Department of Microbiology and Immunology,
Chandler Medical Center, University of Kentucky, Lexington,
Kentucky 40536-0084
Received 18 February 1999/Returned for modification 2 April
1999/Accepted 6 July 1999
 |
INTRODUCTION |
Pathogenic members of the
Yersinia genus include the etiologic agent of plague,
Y. pestis, and the enteropathogenic species Y. pseudotuberculosis and Y. enterocolitica. The ability
of these facultative intracellular pathogens to cause disease in
mammalian hosts is conferred, in part, by components of the
coordinately regulated low-Ca2+ response stimulon (LCR)
encoded on a common 70-kb virulence plasmid. The virulence of Y. pestis is enhanced by two additional, unique plasmids, pMT1
(encoding murine toxin and capsular fraction 1 protein) and pPCP1
(encoding the plasminogen activator serine protease Pla). The
proteinaceous capsule enhances resistance to phagocytosis by monocytes
(6), while Pla is an outer membrane protease (66)
that is required for full virulence from peripheral infectious routes
(4). LCR components encoded on the conserved plasmid (pCD1
in Y. pestis) include a set of secreted antihost proteins
termed Yops and V antigen (LcrV) and a specialized apparatus for the
secretion and deployment of these proteins during infection. LcrV and
most Yops are absolutely essential for virulence in a mouse model
(reviewed in references 9, and
44), and the yersiniae employ an elegant mechanism
which links expression of these proteins to their subsequent secretion
and delivery to respective host targets.
The LCR is thermally regulated by the transcriptional activator LcrF
(28), with maximal expression possible at 37°C. Maximal induction of Yops and LcrV, however, can occur only when bacteria are
activated for secretion of these proteins by cultivation in contact
with eukaryotic cells (10) or in a
Ca2+-deficient medium (9, 44, 70, 80),
reflecting an intimate link between regulation of the LCR and the
ability to secrete proteins. Secretion occurs via a type III mechanism
and is mediated by a Yop secretion apparatus (Ysc) consisting of at
least 22 gene products (reviewed in references 9 and
44). Numerous studies demonstrated that Y. pestis ysc strains could not be fully induced at 37°C, and it
was subsequently surmised that the Ysc mediates secretion of a negative
regulator. In a currently accepted model, Ysc secretion channels remain
blocked in the presence of Ca2+ or in the absence of cell
contact by at least three regulatory proteins. Blockage mediated by
LcrE (also called YopN) (15) and TyeA (24) at the
outer surface and by LcrG (43) at the inner surface enforces
a negative feedback mechanism by causing retention of the secretable
negative regulator LcrQ (49, 54, 68) and an accessory
protein, YopD (77). Under conditions that relieve the Ysc
secretion block, LcrQ is purged from the bacteria, resulting in
derepression of Yops and LcrV expression and secretion.
Yops and LcrV lack cleavable signal sequences and are secreted without
processing by the Ysc (10, 33). Work by Anderson and
Schneewind (1) demonstrated that YopE and YopN (LcrE)
secretion can be mediated by a signal contained within their respective mRNAs. In addition, specific Yop chaperones (Sycs) have been identified for some Yops. These are necessary for the secretion of their respective Yops (75) and may function by donating the Yop to the secretion machinery (7). Whether this theme applies to all Yops remains unclear. LcrV has not been systematically mapped for
secretion determinants, and no Syc has been identified for it. However,
LcrV does bind to the cytoplasmic Ysc gate protein LcrG
(43). During contact-induced release, at least six
Yops (YopE, YopT, YopH, YpkA, YopM, and YopJ) are targeted, without being released into the surrounding medium, into the cytoplasm of
associated eukaryotic cells, where they function as direct antihost
effectors. Several of these effector Yops are susceptible to the
Y. pestis-specific Pla protease and do not accumulate on the
surface of the bacteria (44). Targeting of the secreted effector Yops across the eukaryotic plasma membrane is accomplished by
at least three additional Yops (YopB, YopD, and YopK) and LcrV. YopK
influences the size (22) of the YopB-containing pore which inserts into the eukaryotic membrane. Although both YopD and LcrV are
required for targeting, their precise roles are unclear. YopD has been
shown to bind several Yops, including YopB (40), and LcrV
may be required for YopB to reach the plasma membrane and form a pore.
Yop targeting has been characterized mainly for the enteropathogenic
yersiniae, but it is clear that Y. pestis, which has an
essentially identical set of LCR genes (9, 46), targets Yops
into eukaryotic cells in a similar, contact-activated manner (see,
e.g., references 13, 41, and 63).
The specific adhesin(s) that functions to promote contact has not been
identified, but the resulting attachment lasts at least 4 h.
Importantly, the Pla protease, unique to Y. pestis, has not
been found to prevent Yop targeting (63), although it can
degrade surface-exposed Yops (67). Once targeted, three
effector Yops disrupt host cell signaling by interfering with
intracellular cascades (YopJ) (57, 58), dephosphorylating
focal adhesion components (YopH) (2, 47), and
phosphorylating unidentified host proteins (YpkA) (18). YopE
(55, 56) and YopT (23) cause disruption of actin
microfilaments. The activities of YopE, YopT, and YopH can be directly
visualized as the rounding-up or cytotoxic phenotype of infected
eukaryotic cells (10). The intracellular role of YopM is
unidentified, but the protein does localize to the nuclei of infected
cells (63).
V antigen has been associated with full virulence of Y. pestis for decades (5, 52). LcrV is a 327-residue
soluble protein (53) whose only known homolog is PcrV of
Pseudomonas aeruginosa (78). Unlike most Yops,
LcrV is relatively resistant to the Pla protease (69).
Evidence that implicates LcrV as a multifunctional protein has
accumulated. Within Y. pestis, LcrV is required for induction of the LCR (52, 65), and this activity is
manifested by the noted ability of LcrV to associate with
cytoplasmic LcrG (43) and titrate the LcrG-mediated
inner Ysc secretion block (41). Nilles et al.
(41) and Sarker et al. (60) have also reported
that LcrV functions in Yop targeting through an effect on YopB.
This requirement was demonstrated in the absence of LcrG, thereby
separating LcrV's function in LCR induction from that in targeting of
Yops (41).
The observation that LcrV-specific antibodies confer resistance to
experimental plague (3, 73, 74) prompted the hypothesis that
LcrV also promotes virulence outside the bacteria, and it has been
proposed that LcrV acts directly to compromise innate host immune
responses. In support of this idea, an LcrV-containing fusion protein
(in the absence of yersiniae) was shown to prevent production of the
proinflammatory cytokines tumor necrosis factor alpha and gamma
interferon in mice (37). This immunosuppressive effect was
not limited to Yersinia infections, since exogenous LcrV
exacerbated heterologous infections of mice with Listeria monocytogenes or Salmonella typhimurium
(37). Nedialkov et al. (38) have proposed that
this effect arises from the ability of LcrV to upregulate the
negatively acting cytokine interleukin-10. Interestingly, others have
shown that LcrV inhibits chemotaxis of neutrophils (76).
This complex array of functions has made the elucidation of LcrV's
mechanisms of action during infection difficult. It is likely that
different domains of LcrV are required for its various functions.
Genetic analysis indicated that residues 224 to 266 are required for
binding to LcrG (60), and a protective epitope lies between
residues 176 and 276 (21, 35). The N terminus of LcrV is
dispensable for the immunosuppressive activity, because the fusion
protein used by Nakajima et al. (37) lacked residues 1 to 67 of LcrV. However, the first 125 residues likely are important for
secretion of LcrV (65). How LcrV carries out its multiple functions remains obscure, and its molecular targets are unknown.
This study focuses on LcrV's functions in Yop targeting and virulence.
We found that both the N and C termini of LcrV are required for its
role in Yop targeting but that the N terminus was dispensable for
LcrV's role in activation of the Ysc for Yop secretion. LcrV localized
to the surface of non-contact-activated Yersinia, but
the truncated versions did not, suggesting the hypothesis that
LcrV may exist on the bacterial surface in a pretargeting complex.
However, LcrV-specific antibody did not prevent Yop targeting, suggesting that antibody can be protective against plague
without blocking the delivery of Yops.
 |
MATERIALS AND METHODS |
Bacterial strains, eukaryotic cell lines, and growth
conditions.
The strains and plasmids used in this study are listed
in Table 1. This study employed the human
HeLa epithelium-derived cell line. Unless otherwise noted,
Escherichia coli strains were cultivated in Luria-Bertani
medium (34) at 37°C or on Luria-Bertani agar. Y. pestis strains were grown in the defined medium TMH
(70) as described for physiological studies. Briefly,
Y. pestis cultures were cultivated with shaking at 200 rpm
overnight at 26°C for about eight generations. Cultures were diluted
into fresh 26°C TMH to an optical density at 620 nm
(OD620) of 0.1, initially incubated at 26°C, and shifted
to 37°C when cultures had reached an OD620 of ca. 0.2. Cultures then were harvested 6 h after the shift to 37°C. For
infection of eukaryotic cell lines, Y. pestis was grown in
heart infusion broth (HIB) (Difco Laboratories, Detroit, Mich.) at
26°C for at least six generations in exponential phase. During
construction of the
lcrG3 strain, Y. pestis
was cultivated on tryptose blood agar (Difco) supplemented with
chlorotetracycline HCl (Sigma) and fusaric acid (32), as
described by Nilles et al. (41). When appropriate, bacteria
were grown in the presence of antibiotics, which were used at 15 µg/ml for tetracycline, 25 µg/ml for chloramphenicol, 50 µg/ml
for kanamycin, or 100 µg/ml for ampicillin and streptomycin (Sigma,
St. Louis, Mo.). The HeLa cell line was maintained in RPMI (GIBCO-BRL,
Grand Island, N.Y.) supplemented with 10% (vol/vol) heat-inactivated
fetal bovine serum (FBS) (GIBCO-BRL) at 37°C, with CO2
maintained at 5%. During experiments to determine the partitioning of
LcrV and Yops within cultures of infected HeLa cells, infection was
done in RPMI lacking FBS. When arabinose induction was required,
infection was done in Leibovitz's L15 medium (L15) (GIBCO-BRL) lacking
FBS.
DNA methods.
Template DNA was isolated with midi-prep or
spin-prep columns from Qiagen, Inc. (Studio City, Calif.), and cloning
procedures were performed essentially as described previously
(31). Amplification of specific DNA was achieved by PCR in a
Perkin-Elmer Cetus (Foster City, Calif.) GeneAmp model 2400 thermocycler with Pfu (Stratagene, La Jolla, Calif.) or Vent
(New England Biolabs, Beverly, Mass.) DNA polymerase and
oligonucleotide primers synthesized by Genosys Biotechnologies (The
Woodlands, Tex.) or the Macromolecular Structure Analysis Facility
(University of Kentucky). Typical PCR conditions included a 5-min
preincubation at 94°C followed by 30 amplification cycles.
Denaturation, annealing, and extension were done at 94, 55, and 72°C,
respectively, for 15 to 30 s each. Restriction fragments excised
from agarose gels and PCR products were purified by using a Qiaquick
gel extraction or DNA purification kit (Qiagen), respectively. Transformation of E. coli was achieved by the
CaCl2 method (31) or the frozen-storage-based
protocol as described previously (19), and that of Y. pestis was achieved by electroporation as described by Perry et
al. (45). Double-stranded DNA from pHT-V was sequenced by
the method of Sanger et al. (59) with the Sequenase version 2.0 kit (United States Biochemical Corp., Cleveland, Ohio) and
-35S-dATP (NEN Research Products, Boston, Mass.).
Plasmid construction.
The plasmids pHT-V (encoding
N-terminally histidine-tagged LcrV) and pHT-VN68 (encoding N-terminally
histidine-tagged, N-terminally truncated LcrV) were constructed by
insertion of portions of lcrV (PCR amplified with
Pfu polymerase) into the expression plasmid pPROEX-1. For
pHT-V, lcrV was amplified from pES6-1 DNA. The 5' end of the
sense primer (5'-TATATAGGCGCCATGATTAGAGCCTACGAACAAAACCC-3') was a non-Yersinia-encoded sequence containing a
NarI restriction site; the antisense primer
(5'-CCCCCTCCTTTTAGG-3') annealed immediately downstream of
lcrV. PCR products were 5' end phosphorylated with T4
polynucleotide kinase (Promega, Madison, Wis.) and then digested with
NarI. The resulting DNA was ligated into NarI-
and StuI-cut pProEX-1 and transformed into E. coli DH5
. PCR fidelity was verified by sequencing the cloned
lcrV. pHT-VN68 was derived from pHT-'V2, in which the
encoded 'LcrV lacks the first 67 amino acids of LcrV. A sense primer
(5'-ACGATATCCCAACGACCG-3') complementary to pPROEX-1 DNA and
an antisense primer (5'-CCCCCTCCTTTTAGG-3') positioned 68 nucleotides (nt) into lcrH (also called sycD)
were used to amplify only 'lcrV and the polyhistidine
tag-coding region. The PCR product was digested with KasI
and 5' end phosphorylated with T4 kinase. Treated fragments were
ligated into KasI- and StuI-digested pProEX-1 and
used to transform E. coli DH5
. The resulting leader sequences fused to LcrV and VN68 were similar (HT-V,
MGHHHHHHDYDIPTTENLY FQGA; HT-VN68, MGHHHHHHDYDIPTTENLYFQGAHMGIQR).
pE15VN68 (encoding YopE [amino acids 1 to 15] fused to N-terminally
truncated LcrV) was generated by fusing the mRNA secretion signal
sequence described by Anderson and Schneewind (1) to a
5'-truncated lcrV. The secretion signal contained within the yopE promoter and first 15 codons was amplified by PCR with
Vent DNA polymerase, a sense primer
(5'-AAGAATTCTCCTAATAGTTAGATAAAATATCAAC-3') containing an
EcoRI site at the 5' end (not used in this construct), and
an antisense primer (5'-TAACCCGGGTGCCGGCAGGGG-3') possessing a SmaI site positioned in frame with the yopE
coding sequence. The 237-nt product extended from position
187
upstream of yopE to position +45 within yopE. The
PCR product was treated with SmaI and used to replace DNA
removed from pTrcV by EcoRV digestion. Treatment of pTrcV
with EcoRV removed the 5' end of lcrV (encoding the first 67 amino acids) and upstream pTrc99A vector sequence including a portion of lacIq and the entire
trc promoter. Ligation products were used to transform E. coli XL1-Blue. The PCR insert was oriented so that
yopE and lcrV sequences were translationally
fused but separated by one proline codon derived from the
SmaI restriction site.
Both pTrcV (encoding LcrV) and pVC216 (encoding LcrV C-terminally
truncated after residue 216) were derived from pES6-1. pTrcV was
constructed by restriction digestion of pES6-1 with BbvI
(within the 3' end of lcrG) and NcoI (within
lcrH) followed by treatment of the
lcrV-containing DNA with mung bean exonuclease (New
England Biolabs). The fragment was then purified, ligated into
SmaI-cut pTrc99A and used to transform E. coli
DH5
. pVC216 was derived by PCR amplification of lcrV with
Pfu polymerase and sense
(5'-TATATAGGCGCCATGATTAGAGCCTACGAACAAAACCC-3') and
antisense (5'-TTAGAGAATTTTGTACTCTGCGC-3') primers. The
product, containing nt 1 to 648 of lcrV (encoding amino
acids 1 to 216), was purified, ligated into SmaI-digested
pTrc99A, and used to transform E. coli XL1-Blue. In both
constructs, lcrV was oriented such that expression was
driven by the inducible trc promoter.
pMN
lcrG3 carries a PCR-amplified insert beginning in
lcrD (1,060 bp upstream of the lcrG start),
incorporating a deletion of codons 6 to 86 of lcrG, and
ending past the lcrH start (1,305 bp downstream of the
lcrG start). The construction included the introduction of a
stop codon (TAA) at codon 6 of lcrG to ensure that no
peptide longer than 5 amino acids would be made from lcrG. The insert for the final clone was generated in two pieces by PCR
amplification of upstream flanking DNA by using primers
lcrG-US (5' CGCGGATCCGCTATCTGCTCGAACAGA 3')
and lcrG1-5KPN (5'
CGGGGTACCTTAATGGGAAGACTTCATAATCTA 3') and of downstream flanking
DNA by using
G3-KPN (5' CGGGGTACCCCAACGATGATGCGAGGGCAA 3')
and
lcrG-DSII (5' GATATCAGTGTCTGTCGTCTCTTG
3'). The upstream fragment was digested sequentially with
BamHI and KpnI, while the downstream fragment was
digested with KpnI. Purified, digested fragments were
combined, ligated into BamHI- and
SmaI-digested pLD55, and used to transform E. coli DH5
(
pir). In the resulting fusion junction
(5' ... TCC CAT TAA GGT ACC CCA GCG ... 3')
the stop at position 6 (TAA) was followed by codons for
glycine and threonine not contained in lcrG and then by
codons 87 to 95 of lcrG.
Strain construction.
Y. pestis strains lacking the
plasminogen activator protease (Pla) were created by curing strains of
the encoding plasmid pPCP1. Y. pestis KIM5-3241 and
KIM5-3001.12 were transformed with a plasmid, pOS50 (a gift of J. Goguen, University of Massachusetts, Worcester), containing pPCP1's
origin of replication. Transformants were transferred on tryptose blood
agar containing tetracycline to allow curing of pPCP1 via competition
with pOS50. Potential plasmid-cured strains were screened for the loss
of pPCP1 by analysis of plasmid DNA as previously described
(25) and for the lack of plaminogen activator activity by
assaying for activation of thrombin-mediated cleavage of fibrin film as
previously described (71). Strains cured in this way then
retained the pOS50 plasmid. Y. pestis KIM8-3002.7
(
lcrG3) was created by allelic exchange of the parent
lcrG on pCD1 with the
lcrG3 allele carried on
pMN
lcrG3. Introduction of pMN
lcrG3 into
Y. pestis, selection for crossover events, and screens for
successful replacements were done as described previously
(41). For physiological studies characterizing the phenotype
of Y. pestis KIM8-3002.7, bacteria were cultivated in TMH as
described above (70), and the cultures were separated into
whole cells and cell-free culture supernatants as done previously (41).
Antibody preparations.
LcrV-specific antibodies (
-HTV)
were raised against purified HT-V in female New Zealand White rabbits
as previously described (50). A nonspecific, irrelevant
antibody pool (
-NS) was prepared from rabbit preimmune serum
harvested prior to hyperimmunization with HT-V.
-Yersinia
was a preparation of polyclonal rabbit antibodies that had been raised
against whole cells of Y. pestis KIM6 grown at 26°C in HIB
and partially purified by ammonium sulfate precipitation. In one set of
experiments YopM-specific rabbit polyclonal antibody (
-YopM)
(39) was used as an irrelevant antibody control. All antibodies other than
-Yersinia were purified from serum
by using an Econo Pac protein A cartridge (Bio-Rad Laboratories,
Hercules, Calif.) and subsequently dialyzed into phosphate-buffered
saline (PBS) (135 mM NaCl, 2.7 mM KCl, 10 mM
Na2HPO4, 1.8 mM KH2PO4, pH7.4) as described previously (39). For some experiments,
-HTV or
-NS was dialyzed into buffer containing 100 mM sodium
acetate (pH 5.5) and used to generate antibody Fab fragments.
Antibodies were digested with papain as described previously
(20) for 18 h, and Fab fragments were purified by
collecting flowthrough fractions from a protein A cartridge. Fab
preparations were dialyzed into PBS and concentrated by centrifugation
in a Centricon 30 concentrator (Amicon, Inc., Beverly, Mass.), and the
protein content was quantitated by the bicinchoninic acid assay (Pierce
Chemical, Rockford, Ill.). When resolved by sodium dodecyl
sulfate-polyacrylamide gel electrophoresis (SDS-PAGE) and visualized by
immunoblot analysis, Fab fragments were of predicted sizes, and when
used as primary antibodies in immunoblots, they were able to detect
LcrV (data not shown).
-HTV was absorbed twice with nonspecific
antigens for use in immunostaining of samples to be analyzed by
confocal microscopy. Briefly, spleens were excised from female BALB/c
mice (Harlan Sprague-Dawley, Indianapolis, Ind.), minced, and extracted
with ice-cold acetone. Five hundred micrograms of precipitated, dried
material was combined with 500 µl of
-HTV in the presence of a
protease inhibitor cocktail (Pefabloc, leupeptin, and aprotinin at 20 µg/ml each; all from Boehringer Mannheim Corp., Indianapolis, Ind.)
and incubated overnight on ice. Solid material was then pelleted at
4°C by centrifugation at 20,800 × g and discarded.
Passive immunization of mice with
-HTV.
Female BALB/c
mice (7 to 8 weeks old) were passively immunized with 500 µg of
-HTV or with 333 µg of
-NS Fab fragments as a negative control.
There were four mice per group in one experiment and five per group in
a repetition. Single antibody doses were given intraperitoneally in
100- to 250-µl volumes of PBS. Forty-eight hours after passive
immunization, mice were challenged with a lethal dose of Y. pestis KIM5-3001. Bacteria were diluted into PBS and injected
intravenously into the retro-orbital sinus, and mice were observed for
14 days postinfection. The actual infecting doses were determined by
enumerating CFU from samples of the doses given to the mice. These were
746 CFU in one experiment and 215 in a replicate experiment.
Infection assays.
Prior to infection, eukaryotic cells were
subcultured into six-well 35-mm-diameter tissue culture plates in RPMI
with 10% (vol/vol) FBS and incubated at 37°C with 5%
CO2 for roughly 72 h or to a density of 5 × 105 to 8 × 105 per well. Cells were
washed twice with RPMI or L15 medium lacking FBS immediately prior to
infection. Bacteria were cultivated at 26°C in HIB and harvested at
an OD620 of ca. 1.0. Arabinose or isopropyl-
-D-thiogalactopyranoside (IPTG) was added to
0.2% or 0.1 mM, respectively, at 30 to 60 min prior to harvest for
strains harboring constructs with inducible promoters. Harvested
bacteria were diluted directly into 37°C L15 or RPMI lacking FBS
(containing arabinose or IPTG where appropriate) and transferred to
duplicate wells containing eukaryotic cells. Bacteria were added at a
10-fold excess per well over the number of eukaryotic cells (nominal
multiplicity of infection [MOI] = 10). The plates were then
centrifuged at 200 × g for 5 min to achieve contact
between bacteria and target cells and incubated at 37°C with 5%
CO2 (for RPMI) or at 37°C (for L15) for 4 h. After
infection, one replicate well per infecting bacterial strain was
treated for 5 min at 37°C (5% CO2) with trypsin (100 µg/ml in RPMI or L15), and the trypsin treatment was terminated by
addition of the protease inhibitor cocktail described above. The
contents of the wells were subsequently harvested and fractionated following lysis of the HeLa cells in ice-cold water containing protease
inhibitors at 2 µg/ml, essentially as described previously (13,
41). Three fractions were collected: (i) large cellular debris
plus yersiniae recovered by centrifugation at 20,800 × g, (ii) proteins precipitated with 10% (wt/vol) trichloroacetic acid (TCA) from filtered media, and (iii) TCA-precipitated soluble proteins released by water lysis plus small organelles not removed by
centrifugation at 20,800 × g. The fractions were
solubilized in electrophoresis sample buffer containing 2.3% (wt/vol)
SDS, 5% (vol/vol)
-mercaptoethanol, 60 mM Tris (pH 6.8), and 25%
(vol/vol) glycerol.
Infection assays were also carried out in the presence of LcrV-specific
antibodies. For these experiments, we estimated the amount of LcrV in a
typical infection assay. Briefly, one well of HeLa cells infected with
Y. pestis KIM8-3002 for 4 h was harvested, and total
proteins in the culture were TCA precipitated and solubilized in
electrophoresis buffer. We estimated that the concentration of LcrV was
ca. 20 ng/ml, or 0.53 nM, by comparing immunoblots of serially diluted
samples to immunoblots of serial dilutions of a known concentration of
HT-V. This value was used to estimate fold excesses of LcrV-specific
antibodies in neutralization experiments. HeLa cells and Y. pestis KIM8-3002 were cultivated as described above. In one set of
experiments, full-length
-HTV or
-YopM was added at 175 µg/ml
to yersiniae that had been grown at 26°C and diluted into 37°C
RPMI, and this suspension was layered onto washed HeLa cells without
centrifugation. The antibody was present at an estimated 2,000-fold
molar excess over the total amount of LcrV that typically is produced
in each infected well (4,000-fold molar excess of antigen-binding
sites). The slower initiation of infection without centrifugation was
used to allow the antibody time to interact with both bacteria and HeLa
cells. In a variation of this protocol,
-NS was added to HeLa cells
at 500 µg/ml to block any Fc receptors. After 30 min, the cells were
washed and overlayered with yersiniae in the presence of
-HTV or
-YopM at 175 µg/ml and
-NS, also at 175 µg/ml. At various
times after infection, the cultures were observed by phase-contrast
microscopy for cytotoxicity (retraction and rounding up). After 3 h of infection, they were photographed through a green filter with
Kodak ASA100 black-and-white film.
In a second type of experiment, bacteria were diluted into 37°C RPMI
containing
-HTV Fab fragments at 26.6 µg/ml and incubated for 10 min prior to addition to the HeLa monolayer. This concentration was an
estimated 1,000-fold molar excess over the amount of LcrV present in
each well. Infection of monolayers by centrifugation and harvesting of
samples were performed as described above. To assess antibody
neutralization of LcrV in culture supernatants, we immunoprecipitated
LcrV-Fab complexes from the medium fraction of a replicate infected
culture as follows. The medium was removed, passed through a
0.2-µm-pore-size filter, and combined with a twofold molar excess of
donkey anti-rabbit whole-molecule immunoglobulin G (IgG) (Accurate
Chemical and Scientific Corp., Westbury, N.Y.) bound to protein
A-Sepharose beads (Sigma). The slurry was mixed for 2 h at room
temperature. Beads were subsequently pelleted and washed multiple times
with PBS. Void and flowthrough fractions were combined, and proteins
were precipitated by overnight treatment with TCA at a 10% (wt/vol)
final concentration. Beads and pelleted precipitated proteins were
suspended in equal volumes of electrophoresis sample buffer to
solubilize proteins.
In a third protocol, the yersiniae were preincubated at 37°C without
HeLa cells to allow surface expression of LcrV. For this treatment,
they were washed once with PBS, diluted to give an MOI of 10, dispensed
at 2 ml/well in six-well dishes, and centrifuged onto the wells for 5 min at 200 × g. The dishes were incubated for 1.5 h at 37°C with 5% CO2. They were then resuspended in
each well, and 350 µg of
-HTV, 350 µg of
-YopM (as an
irrelevant antibody treatment), or a corresponding volume (ca. 0.2 ml)
of PBS was added to each well, and the dishes were incubated for 30 min
at 37°C with CO2 to allow the
-HTV antibody (present
at 175 µg/ml) time to bind to LcrV on the bacterial surface. The bacteria were then resuspended and used to infect HeLa cells. Prior to
infection, the HeLa cells had been washed once with PBS and incubated
for 30 min at 37°C with 5% CO2 in RPMI containing 1%
(vol/vol) mouse serum (MS) (Sigma) to block any Fc receptors. This
medium was removed, 2 ml of bacterial suspension containing antibody or
PBS was added, and the infection was initiated by centrifugation as
described earlier. One set of wells was photographed as described above
at hourly intervals for 4 h. Duplicate pairs of wells were
harvested and fractionated as described above for immunoblot analysis
after 4 h of infection. In a repetition of this experiment, the
bacterial MOI was reduced to 2, and the concentration of blocking
antibody was correspondingly reduced fivefold to 35 µg/ml. In both
experiments, the ratio of antigen-binding sites on
-HTV to LcrV was
ca. 4,000.
Protein electrophoresis and immunoblot analysis.
Proteins
from fractionated bacterial cultures and from infection assays were
resolved in polyacrylamide gels (12% [wt/vol] acrylamide) by
SDS-PAGE (27). Samples were loaded so that lanes containing
different culture fractions represented equivalent volumes of the
original cultures. Resolved proteins were transferred to Immobilon-P
(Millipore, Corp., Bedford, Mass.) in carbonate buffer (pH 9.9)
(64) when LcrG was analyzed or in Tris-glycine (72) in all other cases. Specific proteins were detected by using polyclonal antibodies specific for His-tagged LcrV (
-HTV), His-tagged YopD (
-YopD) (76), His-tagged YopE (
-YopE)
(a gift of G. Plano, University of Miami) or glutathione
S-transferase (GST)-tagged LcrG (
-GST-G) (43).
Alkaline phosphatase or horseradish peroxidase-conjugated goat
anti-rabbit IgG (Sigma) was used to visualize proteins by development
with nitroblue tetrazolium-5-bromo-4-chloro-3-indolylphosphate (NBT-BCIP) (GIBCO-BRL) or enhanced chemiluminescence (ECL) substrate (Pierce), respectively.
Confocal analysis.
Bacteria were tested for surface
localization of LcrV by cultivating Yersinia strains at
26°C in HIB as done in infection assays to an OD620 of
ca. 1.0. Bacteria were diluted into 37°C RPMI lacking FBS (containing
0.1 mM IPTG where appropriate) to a density of 106/ml, and
1.0-ml aliquots were centrifuged at 200 × g for 5 min onto 13-mm-diameter glass coverslips, each bearing ca. 105
HeLa cells, in 24-well cluster dishes (Costar, Cambridge, Mass.). After
incubation for 2 h at 37°C with 5% CO2, wells were
washed once with 1.0-ml volumes of Hanks balanced salt solution
(GIBCO-BRL) and subsequently treated with 2% (wt/vol) paraformaldehyde
(Sigma) in PBS (pH 7.4) for 30 min. Fixed bacteria were blocked for
1 h at room temperature with 10% (vol/vol) FBS plus 1% MS in PBS and then washed and incubated for 1 h in PBS plus 1% (vol/vol) MS
with
-HTV,
-YopE, or
-Yersinia. Samples were then
washed with PBS and incubated for 1 h with anti-rabbit IgG
antibodies coupled to the fluorochrome Oregon green (Molecular Probes,
Eugene, Oreg.). After staining, coverslips were mounted by using
SlowFade mounting medium (Molecular Probes) and analyzed by using
laser-scanning confocal microscopy. Specimens were visualized by
differential interference contrast with a Leica DM IRB/E inverted
microscope with Nomarski optics and a 100× objective. Fluorescence
images were derived from a single 0.5-µm-thick optical plane with the Leica TCS NT confocal system (Ar-Kr laser), and image size was recorded
at 1,024 by 1,024 pixels with an additional zoom factor of between 4.5 and 5.5.
In a control experiment for Fig. 7 to assay for LcrV expression
differences between the parent Y. pestis KIM8-3002 and the yscC Y. pestis KIM8-3001.12, the yersiniae were grown and
diluted into 37°C RPMI. Two milliliters per well was centrifuged as
described above in six-well cluster dishes and incubated for 2 h
at 37°C with 5% CO2. The contents of the well were
removed, the well was washed with 1.0 of ml PBS which was combined with
the harvested bacteria, and total proteins were recovered by TCA
precipitation. Proteins were neutralized and resuspended in
electrophoresis sample buffer and boiled for 5 min. Serial twofold
dilutions were prepared and subjected to immunoblot analysis. Duplicate
blots were probed with
-HTV and
-Yersinia (to ensure
comparable loading of the lanes).
 |
RESULTS |
LcrV is essential for Yop targeting, while LcrG has a facilitative
role.
The goal of this study was to gain insight into how LcrV
promotes virulence of Y. pestis. We began by clarifying the
essentiality of LcrV for Yop targeting. Our previous report had shown
that LcrV was required for the targeting of Yops into infected
eukaryotic cells, but our data (41) and those of Sarker et
al. (60) suggested that LcrG also may be needed.
Importantly, LcrV and LcrG have been shown to interact (43,
60), raising the possibility that they may function
synergistically to promote Yop targeting. To determine how LcrG might
influence LcrV's activity in targeting, we constructed a Y. pestis strain possessing an in-frame, nonpolar deletion within
lcrG that did not remove the ribosome-binding site for the
downstream gene (lcrV) and therefore was predicted not to
decrease LcrV expression. Consistent with the case for other
Yersinia strains lacking lcrG (41, 61,
64), the
lcrG3 Y. pestis KIM8-3002.7 displayed a
"Ca2+-blind" growth phenotype in defined medium
(79): i.e., the bacteria ceased growth prematurely at 37°C
whether Ca2+ was present or not (data not shown). This
phenotype is often indicative of strong induction of the LCR and
secretion of LcrV and Yops, regardless of the presence of
Ca2+. In agreement with these predictions, the levels of
proteins detected in whole-cell samples (Fig.
1A) from the
lcrG3 strain were elevated irrespective of the presence of Ca2+ (lanes 3 to 6), whereas the parent possessing wild-type pCD1 displayed
significant induction of LcrV, YopD, and YopE only in the absence of
Ca2+ (lanes 1 and 2). Importantly, the induced levels of
protein encoded by the adjacent downstream gene (lcrV) and
by the last gene of the polycistronic operon (yopD)
confirmed the lack of polarity of the lcrG mutation in
lcrG3 Y. pestis. When complemented with pAraG18K in the
absence of arabinose induction, LcrG was not detectable in the
lcrG3 strain by this assay, but the small amount present was sufficient to restore near-wild-type Ca2+ regulation of
all gene products tested (Fig. 1A, lanes 7 and 8). Addition of
arabinose, however, resulted in detectable levels of LcrG and complete
restoration of Ca2+ regulation (lanes 9 and 10),
demonstrated by the decreased levels of LcrV and Yops D and E when
Ca2+ was present. Providing excess LcrV (lanes 11 to 14)
did not appreciably alter the constitutively induced levels of YopD and
YopE, supporting the observation by Nilles et al. (43) that
the inductive role of LcrV in Ca2+ regulation is dependent
on its interaction with LcrG. Finally, providing both lcrG
and lcrV in the
lcrG3 mutant restored the wild-type regulation of expression in the presence (Fig. 1A, lanes 17 and 18) but not the absence (lanes 15 and 16) of arabinose induction.
Unlike the presumed small amount of LcrG present in the absence of
arabinose (lane 7), LcrG was unable to mediate a significant reduction
of YopD or YopE in the presence of Ca2+ (lane 15), possibly
because excess LcrV provided on the same construct could prevent
LcrG-mediated blockage of the Ysc secretion channel.

View larger version (20K):
[in this window]
[in a new window]
|
FIG. 1.
KIM8-3002.7 ( lcrG3) is defective for
negative regulation of LcrV and Yops, and LcrG is required for
efficient secretion of LcrV. Y. pestis KIM8-3002 (parent)
containing plasmid pBAD18-Kan (vector) (lanes 1 and 2) or Y. pestis KIM8-3002.7 possessing pBAD18-Kan (lanes 3 to 6), pAraG18K
(+LcrG) (lanes 7 to 10), pAraV18K (+LcrV) (lanes 11 to 14), or
pAraGV18K (+LcrGV) (lanes 15 to 18) was grown in TMH at 37°C in the
presence (odd-numbered lanes) or absence (even-numbered lanes) of
Ca2+. Arabinose was added to 0.2% (wt/vol) prior to a
shift to 37°C for vector controls (lanes 1, 2, 5, and 6) or to
achieve induction of lcrG (lanes 9 and 10), lcrV
(lanes 13 and 14), or lcrG and lcrV (lanes 17 and
18). Cultures were harvested after 6 h of growth at 37°C, and
samples were fractionated into whole cells (A) and cell-free culture
supernatants (B). Material corresponding to 0.03 OD620 unit
· ml was resolved by SDS-PAGE in a 12% polyacrylamide gel and
analyzed by immunoblotting with an antibody cocktail containing
-HTV, -YopD, -YopE, and -GST-G. Proteins were visualized by
probing with alkaline phosphatase-conjugated secondary antibodies
followed by development with NBT-BCIP.
|
|
LcrV, YopD, and YopE secreted into culture supernatants during growth
(Fig. 1B) correlated with induction detected in whole-cell samples
(Fig. 1A). LcrV, YopD, and YopE were secreted by the
lcrG3 mutant at significant levels (Fig. 1B, lanes 3 to
6), even under conditions that normally cause secretion to be blocked
(lanes 3 and 5). Interestingly, even though secretion was constitutive, levels of protein were lower (lanes 3 to 6) than those of respective proteins secreted in the absence of Ca2+ by the parent
strain (lane 2). This was an effect not seen in our previous strains
defective in lcrG or lacking lcrG but also having
weak lcrV expression (43, 64). As with expression
in the cells, complementation with LcrG also restored downregulation of
secretion in the presence of Ca2+ (Fig. 1B, lanes 7 to 10),
presumably by restoring a functional inner gate to the Ysc
(43). Comparison of the levels of protein in lanes 3 to 6 to
that in lane 10 revealed that LcrG expressed in trans did
not completely restore the wild-type level of Yop secretion, but it did
appear to increase the secretion of LcrV more than that of YopD or
YopE. As expected, providing LcrV under arabinose induction (lanes 13 and 14) resulted in elevated LcrV being released at essentially
wild-type levels into the culture medium without an increase in the
level of YopD or YopE secretion. Complementing with lcrG and
lcrV under arabinose induction (lanes 17 and 18) resulted in
normal regulation of secretion. In summary, the largest effect of the
lcrG3 mutation was to decrease secretion of LcrV. This
was almost completely alleviated by complementation with
lcrG and was overcompensated by overexpression of
lcrV. The mutation had smaller effects on secretion of YopE
and YopD, which were not changed by complementation, perhaps revealing
a limitation of complementing in trans.
We tested the ability of
lcrG3 Y. pestis and complemented
strains to induce cytotoxicity in infected HeLa cells (Fig.
2) as a very sensitive indicator of Yop
targeting (10, 41). HeLa cells infected with the
lcrG3 mutant were only beginning to show evidence of
cytotoxicity after 4 h of incubation. This defect in Yop targeting
was circumvented by reintroducing LcrG from pAraG18K, since strong
cytotoxicity (cell rounding) was shown in this culture after 4 h
of infection. These results are consistent with those reported by
Sarker et al. (61) and the hemolysis test of Nilles et al.
(41), which indicated that LcrG contributes to the mechanism for targeting of Yops. Interestingly, HeLa cells infected with the
noncomplemented
lcrG3 mutant showed a strong cytotoxic
effect by 6 h postinfection (Fig. 2), indicating that LcrG is not
essential for Yop targeting. Because our analysis of these strains in
TMH had indicated that LcrG may be required for the efficient secretion of LcrV, an effect that was overcome by overexpressing lcrV
in trans, and since we had previously demonstrated that LcrV
was required for Yop targeting, we extended our analysis to include
lcrG3 Y. pestis carrying pAraV18K. This strain, like the
parent, was able to induce strong cytotoxicity by 4 h
postinfection. Taken together, these results indicate that LcrG plays a
facilitative role in Yop targeting, while LcrV is essential, a finding
that agrees with the conclusion of Sarker et al. (61).
However, our data further suggest that LcrG may be necessary for
efficient secretion of LcrV. If true, this may indicate that LcrV
functions to promote Yop targeting outside the bacteria, possibly at
the interface between bacteria and infected cells.

View larger version (93K):
[in this window]
[in a new window]
|
FIG. 2.
LcrG facilitates targeting of Yops into infected HeLa
cells. Y. pestis KIM8-3002 (parent) or Y. pestis
KIM8-3002.7 ( lcrG3) possessing pBAD18-Kan, pAraG18K
( lcrG3 pG), or pAraV18K ( lcrG3 pV) was used
to infect HeLa cell monolayers at an MOI of 10. Expression of LcrG was
induced by addition of arabinose to 2% (wt/vol), and LcrV was induced
by addition of IPTG to 0.1 mM. Cell morphology was visualized by
phase-contrast microscopy and recorded at 3.5 or 6 h after
infection by photography through a green filter.
|
|
Both N and C termini of LcrV are required for Yop-targeting
activity.
We initiated the identification of regions of LcrV that
are necessary for targeting of Yops by testing the ability of several altered versions of LcrV to support this function. The proteins used in
these assays are shown diagrammatically in Fig.
3. HT-V represents full-length LcrV,
while HT-VN68 and E15VN68 represent N-terminal truncations which lacked
the first 67 residues of LcrV. VC216 was truncated at the C terminus
and lacked the final 111 residues of LcrV, a domain which displays a
high degree of sequence similarity (27.9% similarity and 49.5%
identity) to PcrV of P. aeruginosa.

View larger version (38K):
[in this window]
[in a new window]
|
FIG. 3.
Schematic representation of LcrV proteins. Portions of
lcrV were subcloned into expression vectors possessing
IPTG-inducible promoters. HT-V (full-length LcrV) and HT-VN68
(N-terminally truncated LcrV) possesses an N-terminal leader sequence
containing six His residues. Fusion of the YopE mRNA secretion signal
to LcrV in pE15VN68 resulted in the addition of amino acids 1 to 15 of
YopE to N-terminally truncated LcrV, yielding the protein E15VN68. It
was expressed from the yopE promoter. VC216 represents a
C-terminal truncation and lacks the last 111 residues of LcrV.
|
|
We first tested whether HT-V and HT-VN68 could restore the ability of a
Y. pestis lcrV-null strain, KIM5-3241, to target Yops. The
YopJ
mutation, also present in this strain, has been
studied previously for its effect on LcrV function and LCR regulation
(65). It was not expected to complicate our findings
in any significant way. To confirm this and provide an initial
characterization, the strains were analyzed for their growth at 37°C
in the defined medium TMH and for their control of Yop expression and
secretion in response to exogenous calcium (Fig.
4). As noted previously (65),
Y. pestis KIM5-3241 expressed YopE weakly whether
calcium was present or not and secreted very little (an amount not
detectable at the loading used) in the absence of calcium. HT-V did not
allow significant induction of Yop expression in the absence of
calcium, but it did restore weak secretion of YopE, which was calcium
regulated as in our Lcr+ parent strains KIM5-3002 (data not
shown) and KIM8-3002 (Fig. 4A). HT-V itself was weakly secreted in the
absence of calcium (Fig. 4A), showing that the His tag leader did not
prevent LcrV secretion. HT-VN68 itself was never secreted, and it also
did not allow strong induction of Yop expression in the absence of calcium, but it did permit weak secretion of YopE (Fig. 4A) and YopM
(Fig. 4B). Curiously, some (weaker) secretion always occurred in the
presence of calcium, indicating that Y. pestis
KIM5-3241(pHT-VN68) is weakly constitutive, or depolarized, for
secretion of Yops. Consistent with this, Y. pestis
KIM5-3241(pHT-VN68) showed a "calcium-blind" growth phenotype
(79); i.e., it entered growth restriction whether calcium
was present or not (data not shown). These data indicate that although
HT-VN68, like HT-V, can bind to LcrG and weakly activate the Ysc for
Yop secretion by releasing the inner-gate block (Fig. 4 and reference
12), the HT-VN68-LcrG complex is unable to respond
normally to the downregulating state of the Ysc in the presence of
Ca2+ and to fully close the Ysc channel. Accordingly, the N
terminus of LcrV is necessary for the normal regulation of a Ysc
activation function.

View larger version (14K):
[in this window]
[in a new window]
|
FIG. 4.
Yop and V antigen expression and secretion in defined
medium by lcrV yopJ Y. pestis KIM5-3241 complemented with
pHT-V and pHT-VN68. Yersiniae pregrown at 26°C in the defined medium
TMH containing (+) or lacking ( ) 2.5 mM CaCl2 were
shifted to 37°C, and IPTG was added to cultures containing pHT-V and
pHT-VN68 to induce expression of the complementing lcrV
genes. After 5 h, cultures were harvested, and proteins in whole
cells (C) and the cell-free culture medium (M) were analyzed in
immunoblots probed with a mixture of antibodies specific for LcrV and
YopE (A) or anti-YopM (B). Proteins were visualized by probing with
alkaline phosphatase-conjugated secondary antibodies followed by
development with NBT-BCIP.
|
|
lcrV yopJ Y. pestis KIM5-3241 alone (as a negative control)
and expressing HT-VN68 or HT-V (as a positive control) was used to
infect HeLa cell monolayers in RPMI (Fig.
5). After 4 h of infection, HeLa
cells infected with Y. pestis carrying pHT-V had rounded up,
while those infected with lcrV yopJ Y. pestis alone or
carrying pHT-VN68 had not (data not shown), suggesting that targeting
of Yops was occurring only in the presence of HT-V. To confirm
localization of Yops, we fractionated infected monolayers and looked
for targeted proteins in the HeLa cell soluble fraction and for
secreted proteins in the cell-free medium. Detection of YopE by
immunoblot analysis revealed that YopE was indeed targeted by Y. pestis KIM5-3241(pHT-V), since it was detected in soluble fractions (Fig. 5, lanes 2 and 4) and was not susceptible to
degradation by trypsin (lane 4). In contrast, Y. pestis
KIM5-3241 lacking pHT-V released only a small amount of YopE into
the culture medium (Fig. 5, lane 1) and did not target Yops into
the HeLa cells (Fig. 6A, lanes 7 and 8, and data not shown). In agreement with the cytotoxicity observations,
YopE was not targeted by Y. pestis KIM5-3241(pHT-VN68).
Instead, the majority of YopE from this strain was released into the
medium (Fig. 5, lane 7). Although a small portion was cell associated
(lane 6), it was completely susceptible to trypsin (lane 8), indicating
extracellular localization. The strong release of YopE into the medium
(lane 7) compared to that from the lcrV yopJ strain lacking
pHT-VN68 (lane 1) indicates that HT-VN68 was able to carry out LcrV's
function of Ysc activation for Yop secretion, as was seen in defined
medium (Fig. 4). We also examined LcrV localization. HT-V was detected
in the medium (Fig. 5, lane 3) and soluble (lanes 2 and 4) fractions,
indicating again that the His tag leader did not interfere with LcrV
secretion or its entry into cells. In contrast, HT-VN68 was not
detected in either of the analyzed fractions (lanes 6 to 9); however,
it was detected in debris fractions containing contact-activated yersiniae in repetitions of this experiment (data not shown). Taken
together, these results indicate that the first 67 residues of LcrV are
necessary for release of LcrV from bacteria and for LcrV that can
function in Yop targeting, although they are dispensable for LcrV's
ability to promote secretion of Yops to the bacterial surface.

View larger version (32K):
[in this window]
[in a new window]
|
FIG. 5.
HT-VN68 is not secreted by Y. pestis and
cannot complement Yop targeting. Y. pestis KIM5-3241
(lcrV yopJ) (lane 1) or Y. pestis KIM5-3241
carrying pHT-V (lanes 2 to 5) or pHT-VN68 (lanes 6 to 9) was used to
infect HeLa cells, in duplicate, at an MOI of 10 in the presence of 0.1 mM IPTG. After 4 h, one replicate for each was treated with
trypsin (lanes 4, 5, 8, and 9) at 100 µg/ml to assess protease
accessibility of HT-V, HT-VN68, and YopE. The presence of proteins in
cell-free medium (M) or H2O-released HeLa cell soluble (S)
fractions was analyzed by resolving samples representing 20% of the
original cultures in a 12% polyacrylamide gel followed by
immunoblotting. Blots were probed with -HTV and -YopE, and
proteins were visualized by probing with alkaline
phosphatase-conjugated secondary antibodies followed by development
with NBT-BCIP.
|
|

View larger version (14K):
[in this window]
[in a new window]
|
FIG. 6.
Both the N and C termini of LcrV are required to mediate
Yop targeting and for release of LcrV from bacteria. Y. pestis KIM8-3002 (parent), KIM5-3241 (lcrV yopJ), and
KIM8-3002.8 (lcrG lcrV) alone (lanes 1, 2, 7, 8, 13, and
14), carrying pVC216 (lanes 5, 6, 11, 12, 17, and 18) or carrying
pE15VN68 (lanes 3, 4, 9, 10, 15, and 16) were used to infect HeLa
cells, in duplicate, at an MOI of 10 in the presence of 0.2 mM IPTG.
After 4 h, trypsin was added to replicate wells at 100 µg/ml to
assess protease accessibility of LcrV and YopE. Samples were
fractionated, and portions representing 12% of the original cultures
were resolved in 12% polyacrylamide gels. Native LcrV, truncated
LcrVs, and YopE in the HeLa cell soluble fraction (A) or released into
culture medium (B) were detected by probing blots with -HTV and
-YopE. Proteins were visualized by probing with alkaline
phosphatase-conjugated secondary antibodies followed by development
with NBT-BCIP.
|
|
One possible explanation for why HT-VN68 did not mediate targeting of
Yops was that although the truncated protein had the capacity to
function in Yop targeting, it needed to be secreted to have this
effect. In an attempt to accomplish secretion of N-terminally
truncated LcrV, we constructed E15VN68 by fusing the YopE
mRNA-dependent secretion signal to LcrVN68, because this secretion signal can mediate secretion of a heterologous protein by
yersiniae (1, 7). We also tested the function of
C-terminally truncated VC216. E15VN68 and VC216 were expressed in the
parent Y. pestis KIM8-3002 and in two strains defective in
the ability to target Yops: KIM5-3241 (lcrV yopJ) and
KIM8-3002.8 (lcrG lcrV). The ability of these truncated
versions of LcrV to be secreted and support Yop targeting was tested in
the HeLa cell infection assay (Fig. 6). After 4 h of infection,
localization of E15VN68, VC216, and YopE in HeLa cell soluble (Fig. 6A)
and culture medium (Fig. 6B) fractions was analyzed. As expected, the
parent Y. pestis targeted YopE (Fig. 6A, lanes 1 and 2),
whereas Y. pestis lacking lcrV (lanes 7 and 8) or
lacking lcrG and lcrV (lanes 13 and 14) did not.
When expressed in the parent Y. pestis strain, neither of the truncated LcrVs interfered with the ability of the strain to
target YopE. YopE was detected in the HeLa cell soluble fraction (lanes
3 to 6) and was protected from degradation by trypsin (lanes 3 and 5).
Expression of either E15VN68 or VC216 in lcrV and lcrG lcrV Y. pestis failed to complement the Yop-targeting defect. Although YopE was detected in soluble fractions (Fig. 6A, lanes 10, 14, 16, and 18), it was susceptible to degradation by trypsin (lanes 9, 11, 15, and 17), indicating an extracellular localization prior to lysis of the cells. In agreement with these data,
infections with these strains did not result in cytotoxicity of HeLa
cells (data not shown). Interestingly, both truncated versions of LcrV became associated with the HeLa cells, regardless of the strain in
which they were expressed (Fig. 6A, lanes 3, 4, 9, 10, 15, and 16 for
E15VN68 and lanes 5, 6, 11, 12, 17, and 18 for VC216). However,
although native LcrV was secreted by the parent strain and appeared in
the culture medium (Fig. 6B, lanes 2, 4, and 6), neither E15VN68 (lane
4) nor VC216 (lane 6) was detected in the culture medium. Secretion of
the truncated proteins was not detected even from lcrG lcrV Y. pestis, a strain depolarized for Yop secretion (Fig. 6B, lanes 15 to 18). In other experiments, these Y. pestis strains failed
to secrete E15VN68 and VC216 into the medium when the yersiniae were
grown in vitro at 37°C in the defined medium TMH lacking
Ca2+ (data not shown). Levels of YopE in medium fractions
from the parent (Fig. 6B, lane 4) or lcrV (Fig. 6B,
lane 10) strain carrying E15VN68 were elevated compared to amounts
released by those host strains alone (Fig. 6B, lanes 2 and 8, respectively), indicating that E15VN68 (like HT-VN68) functioned to
induce Yop secretion to the bacterial surface, even though it could not
sponsor targeting of Yops into HeLa cells. We speculate that this
results from the previously described ability of LcrV to bind LcrG
(41).
Surface localization of LcrV on Y. pestis.
Nilles et al.
(41) and Sarker et al. (60) had speculated that
LcrV is a dynamic participant in the secretion process and may even
mediate assembly of a surface structure for the delivery of Yops.
According to this hypothesis, LcrV may be present on the outer surface
of Y. pestis. We tested this possibility by staining
bacteria with
-HTV and analyzing LcrV distribution by laser-scanning
confocal microscopy (Fig.
7). Y. pestis was incubated in RPMI, a medium that does not promote
secretion of LcrV or Yops in the absence of contact with eukaryotic
cells (13). Surface deposition of LcrV was tested by probing
fixed but unpermeabilized bacteria with
-HTV. Staining with
antibodies specific for Yersinia lacking pCD1 was used as a
positive control and produced an even, homogeneous surface staining of
the bacteria. However, probing with
-HTV showed that LcrV was
present in punctate zones on the surface of the bacteria. This
deposition was not affected by Pla, since this surface-associated
pattern of LcrV was also detected in Y. pestis lacking the
plasmid pPCP1 (data not shown). We also tested localization of LcrV in
a strain lacking the outer membrane secretin YscC, which is essential
for Ysc function. A control experiment verified that the amounts of
LcrV in the bacteria were the same for the parent and yscC
strains after 2 h in RPMI at 37°C with 5% CO2;
i.e., the yscC mutation did not prevent thermal induction of
LcrV expression under these conditions (data not shown). No
fluorescence signal was detected on the surface of yscC Y. pestis KIM8-3001.12 (Fig. 7A), indicating that LcrV requires the
Ysc machinery to gain access to the bacterial surface.

View larger version (28K):
[in this window]
[in a new window]
|
FIG. 7.
LcrV can localize to the surface of Y. pestis. Surface deposition of LcrV and YopE was tested in Y. pestis strains lacking pPCP1. Parent Y. pestis
(KIM8-3002), secretion-negative Y. pestis (yscC
KIM8-3001.12), and the lcrV-null strain (KIM8-3241)
complemented with pHT-VN68 were fixed on coverslips after incubation
for 2 h at 37°C in RPMI. Bacteria were stained with
-Yersinia or -HTV (A) or -YopE (B). The respective
proteins were then visualized by treatment with Oregon green-conjugated secondary antibody
followed by confocal laser-scanning microscopy. Immunofluorescence (IF)
confocal and differential interference contrast (DIC) images are
shown.
|
|
We used this surface localization assay to test whether the truncated
forms of LcrV could gain access to the bacterial surface when expressed
in Y. pestis. To detect only the truncated proteins, HT-VN68, E15VN68, and VC216 were expressed in the lcrV-null
strain. In this test, we used Y. pestis KIM8-3241, a
Pla
derivative of this strain, to ensure detection of the
truncated LcrV proteins at the bacterial surface even if they should
have increased sensitivity to Pla. All three strains failed to produce detectable signals, indicating that the truncated proteins were not on
the surface of Y. pestis (Fig. 7A and data not shown). The
parent Y. pestis strain was also stained with
-YopE as a negative control (Fig. 7B). No signal was detected by confocal analysis. YopE could be detected by this method, however, when the
depolarized strain KIM8-3241(pHT-VN68) was tested as a positive control (Fig. 7B). These results indicate that LcrV, but not YopE, is
present on the surface of non-contact-induced Y. pestis
after passing through the Ysc. We believe that this is a stable
localization, because surface localization of LcrV was detected in the
absence of conditions sufficient to allow secretion of LcrV and Yops
into the culture medium. LcrV's linkage to the surface is probably not
through Pla-susceptible proteins, since LcrV was detected on the
surface of Y. pestis possessing pPCP1 (not shown). Finally, N- and C-terminally truncated LcrVs are neither localized to the bacterial surface nor secreted into the medium, even though they apparently are targeted to the HeLa cell interior by contact-activated yersiniae.
LcrV-specific antibody does not block targeting of Yops and
LcrV.
Our previous results suggested that LcrV may need to be
secreted to have its role in targeting of Yops, raising the possibility that the surface-localized LcrV may be important for Yop targeting. Since we were able to detect surface-localized LcrV with antibody, we
tested whether LcrV-specific antibodies would interfere with Yop
targeting (Fig. 8). In one experimental
design,
-HTV or
-YopM was present at an estimated 2,000-fold
molar excess over the amount of LcrV that typically is expressed in the
infected monolayer (see Materials and Methods). The
-YopM served as
an irrelevant antibody against a target not expected to be at the
bacterial surface to control for nonspecific effects of immunoglobulin
on the assay. The antibody was added to Y. pestis KIM8-3002
just prior to infection of washed HeLa cells, but the bacteria were allowed to settle by gravity onto the monolayer, instead of being rapidly brought into contact by centrifugation, to allow the antibody time to interact with bacteria and HeLa cells. In some wells, the HeLa
cells were pretreated for 30 min with antibody from preimmune serum
(
-NS), and
-NS was also present along with
-HTV or
-YopM during the infection. The monolayers were observed for retraction and
rounding up (cytotoxicity), which are indicative of targeting of YopE.
Figure 8A shows that by 3 h, all infected monolayers were showing
clear signs of cytotoxicity (data not shown for wells containing
-NS). By 4 h, the infected cells were further rounded up. This
test indicated that LcrV-specific antibody did not block targeting of
Yops by Y. pestis.

View larger version (33K):
[in this window]
[in a new window]
|
FIG. 8.
LcrV-specific antibody does not neutralize Yop-targeting
activity by nonpreinduced Y. pestis. (A) -HTV or -YopM
antibody was added at 175 µg/ml to warm RPMI containing Y. pestis KIM8-3002, and the mixture was added without centrifugation
to monolayers of HeLa cells at an MOI of 10. After incubation for
3 h at 37°C with 5% CO2, the cultures were
visualized by phase-contrast microscopy and photographed through a
green filter. (B) HeLa cell monolayers were untreated (UI) (lane 1) or
infected with Y. pestis KIM8-3002 at an MOI of 10 in the
presence (lanes 6 to 9) or absence (lanes 2 to 5) of LcrV-specific Fab
antibody fragments ( -HTV Fab). For this experiment, Fab antibody
fragments were present at 26.5 µg/ml, corresponding to a 1,000-fold
molar excess over estimated LcrV levels. After 4 h, replicate
wells were treated with trypsin at 100 µg/ml prior to harvesting
(lanes 4, 5, 8, and 9) or were harvested directly. Samples were
fractionated into cell-free supernatants (lanes 3, 5, 7, and 9) and
HeLa cell soluble fractions (lanes 1, 2, 4, 6, and 8). To verify that
released LcrV could be quantitatively bound by the Fab fragments, LcrV
bound by -HTV Fab was immunoprecipitated (Immunoppt) from a
nontrypsinized supernatant fraction by using anti-IgG and protein
A-agarose beads. The combined void and protein A column washes (FT),
elution (E) fractions, and fractionated culture samples were analyzed
by immunoblotting with -HTV and -YopE. Preparations of whole
antibody (IgG) (lane 12) and Fab fragments (lane 13) were also resolved
as references. Proteins were visualized by probing with horseradish
peroxidase-coupled secondary antibody, developed with ECL reagent, and
exposed to film.
|
|
In a second experiment, Fab fragments derived from
-HTV were used to
avoid any artificial association of bacteria through whole antibodies
binding to Fc receptors on HeLa cells (Fig. 8B). The Fab fragments were
added at an estimated 1,000-fold molar excess over the total amount of
LcrV that was anticipated to be present in each well. Analysis of
extracts from monolayers infected with Y. pestis in the
absence (Fig. 8B, lanes 2 to 5) and presence (lanes 6 to 9) of excess
-HTV Fab fragments revealed that targeting occurred in the presence
of antibody fragments; comparable levels of trypsin-resistant YopE were
detected in the absence (lane 4) or presence (lane 8) of Fab fragments.
Partitioning of LcrV among culture fractions was also unaffected in
this assay. LcrV was released into the medium (lanes 3 and 7) and
became cell associated (lanes 4 and 8), regardless of the presence of
Fab fragments. To be certain that all available LcrV was associated
with antibody, we immunoprecipitated Fab fragments (and associated
LcrV) from the culture medium. The elution (Fig. 8B, lane 11) but not
the flowthrough (lane 10) from this column contained LcrV, indicating that all extracellular LcrV had been bound by antibody fragments.
In the experiments of Fig. 8, the yersiniae had come into contact with
the HeLa cells after being at 37°C for a relatively short time
following pregrowth at 26°C, a temperature that supports only weak
expression of LcrV and no secretion. After contact, the yersiniae may
have developed full induction and expression of their Yop delivery
mechanism, and antibody might potentially have had only limited access
to the functional targeting complexes at the junction between the
bacterium and the HeLa cell. Accordingly, these experiments may have
shown only that antibody cannot block targeting once yersiniae have
become attached to host cells.
To address this limitation, we preincubated the yersiniae under the
exact conditions used to demonstrate surface LcrV. During the last 30 min of the 2-h induction period, the yersiniae were in the presence
of
-HTV or
-YopM (as an irrelevant antibody), as in Fig. 8A, or
no antibody. Then they were used to infect HeLa cells that had been
pretreated with 1% MS to block Fc receptors. This experiment was done
for MOIs of 10 and 2 with similar results. With these preinduced
yersiniae, cytotoxicity developed more quickly than had been seen with
nonpreinduced bacteria. Cytotoxicity at 1 h of infection (the
earliest we checked) was fully developed for an MOI of 10 and had
clearly begun to develop for an MOI of 2. The degree of cytotoxicity
seen at this or longer infection times was not affected by either
antibody treatment, indicating that Yop targeting was occurring,
despite the presence of
-HTV or the control antibody
-YopM (Fig.
9A). In the test using an MOI of 10 and
antibodies at 175 µg/ml, both antibodies did cause a significant
reduction in the amount of YopE in the trypsin-inaccessible soluble
fraction as determined by immunoblotting; however, this was a
nonspecific effect that was equivalent for the two antibodies (not
shown). When the MOI used was 2, we correspondingly reduced the
antibody concentration to 35 µg/ml, in hopes of eliminating this
nonspecific effect while maintaining the same high ratio of antibody to
LcrV in the assay. Figure 9B shows immunoblot analysis of the
fractionated infected cultures from that experiment. Equivalent amounts
of YopE were inaccessible to trypsin in the HeLa cell soluble fraction
in all infected cultures, whether or not either antibody was present.

View larger version (34K):
[in this window]
[in a new window]
|
FIG. 9.
LcrV-specific antibody does not neutralize Yop-targeting
activity of Y. pestis preinduced for expression of LcrV and
Yops. Y. pestis KIM8-3002 was grown overnight at 26°C,
diluted into warm RPMI, centrifuged in six-well dishes, and incubated
for 2 h at 37°C with 5% CO2 to allow surface
expression of LcrV. After 1.5 h of the incubation, the bacteria
were resuspended, and -YopM or -HTV was added to some wells. The
yersiniae were used to infect HeLa cells at an MOI of 2, and some wells
were photographed at hourly intervals, up to 4 h, through
phase-contrast optics and a green filter. (A) Cultures after 2 h
of infection. (B) After 4 h of infection, replicate cultures were
treated (+) or not ( ) with trypsin, harvested, and fractionated as
described in Materials and Methods, and TCA-precipitated proteins from
cell-free medium (Med) and HeLa cell soluble (Sol) fractions were
analyzed by immunoblotting with a mixture of -HTV and -YopE
antibodies as a probe. The rightmost two lanes contain 0.2 and 2.0 µg
of -HTV as a reference for the size of the predominant band due to
antibody. The proteins were visualized by probing with horseradish
peroxidase-coupled secondary antibody followed by development with ECL
reagent and exposure to film.
|
|
These experiments showed that our
-HTV preparation does not block
Yop targeting, despite being present in a large concentration. This
antibody had previously been shown to confer protection against Y. pestis KIM5 (39). In this study, we confirmed
that this antibody preparation protects mice against intravenous
challenge with a lethal dose (ca. 5 and 18 50% lethal doses,
respectively, in two experiments) of Y. pestis KIM5-3001. In
the two trials, all mice that received
-HTV survived, whereas all
that had been treated with Fab fragments of
-NS died. Accordingly,
our findings showed that our
-HTV preparation was protective
against experimental plague, even though it was not able to block
targeting of Yops.
 |
DISCUSSION |
In this study, we have found that LcrV's N and C termini are
required for Yop targeting. We also demonstrated a novel surface localization of LcrV that did not occur for truncated forms of LcrV
unable to sponsor Yop targeting, and we speculate that the secretion of
LcrV is required for targeting to occur. However, LcrV's function in
targeting of Yops was not blocked by our protective LcrV-specific
polyclonal antibody.
Our initial tests for requirements of the targeting reaction stemmed
from our previous finding that LcrV was required for targeting of Yops
into eukaryotic cells but that LcrG was necessary for maximal hemolysis
by Y. pestis, which was an indirect assay for a functional
Yop delivery channel (41). In that study we were not able to
clearly demonstrate LcrG's role in targeting, because the
LcrG
strain we used expressed LcrV only weakly, and
supplying LcrG in trans without also supplying LcrV caused
downregulation and blockage of secretion. Accordingly, we wanted to
know whether Y. pestis was like Y. enterocolitica
(61) in that LcrV may function more efficiently in Yop
targeting in the presence of LcrG. Our new, nonpolar
lcrG3 strain indeed induced cytotoxicity significantly more slowly than did the parent Y. pestis strain, but its
Yop-targeting defect could be alleviated by complementation with
lcrG or by providing excess LcrV, indicating that LcrG is
not essential for Yop targeting but is indirectly involved. Curiously,
LcrV was secreted at significantly lower levels by the
lcrG3 mutant than by the parent strain. Release of LcrV
into the medium could be increased to near-wild-type levels when
lcrV or lcrG was expressed in trans.
Clearly, LcrG is not essential for LcrV secretion, but it may function
to make secretion of LcrV more efficient. Future studies will determine
whether it mediates this effect within the bacteria by modulating Ysc
activity or at the bacterial surface, where it conceivably could be
acting in association with LcrV.
To begin to dissect how LcrV carries out its multiple functions, we
tested whether two versions of LcrV could support Yop secretion and
targeting. HT-VN68 was able to support secretion of YopE, consistent
with the idea that LcrV participates in Ysc activation by binding to
the inner-gate protein LcrG, since this N-terminally truncated version
retains a domain required for association with LcrG (60),
and cross-linking experiments have shown that HT-VN68 and LcrG can
interact (12). However, HT-VN68 did not support targeting of
YopE into the HeLa cell cytoplasm. We believe that this defect in
targeting was probably not due to the His-containing N-term