCTC 11637 is not accompanied by an increase in expression of the alpha 2-fucosylated core structure of Ley, H type 2. Since in vitro evidence suggests that the H. pylori alpha 3-fucosyltransferases have no detectable alpha 2-fucosyltransferase activity (13, 18), this observation suggests that alpha 3-fucosylation precedes alpha 2-fucosylation in H. pylori Ley biosynthesis. This was in sharp contrast with the strong expression of H type 1 in both NCTC 11637 and K4.1, and evidently the alpha 2-fucosyltransferase is able to fucosylate Galbeta 1-3GlcNAc. HP093-HP094 codes for an alpha 2-fucosyltransferase enzyme that is involved in Ley synthesis (35); we propose the name futC to designate H. pylori alpha 2-fucosyltransferase genes (HP093-HP094 and orthologs). Evidently, for H type 1 biosynthesis also, alpha 2-fucosyltransferase enzyme activity is required; we have evidence that the same gene (futC) is involved in Ley and H type 1 biosyntheses (see below). In NCTC 11637 and the variants K4.1 and K5.1, the number of leucine zipper-like 7-amino-acid repeats near the termini of the alpha 3-fucosyltransferase genes (18) was invariant (eight repeats in futB and two in futA), suggesting that this region is not involved in LPS phase variation.

                              
View this table:
[in this window]
[in a new window]
  		TABLE 2.   Reactivitya of MAbs with H. pylori strains in relation to alpha 3-fucosyltransferase gene C-tract length

Molecular mechanisms of phase variation from Lex to Lex plus Ley. We next investigated phase variation from NCTC 11637 to its variant 1c, described before (4). Most strikingly, compared to NCTC 11637, variant 1c has a strongly enhanced Ley reactivity and markedly reduced H type 1 expression (Table 2). In addition, strain 1c reacted with MAb 6H3, specific for monomeric Lex; the reactivities of variant 1c and strain NCTC 11637 with MAb 3C10 were similar. Sequencing data show that 1c has a C10 repeat in futB while NCTC 11637 has a C9 tract in that gene, implying that both alpha 3-fucosyltransferase genes are intact (on) in 1c, whereas in NCTC 11637, only futA is functional. Once again, changes in the alpha 3-fucosyltransferase gene status appear to influence the expression of an alpha 2-fucosylated epitope; it may be that having both genes switched on in variant 1c increases the availability of terminal Lex, a precursor of Ley (see below).

In order to confirm the link between alpha 3-fucosyltransferase gene status and serotype and to establish whether futA and futB play completely interchangeable roles in LPS biosynthesis, we wished to compare the serotype of NCTC 11637 (futA on; futB off) with that of its "mirror" variant (futA off; futB on), but no such variant was found. We therefore constructed mutant strains in which one or both genes were permanently inactivated.

alpha 3-Fucosyltransferase knockout mutants. The role of futA and futB in LPS biosynthesis was studied in greater detail by insertional mutagenesis. Since our interests lay in the potential role of alpha 3-fucosylation in H. pylori infection, this work was conducted with a strain (4187E) previously validated in a mouse model of H. pylori colonization (19). 4187E has a C10 repeat in both alpha 3-fucosyltransferase genes (Table 2). Sequence analysis confirmed that, accordingly, both reading frames are intact (data not shown); both genes are on. Isogenic alpha 3-fucosyltransferase mutant strains were constructed by introducing kanamycin or chloramphenicol resistance markers into futA or futB as described in Materials and Methods. A double mutant with both alpha 3-fucosyltransferase genes disrupted was also constructed. Correct insertion of the resistance cassette into the intended target gene was confirmed by Southern hybridization and PCR analysis. Since the two alpha 3-fucosyltransferase genes have a high degree of sequence similarity, primers specific to flanking genes were used in conjunction with resistance cassette and alpha 3-fucosyltransferase primers to ensure that only the intended gene had been disrupted.

In ELISA, strain 4187E behaved almost identically to strain 1c, which also has both alpha 3-fucosyltransferase genes on. It showed strong monomeric and polymeric Lex expression, and it also strongly expressed Ley; no reaction with the H type 2 MAb was observed in 4187E or in its knockout mutants; this is striking, since H type 2 equals Ley minus alpha 3-fucose. A mutant strain in which futB had been disrupted (4187E-KO651) showed an altered serological phenotype with greatly reduced Ley expression and increased reactivity to H type 1. Reactivity to the monomeric (terminal) Lex antibody 6H3 is reduced in 4187E-KO651, but titrations with MAb 54.1F6A revealed a 128-fold increase in polymeric Lex expression. As can be seen from Table 2, the overall ELISA profile of 4187E-KO651 is very similar to that of NCTC 11637, in which futB is switched off (see above).

Compared to the disruption of gene futB, inactivation of gene futA had different effects: no change in Ley or H type 1 expression was observed in the knockout (4187E-KO379), while reactivity with 54.1F6A strongly decreased and a modest reactivity with the anti-i MAb was detected. We infer that the two alpha 3-fucosyltransferase enzymes have different fine specificities, which justifies the use of distinct gene names (futA and futB).

Inactivation of both alpha 3-fucosyltransferase genes (strain 4187E-KO379/651) completely abolished Lex and Ley, while a strong expression of the i antigen and H type 1 was observed; this serotype was similar to that of NCTC 11637 variant K4.1, which has both alpha 3-fucosyltransferase genes switched off. The increased i-antigen expression is easily understood as an unmasking of the Lex/y lactosamine scaffold in the absence of alpha 3-fucosylation.

The increase in H type 1 expression seen in K4.1 and 4187E-KO379/651 is more difficult to explain but may reflect increased alpha 2-fucosylation of type 1 (Galbeta 1-3GlcNAc) structures in the absence of competing Lex-type acceptors.

alpha 3-Fucosyltransferase gene C-tract measurements and Lewis antigen expression in other strains. Chemical structural analysis of strain J-223 has revealed that it carries H type 1 and i-antigen structures in its LPS (21). When tested in our ELISA system, J-223 reacted only with MAbs specific for H type 1 and i antigen, towards which a strong reaction was observed. The serotype of J-223 is thus identical to that of K4.1 and 4187E-KO379/651. We anticipated that J-223 was therefore likely to have both futA and futB switched off; this was confirmed by sequence analysis (not shown). Structural, serological, and sequence data for J-223 thus support the hypothesis that C repeat length in the alpha 3-fucosyltransferase genes futA and futB determines Lex/y expression.

The role of an active futB gene product in determining a strong Ley expression was further investigated in strains N6, SS-1, 26695, P466, and J99. These strains all strongly expressed Ley together with Lex, as shown in ELISA; sequence analysis of futB demonstrated that it was on in all strains (not shown).

alpha 3-Fucosyltransferase enzyme activity in 4187E alpha 3-fucosyltransferase double-knockout mutant strain. We used N-acetyllactosamine, a good acceptor for H. pylori alpha 3-fucosyltransferase enzyme activity, to measure this activity in sonicates of strain 4187E-KO379/651. No such activity could be detected.

Structural information about LPS of strain 4187E and its knockouts. The expression of Lewis blood group antigens in the LPS of strain 4187E and its alpha 3-fucosyltransferase knockout mutants was also investigated by chemical methods. The structure of the O-chain region was investigated by FAB-MS analysis of the methylated intact LPS (21). The FAB-MS spectrum of strain 4187E methylated LPS revealed the presence of H type 1 (m/z 638right-arrow228), Lex (m/z 638right-arrow432), Ley (m/z 812right-arrow402), Galbeta 1-4GlcNac (LacNac) (m/z 464right-arrow432), traces of Lea (m/z 638right-arrow402), and LacNac-Lex (m/z 1087right-arrow881). Mutant 4187E-KO651 expressed H type 1, Lex, and Ley. Methylation linkage analysis of this mutant showed a significant decrease in 2-substituted galactose and terminal fucose and an increase in terminal galactose, implying a decrease in the formation of Ley and/or H type 1 expression in this LPS. The FAB-MS spectrum of mutant 4187E-KO379 showed the presence of H type 1, Lex, and Ley, with small amounts of terminal galactose being observed in the linkage analysis compared with amounts of the 2-substituted galactose. Thus, in 4187E-KO379, Lex expression seems to be weaker than H type 1 and/or Ley, both of which contain 2-substituted Gal. FAB-MS of the LPS of the double knockout clearly showed that Lex and Ley were no longer present and that this LPS expressed only H type 1, the i antigen (LacNAc-LacNac) [m/z 464right-arrow432, 913right-arrow881], and an H type 1-LacNAc-LacNAc sequence [m/z 1087right-arrow1055, 1536, and 1985]. No 3,4-substituted GlcNAc was observed in the linkage analysis, which confirmed the absence of Lex in this LPS. No Lea was observed in any of the 4187E knockouts. The simultaneous expression of H type 1 (type 1 chain), Lex, Ley, and i antigen (type 2 chains) by strain 4187E places this strain in the LPS category of the glycotype F family (21).


    DISCUSSION
Top
Abstract
Introduction
Materials and Methods
Results
Discussion
References

In this paper we provide evidence that phase variation in the LPS of H. pylori takes place through changes in the length of poly(C) repeats of the alpha 3-fucosyltransferase genes futA and futB. Our data suggest that the LPS serotypes of phase variants and clinical isolates are determined, at least in part, by the on or off status of alpha 3-fucosyltransferase genes. Other genes play a role in LPS biosynthesis: previously we have shown that GlcNAcT activity determines the serotypes of several phase variants (4), and for expression of Ley (35) or H type 1 antigens, alpha 2-fucosyltransferase enzyme activity is required. The data also show that the genes futA and futB code for alpha 3-fucosyltransferase enzymes with different specificities. The phenotypes and genotypes of LPS phase variants and alpha 3-fucosyltransferase knockouts (Table 2) reveal that only strains with an intact futB reading frame contain terminal mono- and oligomeric Lex. We infer from this that the futB gene product efficiently fucosylates lactosamine at the residues at the nonreducing terminus of the O-antigen chain and fucosylates internal units less efficiently. The presence of terminal Lex is required for alpha 2-fucosylation in H. pylori, and hence strains that have an active futB gene also strongly express Ley. Titration with MAb 54.1F6A, which reacts with polymeric Lex, revealed that disruption of futA caused a significant decrease (64-fold) in polymeric Lex expression. It would therefore appear that the futA gene product has an acceptor preference which is complementary to that of the futB gene product: it preferentially fucosylates internal lactosamines. The resulting nonterminal polymeric Lex structures do not provide a precursor for Ley synthesis; this is consistent with the low expression of Ley by strains which have only the futA gene intact. Similar fine specificities have been described for mammalian enzymes (11, 14). The differences between the two H. pylori alpha 3-fucosyltransferase enzymes may be related to the different numbers of terminal leucine zipper-like repeats in these genes (Table 2). Experiments with chimeric alpha 3-fucosyltransferase gene constructs could be used to explore this.

Strikingly, inactivation of the futB gene product, either by insertional mutagenesis or by phase variation, leads to a strongly increased H type 1 expression (Table 2). This may reflect competition between different alpha 2-fucosyltransferase receptors. We infer that the Lex terminus, synthesized by the futB gene product, is such a good acceptor for the alpha 2-fucosyltransferase enzyme that it effectively competes with the Galbeta 1right-arrow3GlcNAc acceptor termini, hampering H type 1 synthesis. This competition disappears on inactivation of the futB gene product, when Ley is formed inefficiently and more H type 1 can be formed. These data suggest that the same alpha 2-fucosyltransferase links fucose to both type 2 (Lex) and type 1 (Galbeta 1right-arrow3GlcNAc) acceptors. futC (HP093/94 and orthologs) codes for this alpha 2-fucosyltransferase enzyme (35).

The lack of H type 2 structures in the 4187E alpha 3-fucosyltransferase double-knockout strain 4187E-KO379/651 and in strains J223 and K4.1 demonstrates that alpha 2-fucosylation of the i chain does not take place efficiently in H. pylori. We infer that the final step of Ley biosynthesis in H. pylori is the alpha 2-fucosylation of an Lex terminus. This is consistent with the reported negligible activity of the futB gene product with Fucalpha 1right-arrow2Galbeta 1right-arrow4Glc, a good acceptor for human alpha 3-fucosyltransferase (12, 18). For the synthesis of Ley in mammals, the prescribed order of fucosylation is the opposite of what is observed in H. pylori, i.e., first alpha 2-fucosylation, which is a prerequisite for addition of alpha 3-fucose (37). From the presence of the H type 1 epitope in NCTC 11637, K4.1, and J-223, we conclude that the futC gene product is able to link fucose to C-2 of beta 1right-arrow3-linked Gal.

The serological data on LPS of strain 4187E are confirmed by the chemical-structural information. The small amounts of 2-substituted Gal and terminal fucose, detected chemically in LPS of strain 4187E-KO651, are in agreement with the weak Ley expression detected by serology. The small amount of terminal Gal compared to the amount of 2-substituted Gal detected by structural means in LPS of strain 4187E-KO379 is in agreement with the decreased Lex expression detected by serology. Both by serology and by means of structural analysis, H type 1 and i antigen, but no Lex or Ley, were found in the double knockout mutant 4187E-KO370/651; the same applies to strain J-223, in which both futA and futB are also off.

The biological role of H. pylori LPS phase variation is still unsettled. Data from experimental-infection studies of monkeys clearly suggest an adaptive role (39). Four monkeys were colonized with the same strain. Bacteria of that strain isolated from animals that expressed Ley in their gastric mucosa also strongly expressed Ley in their LPS; bacteria isolated from monkeys that expressed Lex also strongly expressed Lex. These data suggest that the Lewis phenotype of the pathogen can vary and can adapt to that of the host. Whether this is also the case in humans is controversial: one study reported a relationship between the Lewis phenotype of the host and that of the colonizing strain of H. pylori (38); this was not confirmed in another study (30). A related question is whether the expression of Lewis antigens by H. pylori per se has any relevance to infection and disease. We are currently studying whether the Lex/y-deficient mutant strain 4187E-KO379/651 is as able to colonize mice as its parent strain.


    ACKNOWLEDGMENTS

We thank R. Negrini, D. Blanchard, and G. van Dam for providing MAbs. We thank R. Alm, T. Boren, S. Krakowka, A. Labigne, A. Lee, and H. P. Wirth for strains. We thank R. Pot and A. Bart for wordprocessing.


    FOOTNOTES

* Corresponding author. Mailing address: Department of Medical Microbiology, Vrije Universiteit, Med. School, van der Boechorststraat 7, 1081 BT Amsterdam, The Netherlands. Phone: 31 20 4448297. Fax: 31 20 4448318. E-mail: BJ.Appelmelk.mm{at}med.vu.nl.

dagger Present address: Department of Digestive Diseases, Second Affiliated Hospital, Henan Medical University, Zhengzhou, People's Republic of China.

Editor:   J. R. McGhee


    REFERENCES
Top
Abstract
Introduction
Materials and Methods
Results
Discussion
References

1. Alm, R. A., L. L. Ling, D. T. Moir, B. L. King, E. D. Brown, P. C. Doig, D. R. Smith, B. Noonan, B. C. Guild, B. L. deJonge, G. Carmel, P. J. Tummino, A. Caruso, M. Uria-Nickelsen, D. M. Mills, C. Ives, Q. Jiang, D. E. Taylor, G. F. Voviv, and T. J. Trust. 1999. Comparison of two unrelated isolates of the human gastric pathogen Helicobacter pylori. Nature 397:176-180[Medline].
2. Appelmelk, B. J., I. M. Simoons-Smit, R. Negrini, A. P. Moran, G. O. Aspinall, J. G. Forte, T. De Vries, H. Quan, T. Verboom, J. J. Maaskant, P. Ghiara, E. J. Kuipers, E. Bloemena, T. M. Tadema, R. R. Townsend, K. Tyagarajan, J. M. Crothers, Jr., M. A. Monteiro, A. Savio, and J. de Graaff. 1996. Potential role of molecular mimicry between Helicobacter pylori lipopolysaccharide and host Lewis blood group antigens in autoimmunity. Infect. Immun. 64:2031-2040[Abstract].
3. Appelmelk, B. J., R. Negrini, A. P. Moran, and E. J. Kuipers. 1997. Molecular mimicry between Helicobacter pylori and the host. Trends Microbiol. 5:70-73[Medline].
4. Appelmelk, B. J., B. Shiberu, C. Trinks, N. Tapsi, P. Y. Zheng, T. Verboom, J. Maaskant, C. H. Hokke, W. E. C. M. Schiphorst, D. Blanchard, I. M. Simoons-Smit, D. H. van den Einden, and C. M. J. E. Vandenbroucke-Grauls. 1998. Phase variation in Helicobacter pylori lipopolysaccharide. Infect. Immun. 66:70-76[Abstract/Free Full Text].
5. Aspinall, G. O., M. A. Monteiro, H. Pang, E. J. Walsh, and A. P. Moran. 1996. Lipopolysaccharide of the Helicobacter pylori type strain NCTC 11637 (ATCC 43504): structure of the O antigen and core oligosaccharide regions. Biochemistry 35:2489-2497[Medline].
6. Aspinall, G. O., and M. A. Monteiro. 1996. Lipopolysaccharides of Helicobacter pylori strains P466 and MO19: structures of the O antigen and core oligosaccharide strains. Biochemistry 35:2498-2504[Medline].
7. Berg, D. E., P. Hoffman, B. J. Appelmelk, and J. G. Kusters. 1997. The Helicobacter pylori genome sequence: genetic factors for long life in the gastric mucosa. Trends Microbiol. 5:468-474[Medline].
8. Blanchard, D., D. Bernard, M. J. Loirat, Y. Frioux, J. Guimbretiere, and L. Guimbretiere. 1992. Characterization of murine monoclonal antibodies directed to fetal erythrocytes. Rev. Fr. Transfus. Hemobiol. 35:239-254[Medline].
8a. Breton, C., R. Oriol, and A. Imberty. 1998. Conserved structural features in eukaryotic and prokaryotic fucosyltransferases. Glycobiology 8:87-94[Abstract/Free Full Text].
9. Ciucanu, I., and F. Kerek. 1984. A simple method for the permethylation of carbohydrates. Carbohydr. Res. 131:209-217.
10. Dell, A., P. Azadi, P. Tiller, J. Thomas-Oates, H. J. Jennings, M. Beurret, and F. Michon. 1990. Analysis of oligosaccharide epitopes of meningococcal lipopolysaccharides by fast-atom bombardment mass spectrometry. Carbohydr. Res. 200:59-76[Medline].
11. De Vries, T., T. Norberg, H. Lonn, and D. H. van den Eijnden. 1993. The use of human milk fucosyltransferase in the synthesis of tumor-associated trimeric X determinants. Eur. J. Biochem. 216:769-777[Medline].
12. De Vries, T., M. P. Palcic, P. S. Schoenmakers, D. H. Van den Eijnden, and D. H. Joziasse. 1997. Acceptor specificity of GDP-Fuc:Galbeta 1right-arrow4GlcNAc-R alpha 3-fucosyltransferase VI (FUCT VI) expressed in insect cells as soluble, secreted enzyme. Glycobiology 7:921-927[Abstract/Free Full Text].
13. Ge, Z., N. W. C. Chan, M. Palcic, and D. E. Taylor. 1997. Cloning and heterologous expression of an alpha 1,3-fucosyltransferase gene from the gastric pathogen Helicobacter pylori. J. Biol. Chem. 272:21357-21363[Abstract/Free Full Text].
14. Howard, D. R., M. Fukuda, M. N. Fukuda, and P. Stanley. 1987. The GDP-fucose:N-acetylglucosaminide 3-alpha -L-fucosyltransferases of LEC11 and LEC12 Chinese hamster ovary mutants exhibit novel specificities for glycolipid substrates. J. Biol. Chem. 262:16830-16837[Abstract/Free Full Text].
15. Jennings, M. P., D. W. Hood, I. R. A. Peak, M. Virji, and E. R. Moxon. 1995. Molecular analysis of a locus for the biosynthesis and phase variable expression of the lacto-N-neotetraose terminal LPS structure in Neisseria meningitidis. Mol. Microbiol. 18:729-740[Medline].
16. Kuipers, E. J. 1997. Helicobacter pylori and the risk and management of associated diseases: gastritis, ulcer disease, atrophic gastritis and gastric cancer. Aliment. Pharmacol. Ther. 11(Suppl. 1):71-88.
17. Logan, P. H., and D. E. Berg. 1996. Genetic diversity of Helicobacter pylori. Lancet 348:1462-1463[Medline].
18. Martin, S. L., M. R. Edbroke, T. C. Hodgman, D. H. van den Eijnden, and M. I. Bird. 1997. Lewis x biosynthesis in Helicobacter pylori: molecular cloning of an alpha -(1,3)-fucosyltransferase gene. J. Biol. Chem. 272:21349-21356[Abstract/Free Full Text].
19. McColm, A. 1997. Nonprimate animal models of H. pylori infection, p. 235-252. In C. A. Clayton, and H. L. T. Mobley (ed.), Helicobacter pylori protocols. Humana Press, Totowa, N.J.
20. Mollicone, R., A. Cailleau, A. Imberty, P. Gane, S. Perez, and R. Oriol. 1996. Recognition of the blood group H type 2 trisaccharide epitope by 28 monoclonal antibodies and three lectins. Glycoconj. J. 13:263-271[Medline].
21. Monteiro, M. A., K. H. Chan, D. A. Rasko, D. E. Taylor, P. Y. Zheng, B. J. Appelmelk, H. P. Wirth, M. Yang, M. J. Blaser, S. O. Hynes, A. P. Moran, and M. B. Perry. 1998. Simultaneous expression of type 1 and type 2 Lewis blood group antigens by Helicobacter pylori lipopolysaccharides. Molecular mimicry between H. pylori lipopolysaccharides and human gastric epithelial cell surface glycoforms. J. Biol. Chem. 273:11533-11543[Abstract/Free Full Text].
22. Monteiro, M. A., P. Y. Zheng, B. J. Appelmelk, and M. B. Perry. 1997. The lipopolysaccharide of H. mustelae type strain ATCC 43772 expresses the monofucosyl A type 1 histo-blood group epitope. FEMS Microbiol. Lett. 154:103-109[Medline].
23. Negrini, R., L. Lisato, I. Zanella, S. Cavazzini, S. Gullini, V. Villanacci, C. Poiesi, A. Albertini, and S. Ghielmi. 1991. Helicobacter pylori infection induces antibodies cross-reacting with human gastric mucosa. Gastroenterology 101:437-445[Medline].
24. Negrini, R., A. Savio, C. Poiesi, B. J. Appelmelk, F. Buffoli, A. Paterlini, P. Cesari, M. Graffeo, D. Vaira, and G. Franzin. 1996. Antigenic mimicry between Helicobacter pylori and gastric mucosa in the pathogenesis of body atrophic gastritis. Gastroenterology 111:655-665[Medline].
25. O'Croinin, T. O., M. Clyne, and B. Drumm. 1998. Molecular mimicry of ferret gastric epithelial blood group antigen by Helicobacter mustelae. Gastroenterology 114:690-696[Medline].
26. Prieels, J. P., D. Monnom, M. Dolmans, T. A. Beyer, and R. L. Hill. 1981. Co-purification of the Lewis blood group N-acetylglucosaminide alpha-1,4-fucosyltransferase and an N-acetylglucosaminide alpha-1,3-fucosyltransferase from human milk. J. Biol. Chem. 256:10456-10463[Abstract/Free Full Text].
27. Roche, R. J., and E. R. Moxon. 1995. Phenotypic variation of carbohydrate surface antigens and the pathogenesis of Haemophilus influenzae infections. Trends Microbiol. 3:304-309[Medline].
28. Saunders, N. J., J. F. Peden, D. W. Hood, and E. R. Moxon. 1998. Simple sequence repeats in the H. pylori genome. Mol. Microbiol. 27:1091-1098[Medline].
29. Simoons-Smit, I. M., B. J. Appelmelk, T. Verboom, R. Negrini, J. L. Penner, G. O. Aspinall, A. P. Moran, S. F. Fei, B. S. Shi, W. Rudnica, and J. de Graaff. 1996. Typing of Helicobacter pylori with monoclonal antibodies against Lewis antigens in lipopolysaccharide. J. Clin. Microbiol. 34:2196-2200[Abstract].
30. Taylor, D. E., D. A. Rasko, R. Sherburne, C. Ho, and L. D. Jewell. 1998. Lack of correlation between Lewis antigen expression by Helicobacter pylori and gastric epithelial cells in infected patients. Gastroenterology 115:1113-1122[Medline].
31. Tomb, J. F., O. White, A. R. Kerlavage, R. A. Clayton, G. G. Sutton, R. D. Fleischman, K. A. Ketchum, H. P. Klenk, S. Gill, B. A. Dougherty, K. Nelson, J. Quackenbush, L. Zhou, E. F. Kirkness, S. Peterson, B. Loftus, D. Richardson, R. Dodson, H. G. Khalak, A. Glodek, K. McKenney, L. M. Fitzgerald, N. Lee, M. D. Adams, E. K. Hickey, D. E. Berg, J. D. Gocayne, T. R. Utterback, J. D. Peterson, J. M. Kelley, M. D. Cotton, J. M. Weidman, C. Fujii, C. Bowman, L. Watthey, E. Wallin, W. S. Hayes, M. Bordovsky, P. D. Karp, H. O. Smith, C. M. Fraser, and C. J. Venter. 1997. The complete genome sequence of the gastric pathogen Helicobacter pylori. Nature 388:539-547[Medline].
32. Trieu-Cuot, P., G. Gerbaud, T. Lambert, and P. Courvalin. 1985. In vivo transfer of genetic information between gram-positive and gram-negative bacteria. EMBO J. 4:3583-3587[Medline].
33. Van Dam, G. J., A. A. Bergwerff, J. E. Thomas-Oates, J. P. Rotmans, J. P. Kamerling, J. F. Vliegenthart, and A. M. Deelder. 1994. The immunologically reactive O-linked polysaccharide chains derived from circulating cathodic antigen isolated from human blood fluke Schistosoma mansoni have Lewis x as repeating unit. Eur. J. Biochem. 225:467-482[Medline].
34. Van Putten, J. P. M., and B. D. Robertson. 1995. Molecular mechanisms and implications for infection of lipopolysaccharide variation in Neisseria. Mol. Microbiol. 16:847-853[Medline].
35. Wang, G., D. A. Rosko, R. Sherburne, and D. E. Taylor. 1999. Molecular genetic basis for the variable expression of Lewis y antigen in Helicobacter pylori: analysis of the alpha (1,2)fucosyltransferase gene. Mol. Microbiol. 31:1265-1274[Medline].
36. Wang, Y., and D. E. Taylor. 1990. Chloramphenicol resistance in Campylobacter coli: nucleotide sequence, expression and cloning vector construction. Gene 94:23-28[Medline].
37. Watkins, W. M., P. Greenwell, A. D. Yates, and P. H. Johnson. 1988. Regulation of expression of carbohydrate blood group antigens. Biochimie 70:1597-1611[Medline].
38. Wirth, H. P., M. Yang, R. M. Peek, Jr., K. T. Tham, and M. J. Blaser. 1997. H. pylori Lewis expression is related to the host phenotype. Gastroenterology 113:1091-1098[Medline].
39. Wirth, H. P., M. Yang, A. Dubois, D. E. Berg, and M. J. Blaser. 1998. Host Lewis phenotype-dependent selection of H. pylori Lewis expression in Rhesus monkeys. Gut 43:A26.
40. Yang, Q. L., and E. C. Gotschlich. 1996. Variations of gonococcal lipopolysaccharide structure is due to alterations in poly-G tracts in lgt genes encoding glycosyltransferases. J. Exp. Med. 183:323-327[Abstract/Free Full Text].

Infection and Immunity, October 1999, p. 5361-5366, Vol. 67, No. 10
0019-9567/99/$04.00+0
Copyright © 1999, American Society for Microbiology. All rights reserved.


This article has been cited by other articles:

  • Giannakis, M., Backhed, H. K., Chen, S. L., Faith, J. J., Wu, M., Guruge, J. L., Engstrand, L., Gordon, J. I. (2009). Response of Gastric Epithelial Progenitors to Helicobacter pylori Isolates Obtained from Swedish Patients with Chronic Atrophic Gastritis. J. Biol. Chem. 284: 30383-30394 [Abstract] [Full Text]  
  • Keenan, J. I., Davis, K. A., Beaugie, C. R., McGovern, J. J., Moran, A. P. (2008). Alterations in Helicobacter pylori outer membrane and outer membrane vesicle-associated lipopolysaccharides under iron-limiting growth conditions. Innate Immunity 14: 279-290 [Abstract]  
  • Skoglund, A., Bjorkholm, B., Nilsson, C., Andersson, A. F., Jernberg, C., Schirwitz, K., Enroth, C., Krabbe, M., Engstrand, L. (2007). Functional Analysis of the M.HpyAIV DNA Methyltransferase of Helicobacter pylori. J. Bacteriol. 189: 8914-8921 [Abstract] [Full Text]  
  • Ma, B., Simala-Grant, J. L., Taylor, D. E. (2006). Fucosylation in prokaryotes and eukaryotes. Glycobiology 16: 158R-184R [Abstract] [Full Text]  
  • Algood, H. M. S., Cover, T. L. (2006). Helicobacter pylori Persistence: an Overview of Interactions between H. pylori and Host Immune Defenses. Clin. Microbiol. Rev. 19: 597-613 [Abstract] [Full Text]  
  • Casadesus, J., Low, D. (2006). Epigenetic Gene Regulation in the Bacterial World. Microbiol. Mol. Biol. Rev. 70: 830-856 [Abstract] [Full Text]  
  • Kusters, J. G., van Vliet, A. H. M., Kuipers, E. J. (2006). Pathogenesis of Helicobacter pylori Infection. Clin. Microbiol. Rev. 19: 449-490 [Abstract] [Full Text]  
  • Wirth, H.-P., Yang, M., Sanabria-Valentin, E., Berg, D. E., Dubois, A., Blaser, M. J. (2006). Host Lewis phenotype-dependent Helicobacter pylori Lewis antigen expression in rhesus monkeys. FASEB J. 20: 1534-1536 [Abstract] [Full Text]  
  • Ma, B., Audette, G. F., Lin, S., Palcic, M. M., Hazes, B., Taylor, D. E. (2006). Purification, Kinetic Characterization, and Mapping of the Minimal Catalytic Domain and the Key Polar Groups of Helicobacter pylori {alpha}-(1,3/1,4)-Fucosyltransferases. J. Biol. Chem. 281: 6385-6394 [Abstract] [Full Text]  
  • Nilsson, C., Skoglund, A., Moran, A. P., Annuk, H., Engstrand, L., Normark, S. (2006). An enzymatic ruler modulates Lewis antigen glycosylation of Helicobacter pylori LPS during persistent infection. Proc. Natl. Acad. Sci. USA 103: 2863-2868 [Abstract] [Full Text]  
  • Ma, B., Lau, L. H., Palcic, M. M., Hazes, B., Taylor, D. E. (2005). A Single Aromatic Amino Acid at the Carboxyl Terminus of Helicobacter pylori {alpha}1,3/4 Fucosyltransferase Determines Substrate Specificity. J. Biol. Chem. 280: 36848-36856 [Abstract] [Full Text]  
  • Khamri, W., Moran, A. P., Worku, M. L., Karim, Q. N., Walker, M. M., Annuk, H., Ferris, J. A., Appelmelk, B. J., Eggleton, P., Reid, K. B. M., Thursz, M. R. (2005). Variations in Helicobacter pylori Lipopolysaccharide To Evade the Innate Immune Component Surfactant Protein D. Infect. Immun. 73: 7677-7686 [Abstract] [Full Text]  
  • Lundin, A., Bjorkholm, B., Kupershmidt, I., Unemo, M., Nilsson, P., Andersson, D. I., Engstrand, L. (2005). Slow Genetic Divergence of Helicobacter pylori Strains during Long-Term Colonization. Infect. Immun. 73: 4818-4822 [Abstract] [Full Text]  
  • Langdon, R., Craig, J. E, Goldrick, M., Houldsworth, R., High, N. J (2005). Analysis of the role of HP0208, a phase-variable open reading frame, and its homologues HP1416 and HP0159 in the biosynthesis of Helicobacter pylori lipopolysaccharide. J Med Microbiol 54: 697-706 [Abstract] [Full Text]  
  • Bergman, M. P., Engering, A., Smits, H. H., van Vliet, S. J., van Bodegraven, A. A., Wirth, H.-P., Kapsenberg, M. L., Vandenbroucke-Grauls, C. M.J.E., van Kooyk, Y., Appelmelk, B. J. (2004). Helicobacter pylori Modulates the T Helper Cell 1/T Helper Cell 2 Balance through Phase-variable Interaction between Lipopolysaccharide and DC-SIGN. JEM 200: 979-990 [Abstract] [Full Text]  
  • van der Woude, M. W., Baumler, A. J. (2004). Phase and Antigenic Variation in Bacteria. Clin. Microbiol. Rev. 17: 581-611 [Abstract] [Full Text]  
  • Eaton, K. A., Logan, S. M., Baker, P. E., Peterson, R. A., Monteiro, M. A., Altman, E. (2004). Helicobacter pylori with a Truncated Lipopolysaccharide O Chain Fails To Induce Gastritis in SCID Mice Injected with Splenocytes from Wild-Type C57BL/6J Mice. Infect. Immun. 72: 3925-3931 [Abstract] [Full Text]  
  • Salaun, L., Linz, B., Suerbaum, S., Saunders, N. J. (2004). The diversity within an expanded and redefined repertoire of phase-variable genes in Helicobacter pylori. Microbiology 150: 817-830 [Abstract] [Full Text]  
  • Maki, M., Renkonen, R. (2004). Biosynthesis of 6-deoxyhexose glycans in bacteria. Glycobiology 14: 1R-15R [Abstract] [Full Text]  
  • Chisholm, S. A., Owen, R. J. (2004). Frameshift mutations in frxA occur frequently and do not provide a reliable marker for metronidazole resistance in UK isolates of Helicobacter pylori. J Med Microbiol 53: 135-140 [Abstract] [Full Text]  
  • Ma, B., Wang, G., Palcic, M. M., Hazes, B., Taylor, D. E. (2003). C-terminal Amino Acids of Helicobacter pylori{alpha}1,3/4 Fucosyltransferases Determine Type I and Type II Transfer. J. Biol. Chem. 278: 21893-21900 [Abstract] [Full Text]  
  • Mahdavi, J., Boren, T., Vandenbroucke-Grauls, C., Appelmelk, B. J. (2003). Limited Role of Lipopolysaccharide Lewis Antigens in Adherence of Helicobacter pylori to the Human Gastric Epithelium. Infect. Immun. 71: 2876-2880 [Abstract] [Full Text]  
  • Boneca, I. G., Reuse, H. d., Epinat, J.-C., Pupin, M., Labigne, A., Moszer, I. (2003). A revised annotation and comparative analysis of Helicobacter pylori genomes. Nucleic Acids Res 31: 1704-1714 [Abstract] [Full Text]  
  • de Vries, N., Duinsbergen, D., Kuipers, E. J., Pot, R. G. J., Wiesenekker, P., Penn, C. W., van Vliet, A. H. M., Vandenbroucke-Grauls, C. M. J. E., Kusters, J. G. (2002). Transcriptional Phase Variation of a Type III Restriction-Modification System in Helicobacter pylori. J. Bacteriol. 184: 6615-6623 [Abstract] [Full Text]  
  • Xu, Q., Morgan, R. D., Roberts, R. J., Xu, S. Y., van Doorn, L. J., Donahue, J. P., Miller, G. G., Blaser, M. J. (2002). Functional analysis of iceA1, a CATG-recognizing restriction endonuclease gene in Helicobacter pylori. Nucleic Acids Res 30: 3839-3847 [Abstract] [Full Text]  
  • Takata, T., El-Omar, E., Camorlinga, M., Thompson, S. A., Minohara, Y., Ernst, P. B., Blaser, M. J. (2002). Helicobacter pylori Does Not Require Lewis X or Lewis Y Expression To Colonize C3H/HeJ mice. Infect. Immun. 70: 3073-3079 [Abstract] [Full Text]  
  • Webb, G. F., Blaser, M. J. (2002). Dynamics of bacterial phenotype selection in a colonized host. Proc. Natl. Acad. Sci. USA 10.1073/pnas.042685799v1 [Abstract] [Full Text]  
  • Moran, A. P., Knirel, Y. A., Senchenkova, S.'y. N., Widmalm, G., Hynes, S. O., Jansson, P.-E. (2002). Phenotypic Variation in Molecular Mimicry between Helicobacter pylori Lipopolysaccharides and Human Gastric Epithelial Cell Surface Glycoforms. ACID-INDUCED PHASE VARIATION IN LEWISX AND LEWISY EXPRESSION BY H. PYLORI LIPOPOLYSACCHARIDES. J. Biol. Chem. 277: 5785-5795 [Abstract] [Full Text]  
  • Tannas, T., Dekker, N., Bukholm, G., Bijlsma, J. J. E., Appelmelk, B. J. (2001). Phase Variation in the Helicobacter pylori Phospholipase A Gene and Its Role in Acid Adaptation. Infect. Immun. 69: 7334-7340 [Abstract] [Full Text]  
  • Snyder, L. A. S., Butcher, S. A., Saunders, N. J. (2001). Comparative whole-genome analyses reveal over 100 putative phase-variable genes in the pathogenic Neisseria spp.. Microbiology 147: 2321-2332 [Abstract] [Full Text]  
  • Kawahara, T., Teshima, S., Oka, A., Sugiyama, T., Kishi, K., Rokutan, K. (2001). Type I Helicobacter pylori Lipopolysaccharide Stimulates Toll-Like Receptor 4 and Activates Mitogen Oxidase 1 in Gastric Pit Cells. Infect. Immun. 69: 4382-4389 [Abstract] [Full Text]  
  • Suda, Y., Kim, Y.-M., Ogawa, T., Yasui, N., Hasegawa, Y., Kashihara, W., Shimoyama, T., Aoyama, K., Nagata, K., Tamura, T., Kusumoto, S. (2001). Chemical structure and biological activity of a lipid A component from Helicobacter pylori strain 206. Innate Immunity 7: 95-104 [Abstract]  
  • Sebbane, F., Devalckenaere, A., Foulon, J., Carniel, E., Simonet, M. (2001). Silencing and Reactivation of Urease in Yersinia pestis Is Determined by One G Residue at a Specific Position in the ureD Gene. Infect. Immun. 69: 170-176 [Abstract] [Full Text]  
  • Appelmelk, B. J., Martino, M. C., Veenhof, E., Monteiro, M. A., Maaskant, J. J., Negrini, R., Lindh, F., Perry, M., Del Giudice, G., Vandenbroucke-Grauls, C. M. J. E. (2000). Phase Variation in H Type I and Lewis a Epitopes of Helicobacter pylori Lipopolysaccharide. Infect. Immun. 68: 5928-5932 [Abstract] [Full Text]  
  • Josenhans, C., Eaton, K. A., Thevenot, T., Suerbaum, S. (2000). Switching of Flagellar Motility in Helicobacter pylori by Reversible Length Variation of a Short Homopolymeric Sequence Repeat in fliP, a Gene Encoding a Basal Body Protein. Infect. Immun. 68: 4598-4603 [Abstract] [Full Text]  
  • Karlsson, K.-A. (2000). The human gastric colonizer Helicobacter pylori: a challenge for host-parasite glycobiology. Glycobiology 10: 761-771 [Abstract] [Full Text]  
  • Alm, R. A., Bina, J., Andrews, B. M., Doig, P., Hancock, R. E. W., Trust, T. J. (2000). Comparative Genomics of Helicobacter pylori: Analysis of the Outer Membrane Protein Families. Infect. Immun. 68: 4155-4168 [Abstract] [Full Text]  
  • APPELMELK, B J, VANDENBROUCKE-GRAULS, C M J E (2000). H pylori and Lewis antigens. Gut 47: 10-11 [Full Text]  
  • Beier, D., Frank, R. (2000). Molecular Characterization of Two-Component Systems of Helicobacter pylori. J. Bacteriol. 182: 2068-2076 [Abstract] [Full Text]  
  • Webb, G. F., Blaser, M. J. (2002). Dynamics of bacterial phenotype selection in a colonized host. Proc. Natl. Acad. Sci. USA 99: 3135-3140 [Abstract] [Full Text]  

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow An erratum has been published
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowReprints and Permissions
Right arrow Copyright Information
Right arrow Books from ASM Press
Right arrow MicrobeWorld
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Appelmelk, B. J.
Right arrow Articles by Kusters, J. G.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Appelmelk, B. J.
Right arrow Articles by Kusters, J. G.

Copyright © 2009 by the American Society for Microbiology.   For an alternate route to Journals.ASM.org, visit: http://intl-journals.asm.org | More Info»