This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowReprints and Permissions
Right arrow Copyright Information
Right arrow Books from ASM Press
Right arrow MicrobeWorld
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Cramton, S. E.
Right arrow Articles by Götz, F.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Cramton, S. E.
Right arrow Articles by Götz, F.

 Previous Article  |  Next Article 

Infection and Immunity, October 1999, p. 5427-5433, Vol. 67, No. 10
0019-9567/99/$04.00+0
Copyright © 1999, American Society for Microbiology. All rights reserved.

The Intercellular Adhesion (ica) Locus Is Present in Staphylococcus aureus and Is Required for Biofilm Formation

Sarah E. Cramton,1 Christiane Gerke,1 Norbert F. Schnell,2 Wright W. Nichols,2 and Friedrich Götz1,*

Mikrobielle Genetik, Universität Tübingen, D-72076 Tübingen, Germany,1 and ZENECA Pharmaceuticals, Macclesfield, Cheshire SK10 4TG, England2

Received 15 March 1999/Returned for modification 12 May 1999/Accepted 13 July 1999


    ABSTRACT
Top
Abstract
Introduction
Materials and Methods
Results
Discussion
References

Nosocomial infections that result in the formation of biofilms on the surfaces of biomedical implants are a leading cause of sepsis and are often associated with colonization of the implants by Staphylococcus epidermidis. Biofilm formation is thought to require two sequential steps: adhesion of cells to a solid substrate followed by cell-cell adhesion, creating multiple layers of cells. Intercellular adhesion requires the polysaccharide intercellular adhesin (PIA), which is composed of linear beta -1,6-linked glucosaminylglycans and can be synthesized in vitro from UDP-N-acetylglucosamine by products of the intercellular adhesion (ica) locus. We have investigated a variety of Staphylococcus aureus strains and find that all strains tested contain the ica locus and that several can form biofilms in vitro. Sequence comparison with the S. epidermidis ica genes revealed 59 to 78% amino acid identity. Deletion of the ica locus results in a loss of the ability to form biofilms, produce PIA, or mediate N-acetylglucosaminyltransferase activity in vitro. Cross-species hybridization experiments revealed the presence of icaA in several other Staphylococcus species, suggesting that cell-cell adhesion and the potential to form biofilms is conserved within this genus.


    INTRODUCTION
Top
Abstract
Introduction
Materials and Methods
Results
Discussion
References

Chronic nosocomial infections by gram-positive bacteria have become more prevalent in recent years with the increased use of prosthetic biomedical implants. Chronic infection of a prosthetic implant can serve as a septic focus that can lead to osteomyelytis, acute sepsis, and death, particularly in immunocompromised patients (5, 12). Bacteria colonize prosthetic implants as a biofilm, multiple layers of sessile cells that adhere to the implant surface as well as to each other. Once a biofilm has formed, it can be very difficult to treat clinically because the bacteria on the interior of the biofilm are well protected from the host immune response as well as antibiotic agents (16).

Biofilm formation is thought to be a two-step process that requires the adhesion of bacteria to a substrate surface followed by cell-cell adhesion, forming the multiple layers of the biofilm (13, 14, 30). This latter process is associated with the polysaccharide intercellular adhesin (PIA), which is composed of linear beta -1,6-linked glucosaminylglycans in Staphylococcus epidermidis (22). The intercellular adhesion (ica) locus, icaADB and C, was identified and shown to mediate cell-cell adhesion and PIA production in S. epidermidis (15). It was further demonstrated that icaA and icaD together mediate the synthesis of sugar oligomers in vitro, using UDP-N-acetylglucosamine as a substrate. This N-acetylglucosaminyltransferase activity together with the activity of icaC produces a product in vitro that is recognized by an antibody raised against PIA (8).

The organism most frequently isolated in association with certain types of infections related to biomedical implants, including central venous catheters, cerebrospinal fluid shunts, prosthetic heart valves, and ocular lens implants, is S. epidermidis (2, 5, 6, 18, 24). Staphylococcus aureus is more frequently isolated in association with peripheral intravascular catheters, endotracheal and tracheotomy tubing, peritoneal dialysis tubing, and corneal infections related to contact lens wear (2, 7, 24, 31, 37, 38). Coagulase-negative staphylococci, primarily S. epidermidis, and S. aureus are isolated in approximately equal numbers in association with prosthetic joint and vascular graft infections (18, 35); however, the infections that are associated with S. aureus represent a more serious clinical hazard due to the higher morbidity and mortality associated with this organism compared to those of S. epidermidis.

We set out to investigate whether S. aureus can form biofilms in vitro, and if so, whether it is able to mediate cell-cell adhesion and PIA synthesis via the ica locus. We found not only that the function of the ica locus is conserved between S. epidermidis and S. aureus but also that the ica locus is present in several other Staphylococcus species as well, implying that the cell-cell adhesion function mediated by this locus may be conserved within this genus.


    MATERIALS AND METHODS
Top
Abstract
Introduction
Materials and Methods
Results
Discussion
References

Staphylococcus strains. Most of the strains used for this work are listed in Tables 1 and 2 along with national strain collection reference numbers where applicable. S. epidermidis O-47 is a clinical isolate (13), and strain 5179 is a biofilm- and PIA-negative strain (23). Staphylococcus carnosus TM300 is a wild-type plasmid and cloning host strain (9, 33). Bacteria were cultured under standard conditions in B medium (1% tryptone [Gibco BRL Life-Technologies GmbH, Eggenstein, Germany], 0.5% yeast extract [Gibco BRL], 0.5% NaCl, 0.1% K2HPO4, 0.1% glucose) or Luria-Bertani medium (1% tryptone [Gibco BRL], 0.5% yeast extract, 0.5% NaCl) except as noted below. Media were supplemented when appropriate with chloramphenicol (10 µg/ml), tetracycline (10 µg/ml), or ampicillin (100 µg/ml) except where otherwise noted.

                              
View this table:
[in this window]
[in a new window]
 
TABLE 1.   Strains used in this work


                              
View this table:
[in this window]
[in a new window]
 
TABLE 2.   Staphylococcus species used in this study and presence of icaA

Biofilm assay. Bacteria were grown overnight in tryptic soy broth (TSB; Gibco BRL) supplemented with 0.25% glucose. Cultures were then diluted 1:200 and incubated overnight in stationary U-bottom well polystyrol microtiter plates (Greiner Labortechnik, Frickenhausen, Germany) at 37°C. Microtiter wells were washed twice with phosphate-buffered saline (7 mM Na2HPO4, 3 mM NaH2PO4, 130 mM NaCl [pH 7.4]), dried in an inverted position, and stained with 0.1% safranin (Serva Feinbiochemica GmbH & Co. KG, Heidelberg, Germany) (13).

PIA detection. PIA production in S. aureus was detected, with modifications, as described by Gerke et al. (8). Briefly, cells were grown overnight in TSB supplemented with 0.25% glucose, the optical density was determined, and the same number of cells (2 to 4 ml) from each culture was resuspended in 50 µl of 0.5 M EDTA (pH 8.0). Cells were then incubated for 5 min at 100°C and centrifuged to pellet the cells, and 40 µl of the supernatant was incubated with 10 µl of proteinase K (20 mg/ml; Boehringer GmbH, Mannheim, Germany) for 30 min at 37°C. After addition of 10 µl of Tris-buffered saline (20 mM Tris-HCl, 150 mM NaCl [pH 7.4]) containing 0.01% bromphenol blue, 4 µl was spotted on a nitrocellulose filter, dried, blocked with 3% bovine serum albumin, and incubated overnight with an anti-S. epidermidis PIA antibody (gift from D. Mack, Hamburg, Germany) (23) absorbed as described by Gerke et al. (8) and diluted 1:5,000. Bound antibodies were detected with an absorbed biotin-conjugated anti-rabbit immunoglobulin G (IgG) antibody (Sigma-Aldrich Chemie GmbH, Deisenhofen, Germany) diluted 1:5,000, horseradish peroxidase-conjugated streptavidin (Amersham Buchler GmbH & Co. KG, Braunschweig, Germany) diluted 1:3,000, and the Amersham ECL (enhanced chemiluminescence) Western blotting system.

N-Acetylglucosaminyltransferase assay. Crude membranes were prepared by disrupting cells with glass beads as described previously (8). Protein concentrations were determined by the method of Bradford (3). The basis for the N-acetylglucosaminyltransferase assays has been described previously (8). Assays with crude membranes from plasmid-bearing S. carnosus were performed with 5 mg of protein per ml incubated with 2 mM UDP-N-acetylglucosamine (10 µM 14C labeled) and 4 µM dithiothreitol. For assays with crude membranes from S. epidermidis and S. aureus strains, conditions were modified to 10 µM UDP-N-acetylglucosamine (all 14C labeled), 0.4 µM dithiothreitol, and a protein concentration of 1 mg/ml. Products were analyzed by thin-layer chromatography (NH2-HPTLC plates; Merck, Darmstadt, Germany), 1 µl each, using acetonitrile-water (65:35, vol/vol). N-Acetylglucosamine (10 Bq) was used as a reference compound. Fuji HR-E30 film was exposed for 12 weeks.

DNA blots. Chromosomal DNA was prepared, with modifications, by the method of Marmur (25) as follows. Bacteria were grown to an optical density at 578 nm of 1 to 2 and washed in 5× Tris-EDTA. Cells were then resuspended in 100 µl of 5× Tris-EDTA, 50 µl of lysostaphin (0.5 mg/ml; Sigma), and 1 µl of RNase A (20 mg/ml; Boehringer) and incubated at 37°C until viscous. After cell lysis, 150 µl of 2% sodium dodecyl sulfate was added, the mixture incubated for 5 min at 37°C, and 50 µl of proteinase K (20 mg/ml) added for at last 30 min. After incubation for 5 min at room temperature with 150 µl of 5 M NaClO4, the mixture was extracted with phenol-chloroform-isoamyl alcohol (25:24:1) (Merck) and precipitated with an equal volume isopropanol. DNA digests and Southern blotting were performed by standard methods (32). Prehybridization and hybridization were performed with DIG (digoxigenin) Easy Hyb solution (Boehringer) at 60, 50, and 40°C. Washes were performed in 0.5× SSC (1× SSC is 0.15 M NaCl plus 0.015 M sodium citrate)-0.1% sodium dodecyl sulfate at 50°C. DIG-labeled probes were made by using PCR, DIG nucleotide labeling mix (Boehringer), and Taq polymerase (AGS, Heidelberg, Germany) as recommended by the manufacturers, using a MiniCycler PTC-150 (MJ Research, Inc., Watertown, Mass.).

Operon identification. The existence of an ica operon in S. aureus was postulated based on the ability to form an in vitro biofilm similar to that of S. epidermidis. A search of public nucleotide sequence data libraries using the S. epidermidis ica gene sequences (15) revealed no significant homologies to the ica locus in S. aureus. The genes were detected, however, with Pathoseq, S. aureus contig sequence information available from a commercial provider (Incyte Pharmaceuticals, Palo Alto, Calif.). The S. aureus clones showing homologies to S. epidermidis icaA to icaC were SAU1c0610, SAU1c0627, SAU1c0071, SAU1c0377, SAU1c0511, and SAU1c0012. Due to the sequence errors caused by single-read shotgun sequencing and gaps due to missing or incomplete contigs, it was necessary to subclone and resequence the S. aureus ica locus. The Pathoseq information was used to design PCR primer SA12 (see below) and some sequencing primers.

PCR amplification, cloning, and sequencing. Chromosomal DNA from S. aureus ATCC 35556 was amplified via PCR using primers SA11 and SA12 and the Expand Long Template PCR System (Boehringer) as recommended by the manufacturer and cloned into the KpnI site of shuttle vector pBT5, a derivative of pBT2 lacking the EcoRI restriction site in the multiple cloning site (4), creating plasmid pSC18. Primers SA14 and SA15 were used to amplify plasmid pSC18, which deleted nucleotides 2132 to 5862 (mid-icaR through icaC). The tetracycline resistance cassette from pT181mcs (1) was then ligated by using XhoI restriction sites into the deleted region, creating plasmid pSC23. Cloning was performed in Escherichia coli DH5alpha . Portions of pSC18 and chromosomal DNA from S. aureus ATCC 35556 were sequenced by using a LI-COR DNA sequencer Long Readir 4200 (Lincoln Corporation, Inc., Lincoln, Neb.). Computer sequence analysis was performed with MacDNASIS Pro (Hitachi Software Engineering, San Bruno, Calif.). Enzymes used for cloning were purchased from Gibco BRL, Boehringer, or New England Biolabs GmbH (Schwalbach, Germany). Primers were obtained from MWG-Biotech (Ebersberg, Germany) or Interactiva (Ulm, Germany). The primers used for DNA amplification in S. aureus were SA11 (CGGGGTACCTGCAGGATGGTCATTATGAGTGC), SA12 (AGGGGTACCGAGCTCGCTAATAGGTGACTTTGG), SA14 (ATTTCTCGAGAAGGGGTATGACGGTACAAC), and SA15 (GTAAATGCTCGAGGGAGTGGGACAGAAA). The primers used to amplify the tetracycline resistance cassette from plasmid pT181mcs were tet-2 (GAGCTCGAGTGGCAAAATGCTAGCCAC) and tet-6 (GCGCTCGAGTTCGCCAGCGATTAACGGA). The KpnI restriction site at the beginning of the sequence indicated by a solid line in Fig. 2A is a cloning artifact introduced via the primer used for PCR amplification and is not found at this position on the chromosome. Plasmids were transformed into staphylococci via protoplast transformation (10, 11) or electroporation (21).

Homologous recombination. Wild-type S. aureus ATCC 35556 containing plasmid pSC23 was grown overnight in B medium at 30°C with chloramphenicol (10 µg/ml), diluted 1:1,000 and grown again at 30°C with antibiotic selection, diluted 1:1,000 and grown at 42°C without antibiotic selection twice, diluted 1:100, and plated on TSB plates containing tetracycline (2.5 µg/ml). Homologous recombination and plasmid curing of chloramphenicol-sensitive, tetracycline-resistant colonies were then confirmed by PCR and Southern blotting.

Nucleotide sequence accession number. The sequence indicated by a solid line in Fig. 2A has been submitted to the EMBL/GenBank/DDBJ nucleotide sequence data libraries under accession no. AF086783.


    RESULTS
Top
Abstract
Introduction
Materials and Methods
Results
Discussion
References

S. aureus forms biofilms in vitro and contains the ica locus. Ten commonly studied S. aureus strains, listed in Table 1, were tested for the ability to form biofilms in polystyrol microtiter plates (Fig. 1). As is often seen with heterogeneous S. epidermidis strains, some strains were able to form a strong biofilm and others formed a weak or no biofilm. Two biofilm-forming S. epidermidis strains were included for comparison (Fig. 1, wells 3b and 3c), in addition to the non-biofilm-forming S. carnosus (well 3d).


View larger version (93K):
[in this window]
[in a new window]
 
FIG. 1.   Biofilm formation in S. aureus strains. The strains listed in Table 1 were grown overnight in polystyrol microtiter wells in TSB supplemented with 0.25% glucose. The cells that adhered to the plate after washing were then visualized by staining with safranin.

All strains shown in Fig. 1 and listed in Table 1 exception those of S. carnosus contain icaA, icaD, icaB, and icaC as detected with individual gene probes on Southern blots (data not shown). As is commonly seen with S. epidermidis isolates, in vitro biofilm formation is fairly sensitive to growth conditions; for example, the addition of glucose or glucosamine to the media may be required even for "strong" biofilm-forming strains. Since several of the strains fail to form an in vitro biofilm despite the presence of the ica genes and growth conditions that allow biofilm formation in other strains, it is possible that these strains contain point mutations within the ica locus, that the production of PIA is otherwise negatively regulated, or that biofilm formation is influenced by some other, as yet unidentified factor(s). None of these strains contain insertional elements near the ica locus of a size that could be detected by PCR amplification using primers SA11 and SA12 (Fig. 2A) (data not shown) (39).


View larger version (11K):
[in this window]
[in a new window]
 
FIG. 2.   Map of the ica locus and surrounding sequence in S. aureus ATCC 35556. (A) Genomic organization of the ica locus and surrounding chromosomal region. The region between primers SA12 and SA11 was amplified by PCR and cloned into vector pBT5, creating plasmid pSC18. The solid line indicates the region sequenced and submitted to the EMBL/GenBank/DDBJ nucleotide sequence data libraries; the dashed line indicates previously published sequence (database accession no. M90693). (B) Schematic of pSC23 diagramming the knockout construct. Plasmid pSC18 was amplified by inverse PCR and primers SA14 and SA15, which deleted the sequence between the middle of icaR and the end of icaC. The tetracycline resistance cassette from pT181 (tet) was then ligated into the deleted ica gene locus.

Sequence of the ica locus in S. aureus and sequence comparison with S. epidermidis. Sequence information available from a commercial provider (Incyte Pharmaceuticals) was used to design a PCR primer, and the ica locus from S. aureus ATCC 35556 was cloned and sequenced (Fig. 2A). The organization of the locus itself is identical to that of S. epidermidis; however, other than the presence of a lipase gene downstream and in the opposite orientation, the surrounding sequence shows no similarity. The predicted gene labeled icaR, located upstream and transcribed in the opposite direction from icaA, icaD, icaB, and icaC is also present in S. epidermidis, but its function is not yet known. A sequence similarity comparison between S. aureus ATCC 35556 and S. epidermidis ATCC 35984 is shown in Table 3.

                              
View this table:
[in this window]
[in a new window]
 
TABLE 3.   Sequence comparison of the ica locus between S. aureus and S. epidermidis

Deletion of the ica locus in S. aureus eliminates biofilm formation and PIA production. To show that the ica locus in S. aureus is required for biofilm formation, a deletion mutant was constructed in biofilm-forming strain ATCC 35556 (Fig. 1, well 1a). The ica genes (icaADBC and the beginning of icaR) were replaced with the tetracycline resistance cassette from plasmid pT181 as diagrammed in Fig. 2B and described in more detail in Materials and Methods. This temperature-sensitive plasmid construct (pSC23) was used to replace the wild-type ica locus via homologous recombination, creating the knockout strain ATCC 35556Delta ica::tet.

The deletion mutant was then tested for the ability to form a biofilm in vitro. As shown in Fig. 3, the ica knockout mutant is not able to form a strong biofilm compared to the wild-type parent strain; however, when the strain is complemented with plasmid pSC18, carrying the wild-type ica locus (see Fig. 2A), biofilm formation is restored. This finding demonstrates that the ica locus is required for biofilm formation in S. aureus.


View larger version (89K):
[in this window]
[in a new window]
 
FIG. 3.   Loss of biofilm formation in S. aureus ATCC 35556Delta ica::tet. The ica locus in S. aureus ATCC 35556 was deleted and replaced with a tetracycline resistance cassette by homologous recombination. The knockout strain, ATCC 35556Delta ica::tet, is unable to form a biofilm in vitro; however, the ability to form a biofilm is restored when the knockout strain is complemented with pSC18, carrying the wild type ica genes. The assay for each strain is shown in duplicate.

The same three strains, wild type, knockout, and complemented knockout, were then assayed for the ability to produce PIA, which is mediated by the ica locus. Figure 4 shows the production of PIA as detected with an antibody raised against S. epidermidis PIA (gift from D. Mack). Cell surface extracts were treated with proteinase K before spotting on a nitrocellulose filter to eliminate the cross-reaction of S. aureus protein A with the IgGs used for detection. The antibody was then able to recognize the remaining sugar polymer in the wild-type S. aureus ATCC 35556 (spot A1). The deletion mutant was no longer able to produce PIA, but PIA production was restored in the complemented mutant (spots A2 and A3, respectively). The faint signal remaining in the knockout (spot A2) may represent undigested protein A or another cross-reaction not affected by deletion of the ica locus. PIA-producing S. epidermidis ATCC 35984 (RP62A) and O-47 as well as the non-PIA-producing S. carnosus strain TM300 were included for comparison (spots B1, B2, and B3, respectively).


View larger version (99K):
[in this window]
[in a new window]
 
FIG. 4.   Loss of PIA production in S. aureus ATCC 35556Delta ica::tet. Cell surface extracts from overnight cultures of S. aureus ATCC 35556 (A1), ATCC 35556Delta ica::tet (A2), ATCC 35556Delta ica::tet carrying pSC18 (A3), S. epidermidis ATCC 35984 (RP62A) (B1), S. epidermidis O-47 (B2), and S. carnosus TM300 (B3) were treated with proteinase K, and PIA production was detected with an anti-S. epidermidis PIA antibody, showing that PIA is no longer produced in the ica knockout strain and is restored in the complemented mutant.

To further show that the ica genes in S. aureus mediate PIA production, we applied crude membrane extracts to an in vitro assay using UDP-N-acetylglucosamine as a substrate (8). Figure 5 shows in vitro-synthesized N-acetylglucosaminyltransferase products mediated by crude membrane extracts from S. carnosus containing a plasmid carrying the S. epidermidis ica genes, from the biofilm- and PIA-producing S. epidermidis strain ATCC 35984 (RP62A), and from the wild-type S. aureus strain ATCC 35556 (lanes 1, 3, and 5, respectively). It is significant that extracts from wild-type S. epidermidis and S. aureus strains are able to mediate detectable activity in vitro, as had previously been shown for the S. epidermidis ica genes on an inducible plasmid expressed in S. carnosus (8). The synthesis products were separated on an NH2-HPTLC plate. Negative controls were crude membrane extracts from S. carnosus carrying the vector alone corresponding to the construct in lane 1 (lane 2) and from a non-biofilm- and non-PIA-producing S. epidermidis strain, 5179 (lane 4). The S. aureus knockout strain (lane 6) did not show N-acetylglucosaminyltransferase activity in vitro, demonstrating that the ica genes are required for the synthesis of these sugar oligomers in S. aureus.


View larger version (60K):
[in this window]
[in a new window]
 
FIG. 5.   N-Acetylglucosaminyltransferase activity is mediated by the ica locus. Crude membrane extracts were incubated with radiolabeled UDP-N-acetylglucosamine, and synthesized oligomers were separated on an NH2-HPTLC plate. Lane S contains the standard, N-acetylglucosamine, alone. The remaining lanes contain products synthesized by crude membrane extracts from S. carnosus carrying pTXicaADBC, an inducible expression plasmid containing S. epidermidis icaA, icaD, icaB, and icaC (lane 1), S. carnosus harboring the vector, pTX16, alone (lane 2), S. epidermidis ATCC 35984 (RP62A), which produces PIA (lane 3), S. epidermidis 5179, a strain that does not produce PIA and does not form biofilms (lane 4), S. aureus wild-type strain ATCC 35556 (lane 5), and S. aureus ica knockout strain ATCC 35556Delta ica::tet (lane 6). An arrow indicates the monomer. Oligomers of increasing size are seen as a ladder-like series of spots that descend on the plate toward the origin (arrowhead) at the bottom. The smear just above the origin is unreacted UDP-N-acetylglucosamine.

The ica locus is also present in other Staphylococcus species. Since the sequence of the ica locus is well conserved between S. epidermidis and S. aureus (Table 3), we examined whether other Staphylococcus species carry these genes. Curiously, cross-hybridization between S. aureus and S. epidermidis on DNA blots was weak (data not shown). Therefore, icaA DNA probes from both S. epidermidis and S. aureus were used simultaneously to hybridize cross-species Southern blots of decreasing stringency containing DNA from 22 different Staphylococcus species (Table 2). Cross-species hybridization was detected with S. auricularis and S. capitis, to a lesser extent with S. intermedius, S. lugdunensis, S. piscifermentans, and weakly with S. pasteuri. For those species that showed no cross-hybridization with these probes, one can conclude that an icaA homologue, however distantly related, is not detectable under these conditions, but one cannot go so far as to say that no homologue is present in the genome of these species. The result does show that the ica locus is conserved in some members of this genus, and it suggests that intercellular adhesion mediated by the ica locus may be a general phenomenon that is conserved among staphylococci.

In agreement with the presence of an icaA homolog, S. auricularis and S. capitis react weakly with the antibody raised against S. epidermidis PIA, as do S. haemolyticus and S. saprophyticus, though the latter two strains do not cross-hybridize with icaA DNA probes, and none of these species form a biofilm in vitro. Conversely, our S. simulans representative forms a very strong biofilm in vitro but does not produce a product that cross-reacts with our anti-PIA antibody. S. gallinarum, S. lentus, and S. sciuri were also able to form weak biofilms in vitro, but a PIA-like product was not detectable (data not shown).


    DISCUSSION
Top
Abstract
Introduction
Materials and Methods
Results
Discussion
References

Intercellular adhesion is conserved between S. epidermidis and S. aureus. We have shown that there is a functional conservation of intercellular adhesion mediated by the ica locus between S. epidermidis and S. aureus. Although nosocomial infections related to certain types of biomedical implants are commonly associated with S. epidermidis, S. aureus infections occur at a high frequency in association with other types of prosthetic devices and have more serious clinical consequences due to the expression of various virulence factors and the frequent presence of genes encoding antibiotic resistance. The prevalence of S. epidermidis and other coagulase-negative staphylococci in patients with some types of biomedical implant-associated infections may be due to (i) the organisms' increased proximity, and therefore access, to surgical incisions and/or (ii) transmission via skin contact between patients and/or hospital staff. S. aureus, in contrast to typical members of the human epidermal flora, resides predominantly in aural and nasal tissues, which are usually remote from surgical implant sites. It is likely that with better access, this species would be found even more frequently in association with all types of biomedical implant-related infections.

The ability to mediate intercellular adhesion and the formation of biofilms in both of these species is unlikely to have arisen recently in conjunction with the invention of prosthetic medical devices. Rather, it must have had a function much earlier in the evolution and survival of these organisms. The presence of the icaA gene in other Staphylococcus species also supports the notion that the locus has or had a more general function in the survival of this genus in a variety of environments.

Differences in the ability to form biofilms among related S. aureus strains. Strains ATCC 35556 (SA113) and RN4220 (Fig. 1, wells 1a and 2b, respectively) are both derivatives of S. aureus NCTC 8325 and, in effect, cousins. Strain NCTC 8325 underwent a chemical mutagenesis to produce restriction-negative strain SA113 (ATCC 35556) (17). Strain NCTC 8325 (RN1) was also treated twice with UV light to remove three prophages, producing strain 8325-4 (RN450) (28, 29). This strain was then subjected to a chemical mutagenesis, producing the restriction-negative strain RN4220 (20). While strain SA113 is able to form a strong biofilm, neither strain 8325-4 (not shown) nor strain RN4220 shows this phenotype. Instead, the two latter strains leave a thin layer of cells on the bottom of the microtiter plate well. This same phenotype is also seen in S. epidermidis transposon-induced ica mutants (13, 15). In each case, cells are able to adhere to the substrate surface, the genetically distinct first step in biofilm formation, but are not able to build a multilayered biofilm due to a defect in cell-cell adhesion. This implies that the multiple mutageneses that separate S. aureus SA113 and its cousins, 8325-4 and RN4220, have altered the regulation or expression, either directly or indirectly, of genes required for cell-cell adhesion, and therefore biofilm formation. While RN4220 leaves only a thin layer of cells on the bottom of the microtiter plate well in a biofilm assay (Fig. 1, well 2b), RN4220 carrying pSC18 is able to form a multilayered biofilm (data not shown). In addition, RN4220 carrying plasmid pCN27, containing icaA to icaC from S. epidermidis, was reported to form a strong biofilm (26). This implies that the expression or activity of the ica genes or gene products in S. aureus RN4220 may be less than for its cousin SA113, but that a plasmid carrying the ica region is able to rescue this phenotype. Similarly, the ica knockout mutant in S. aureus ATCC 35556 described here fails to form cell clusters when grown in culture, unlike the wild-type and complemented mutant strains. Cells from all three strains are able to attach to a polystyrene surface in a primary adhesion assay, however, supporting results for S. epidermidis showing that a mutation in the ica locus affects cell-cell adhesion but does not affect adhesion to a solid substrate (13).

As can be seen in Fig. 3 and 4, the complementation of the ATCC 35556 ica knockout strain is not complete. This phenomenon might be due to an as yet uncharacterized regulatory function in the region that is included on the complementation plasmid. A correlation can, however, be seen between the level of PIA production and the thickness of the biofilm formed (compare wild-type, knockout, and complemented knockout in Fig. 3 and 4).

Presence of the ica locus in other Staphylococcus species. The Staphylococcus species that cross-hybridized with icaA DNA probes from S. aureus and S. epidermidis were the species that are phylogenetically the most closely related. The so-called epidermidis phylogenetic group, based on DNA comparisons as well as some biochemical properties (19, 34), includes S. auricularis and S. capitis, both of which appear to carry a copy of the icaA gene. Other, more distantly related members of this group, S. haemolyticus, S. hominis, and S. warneri, failed to cross-hybridize under the conditions used. Coagulase-positive S. intermedius was so named to reflect a sequence composition that places it phylogenetically between S. aureus and S. epidermidis (27), and accordingly, this species was also able to cross-hybridize with icaA probes. The remaining three icaA-positive species, S. lugdunensis, S. pasteuri and S. piscifermentans have not been classified into any of the larger phylogenetic groupings based on sequence comparisons (19, 34, 36).

Tests on the 22 different Staphylococcus species to detect biofilm formation and PIA production were inconclusive. As seen with both S. epidermidis and S. aureus (e.g., Fig. 1), strain representatives within the same species behave very differently, and a single tested strain from each species is unlikely to be representative of the species as a whole. In addition, even if these strains produce PIA, there is no guarantee that the available antibody raised against S. epidermidis PIA can recognize sugar moieties that may be modified in a different manner, for example, deacetylated or succinated (26), in other, albeit related, species. In addition, nonspecific cross-reactions such as that seen between IgGs and protein A in S. aureus cannot be discounted. Those species that appear to carry no icaA-like gene yet are able to form a biofilm in vitro or produce a product that reacts with the anti-S. epidermidis PIA antibody may well have an entirely different and as yet unidentified mechanism mediating biofilm formation. Studies that include a larger number of representatives for each species are clearly required in order to show that functional intercellular adhesion, and not just the presence of the ica locus, occurs in Staphylococcus species other than S. epidermidis and S. aureus.

S. aureus and S. epidermidis are the gram-positive bacteria most often associated with medical implant-related infections. We have shown that both species mediate the cell-cell adhesion step of biofilm formation via the ica locus and that deletion of the ica genes eliminates the ability to produce PIA and form a biofilm in vitro. Due to the high level of morbidity and mortality associated with S. aureus infections, as well as the high frequency of infection by both organisms, the ica locus represents an important potential clinical target for the prevention of chronic infections associated with prosthetic medical devices.


    ACKNOWLEDGMENTS

We thank Phuong Lan Huynh, Elisabeth Knorpp, and Ulrike Pfitzner and for photography.

S.E.C. was supported by NRSA postdoctoral fellowship AI09626 from the National Institute of Allergy and Infectious Diseases. This project was supported by grant DLR: 01KI9751/1 from the German Bundesministerium für Bildung Wissenschaft, Forschung und Technologie.


    FOOTNOTES

* Corresponding author. Mailing address: Mikrobielle Genetik, Waldhäuser Strasse 70/8, Universität Tübingen, D-72076 Tübingen, Germany. Phone: 49 7071 297 4636. Fax: 49 7071 29 5937. E-mail: friedrich.goetz{at}uni-tuebingen.de.

Editor:   S. H. E. Kaufmann


    REFERENCES
Top
Abstract
Introduction
Materials and Methods
Results
Discussion
References

1. Augustin, J., R. Rosenstein, B. Wieland, U. Schneider, N. Schnell, G. Engelke, K.-D. Entian, and F. Götz. 1992. Genetic analysis of epidermin biosynthetic genes and epidermin-negative mutants of Staphylococcus epidermidis. Eur. J. Biochem. 204:1149-1154[Medline].
2. Baker, A. S., and O. D. Schein. 1994. Ocular infections, p. 111-134. In A. L. Bisno, and F. A. Waldvogel (ed.), Infections associated with indwelling medical devices, 2nd ed. ASM Press, Washington, D.C.
3. Bradford, M. M. 1976. A rapid and sensitive method for the quantitation of microgram quantities of protein utilizing the principle of protein-dye binding. Anal. Biochem. 72:248-254[Medline].
4. Brückner, R. 1997. Gene replacement in Staphylococcus carnosus and Staphylococcus xylosus. FEMS Microbiol. Lett. 151:1-8[Medline].
5. Christensen, G. D., L. Baldassarri, and W. A. Simpson. 1994. Colonization of medical devices by coagulase-negative staphylococci, p. 45-78. In A. L. Bisno, and F. A. Waldvogel (ed.), Infections associated with indwelling medical devices, 2nd ed. American Society for Microbiology, Washington, D.C.
6. Dickinson, G., and A. L. Bisno. 1989. Infections associated with indwelling devices: concepts of pathogenesis; infections associated with intravascular devices. Antimicrob. Agents Chemother. 33:597-601[Free Full Text].
7. Dickinson, G. M., and A. L. Bisno. 1989. Infections associated with indwelling devices: infections related to extravascular devices. Antimicrob. Agents Chemother. 33:602-607[Free Full Text].
8. Gerke, C., A. Kraft, R. Süßmuth, O. Schweitzer, and F. Götz. 1998. Characterization of the N-acetylglucosaminyltransferase activity involved in the biosynthesis of the Staphylococcus epidermidis polysaccharide intercellular adhesin (PIA). J. Biol. Chem. 273:18586-18593[Abstract/Free Full Text].
9. Götz, F. 1990. Staphylococcus carnosus. A new host for gene cloning and protein production. Soc. Appl. Bacteriol. Symp. Ser. 19:49S-53S[Medline].
10. Götz, F., B. Kreutz, and K. H. Schleifer. 1983. Protoplast transformation of Staphylococcus carnosus by plasmid DNA. Mol. Gen. Genet. 189:340-342.
11. Götz, F., and B. Schumacher. 1987. Improvements of protoplast transformation in Staphylococcus carnosus. FEMS Microbiol. Lett. 40:285-288.
12. Gristina, A. G. 1987. Biomaterial-centered infection: microbial adhesion versus tissue integration. Science 23:1588-1595.
13. Heilmann, C., C. Gerke, F. Perdreau-Remington, and F. Götz. 1996. Characterization of Tn917 insertion mutants of Staphylococcus epidermidis affected in biofilm formation. Infect. Immun. 64:277-282[Abstract].
14. Heilmann, C., and F. Götz. 1998. Further characterization of Staphylococcus epidermidis transposon mutants deficient in primary attachment or intercellular adhesion. Zentbl. Bakteriol. 287:69-83.
15. Heilmann, C., O. Schweitzer, C. Gerke, N. Vanittanakom, D. Mack, and F. Götz. 1996. Molecular basis of intercellular adhesion in the biofilm-forming Staphylococcus epidermidis. Mol. Microbiol. 20:1083-1091[Medline].
16. Hoyle, B. D., and J. W. Costerton. 1991. Bacterial resistance to antibiotics: the role of biofilms. Prog. Drug Res. 37:91-105[Medline].
17. Iordanescu, S., and M. Surdeanu. 1976. Two restriction and modification systems in Staphylococcus aureus NCTC 8325. J. Gen. Microbiol. 96:277-281[Abstract/Free Full Text].
18. Karchmer, A. W., and G. W. Gibbons. 1994. Infections of prosthetic heart valves and vascular grafts, p. 213-250. In A. L. Bisno, and F. A. Waldvogel (ed.), Infections associated with indwelling medical devices, 2nd ed. ASM Press, Washington, D.C.
19. Kloos, W. E. 1990. Systematics and the natural history of staphylococci. 1 Soc. Appl. Bacteriol. Symp. Ser. 19:25S-37S.
20. Kreiswirth, B. N., S. Lofdahl, M. J. Betley, M. O'Reilly, P. M. Schlievert, M. S. Bergdoll, and R. P. Novick. 1983. The toxic shock syndrome exotoxin structural gene is not detectably transmitted by a prophage. Nature. 305:709-712[Medline].
21. Lee, J. C. 1995. Electrotransformation of staphylococci. Methods in Mol. Biol. 47:209-216[Medline].
22. Mack, D., W. Fischer, A. Krokotsch, K. Leopold, R. Hartmann, H. Egge, and R. Laufs. 1996. The intercellular adhesin involved in biofilm accumulation of Staphylococcus epidermidis is a linear beta -1,6-linked glucosaminoglycan: purification and structural analysis. J. Bacteriol. 178:175-183[Abstract/Free Full Text].
23. Mack, D., N. Siemssen, and R. Laufs. 1992. Parallel induction by glucose of adherence and a polysaccharide antigen specific for plastic-adherent Staphylococcus epidermidis: evidence for functional relation to intercellular adhesion. Infect. Immun. 60:2048-2057[Abstract/Free Full Text].
24. Maki, D. G. 1994. Infections caused by intravascular devices used for infusion therapy: pathogenesis, prevention, and management, p. 155-212. In A. L. Bisno, and F. A. Waldvogel (ed.), Infections associated with indwelling medical devices, 2nd ed. ASM Press, Washington, D.C.
25. Marmur, J. 1961. A procedure for the isolation of deoxyribonucleic acid from microorganisms. J. Mol. Biol. 3:202-218[Medline].
26. McKenney, D., J. Hübner, E. Muller, Y. Wang, D. A. Goldmann, and G. B. Pier. 1998. The ica locus of Staphylococcus epidermidis encodes production of the capsular polysaccharide/adhesin. Infect. Immun. 66:4711-4720[Abstract/Free Full Text].
27. Noble, W. C. 1990. Systematics and the natural history of staphylococci. 2. Soc. Appl. Bacteriol. Symp. Ser. 19:39S-48S[Medline].
28. Novick, R. P. 1967. Properties of a cryptic high-frequency transducing phage in Staphylococcus aureus. Virology 33:155-166[Medline].
29. Novick, R. P., and M. H. Richmond. 1965. Nature and interactions of the genetic elements governing penicillinase synthesis in Staphylococcus aureus. J. Bacteriol. 90:467-480[Abstract/Free Full Text].
30. Peters, G., R. Locci, and G. Pulverer. 1981. Microbial colonization of prosthetic devices. II. Scanning electron microscopy of naturally infected intravenous catheters. Zentbl. Bakteriol. Hyg. I Abt. Orig. Reihe B 172:293-299.
31. Robinson, D. L., V. G. Fowler, D. J. Sexton, R. G. Corey, and P. J. Conlon. 1997. Bacterial endocarditis in hemodialysis patients. Am. J. Kidney Dis. 30:521-524[Medline].
32. Sambrook, J., E. F. Fritsch, and T. Maniatis. 1989. Molecular cloning: a laboratory manual, 2nd ed. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y.
33. Schleifer, K. H., and U. Fischer. 1982. Description of a new species of the genus Staphylococcus: Staphylococcus carnosus. Int. J. Syst. Bacteriol. 32:153-156.
34. Schleifer, K. H., and R. M. Kroppenstedt. 1990. Chemical and molecular classification of staphylococci. Soc. Appl. Bacteriol. Symp. Ser. 19:9S-24S[Medline].
35. Steckelberg, J. M., and D. R. Osmon. 1994. Prosthetic joint infection, p. 259-290. In A. L. Bisno, and F. A. Waldvogel (ed.), Infections associated with indwelling medical devices, 2nd ed. ASM Press, Washington, D.C.
36. Takahashi, T., M. Kaneko, Y. Mori, M. Tsuji, N. Kikuchi, and T. Miramune. 1997. Phylogenetic analysis of Staphylococcus based on the 16S rDNA sequence and assignment of clinical isolates from animals. J. Vet. Med. Sci. 59:775-783[Medline].
37. Tiruvilauamala, P., and W. G. Johanson, Jr. 1994. Infections associated with endotracheal intubation and tracheostomy, p. 135-154. In A. L. Bisno, and F. A. Waldvogel (ed.), Infections associated with indwelling medical devices, 2nd ed. ASM Press, Washington, D.C.
38. Vychytil, A., M. Lorenz, B. Schneider, W. H. Horl, and M. Haag-Weber. 1998. New criteria for management of catheter infections in peritoneal dialysis patients using ultrasonography. J. Am. Soc. Nephrol. 9:290-296[Abstract].
39. Ziebuhr, W., V. Krimmer, S. Rachid, I. Lößner, F. Götz, and J. Hacker. 1999. A novel mechanism of phase variation of virulence in Staphylococcus epidermidis: evidence for control of the polysaccharide intercellular adhesin synthesis by alternating insertion and excision of the insertion sequence element IS256. Mol. Microbiol. 32:345-356[Medline].


Infection and Immunity, October 1999, p. 5427-5433, Vol. 67, No. 10
0019-9567/99/$04.00+0
Copyright © 1999, American Society for Microbiology. All rights reserved.



This article has been cited by other articles:

  • Stevens, N. T., Greene, C. M., O'Gara, J. P., Humphreys, H. (2009). Biofilm characteristics of Staphylococcus epidermidis isolates associated with device-related meningitis. J Med Microbiol 58: 855-862 [Abstract] [Full Text]  
  • Karatan, E., Watnick, P. (2009). Signals, Regulatory Networks, and Materials That Build and Break Bacterial Biofilms. Microbiol. Mol. Biol. Rev. 73: 310-347 [Abstract] [Full Text]  
  • Fredheim, E. G. A., Klingenberg, C., Rohde, H., Frankenberger, S., Gaustad, P., Flaegstad, T., Sollid, J. E. (2009). Biofilm Formation by Staphylococcus haemolyticus. J. Clin. Microbiol. 47: 1172-1180 [Abstract] [Full Text]  
  • Lauderdale, K. J., Boles, B. R., Cheung, A. L., Horswill, A. R. (2009). Interconnections between Sigma B, agr, and Proteolytic Activity in Staphylococcus aureus Biofilm Maturation. Infect. Immun. 77: 1623-1635 [Abstract] [Full Text]  
  • Ganeshnarayan, K., Shah, S. M., Libera, M. R., Santostefano, A., Kaplan, J. B. (2009). Poly-N-Acetylglucosamine Matrix Polysaccharide Impedes Fluid Convection and Transport of the Cationic Surfactant Cetylpyridinium Chloride through Bacterial Biofilms. Appl. Environ. Microbiol. 75: 1308-1314 [Abstract] [Full Text]  
  • Merino, N., Toledo-Arana, A., Vergara-Irigaray, M., Valle, J., Solano, C., Calvo, E., Lopez, J. A., Foster, T. J., Penades, J. R., Lasa, I. (2009). Protein A-Mediated Multicellular Behavior in Staphylococcus aureus. J. Bacteriol. 191: 832-843 [Abstract] [Full Text]  
  • Rosenstein, R., Nerz, C., Biswas, L., Resch, A., Raddatz, G., Schuster, S. C., Gotz, F. (2009). Genome Analysis of the Meat Starter Culture Bacterium Staphylococcus carnosus TM300. Appl. Environ. Microbiol. 75: 811-822 [Abstract] [Full Text]  
  • Erickson, D. L., Jarrett, C. O., Callison, J. A., Fischer, E. R., Hinnebusch, B. J. (2008). Loss of a Biofilm-Inhibiting Glycosyl Hydrolase during the Emergence of Yersinia pestis. J. Bacteriol. 190: 8163-8170 [Abstract] [Full Text]  
  • Trotonda, M. P., Tamber, S., Memmi, G., Cheung, A. L. (2008). MgrA Represses Biofilm Formation in Staphylococcus aureus. Infect. Immun. 76: 5645-5654 [Abstract] [Full Text]  
  • Coelho, L. R., Souza, R. R., Ferreira, F. A., Guimaraes, M. A., Ferreira-Carvalho, B. T., Figueiredo, A. M. S. (2008). agr RNAIII divergently regulates glucose-induced biofilm formation in clinical isolates of Staphylococcus aureus. Microbiology 154: 3480-3490 [Abstract] [Full Text]  
  • Monk, A. B., Boundy, S., Chu, V. H., Bettinger, J. C., Robles, J. R., Fowler, V. G. Jr., Archer, G. L. (2008). Analysis of the Genotype and Virulence of Staphylococcus epidermidis Isolates from Patients with Infective Endocarditis. Infect. Immun. 76: 5127-5132 [Abstract] [Full Text]  
  • Behlau, I., Gilmore, M. S. (2008). Microbial Biofilms in Ophthalmology and Infectious Disease. Arch Ophthalmol 126: 1572-1581 [Abstract] [Full Text]  
  • Cerca, N., Brooks, J. L., Jefferson, K. K. (2008). Regulation of the Intercellular Adhesin Locus Regulator (icaR) by SarA, {sigma}B, and IcaR in Staphylococcus aureus. J. Bacteriol. 190: 6530-6533 [Abstract] [Full Text]  
  • Jordan, S. J., Perni, S., Glenn, S., Fernandes, I., Barbosa, M., Sol, M., Tenreiro, R. P., Chambel, L., Barata, B., Zilhao, I., Aldsworth, T. G., Adriao, A., Faleiro, M. L., Shama, G., Andrew, P. W. (2008). Listeria monocytogenes Biofilm-Associated Protein (BapL) May Contribute to Surface Attachment of L. monocytogenes but Is Absent from Many Field Isolates. Appl. Environ. Microbiol. 74: 5451-5456 [Abstract] [Full Text]  
  • Holland, L. M., O'Donnell, S. T., Ryjenkov, D. A., Gomelsky, L., Slater, S. R., Fey, P. D., Gomelsky, M., O'Gara, J. P. (2008). A Staphylococcal GGDEF Domain Protein Regulates Biofilm Formation Independently of Cyclic Dimeric GMP. J. Bacteriol. 190: 5178-5189 [Abstract] [Full Text]  
  • Smith, K., Perez, A., Ramage, G., Lappin, D., Gemmell, C. G., Lang, S. (2008). Biofilm formation by Scottish clinical isolates of Staphylococcus aureus. J Med Microbiol 57: 1018-1023 [Abstract] [Full Text]  
  • Shanks, R. M. Q., Meehl, M. A., Brothers, K. M., Martinez, R. M., Donegan, N. P., Graber, M. L., Cheung, A. L., O'Toole, G. A. (2008). Genetic Evidence for an Alternative Citrate-Dependent Biofilm Formation Pathway in Staphylococcus aureus That Is Dependent on Fibronectin Binding Proteins and the GraRS Two-Component Regulatory System. Infect. Immun. 76: 2469-2477 [Abstract] [Full Text]  
  • Seidl, K., Goerke, C., Wolz, C., Mack, D., Berger-Bachi, B., Bischoff, M. (2008). Staphylococcus aureus CcpA Affects Biofilm Formation. Infect. Immun. 76: 2044-2050 [Abstract] [Full Text]  
  • Majerczyk, C. D., Sadykov, M. R., Luong, T. T., Lee, C., Somerville, G. A., Sonenshein, A. L. (2008). Staphylococcus aureus CodY Negatively Regulates Virulence Gene Expression. J. Bacteriol. 190: 2257-2265 [Abstract] [Full Text]  
  • Johnson, M., Cockayne, A., Morrissey, J. A. (2008). Iron-Regulated Biofilm Formation in Staphylococcus aureus Newman Requires ica and the Secreted Protein Emp. Infect. Immun. 76: 1756-1765 [Abstract] [Full Text]  
  • Vergara-Irigaray, M., Maira-Litran, T., Merino, N., Pier, G. B., Penades, J. R., Lasa, I. (2008). Wall teichoic acids are dispensable for anchoring the PNAG exopolysaccharide to the Staphylococcus aureus cell surface. Microbiology 154: 865-877 [Abstract] [Full Text]  
  • Izano, E. A., Amarante, M. A., Kher, W. B., Kaplan, J. B. (2008). Differential Roles of Poly-N-Acetylglucosamine Surface Polysaccharide and Extracellular DNA in Staphylococcus aureus and Staphylococcus epidermidis Biofilms. Appl. Environ. Microbiol. 74: 470-476 [Abstract] [Full Text]  
  • Frank, K. L., del Pozo, J. L., Patel, R. (2008). From Clinical Microbiology to Infection Pathogenesis: How Daring To Be Different Works for Staphylococcus lugdunensis. Clin. Microbiol. Rev. 21: 111-133 [Abstract] [Full Text]  
  • Harraghy, N., Homerova, D., Herrmann, M., Kormanec, J. (2008). Mapping the Transcription Start Points of the Staphylococcus aureus eap, emp, and vwb Promoters Reveals a Conserved Octanucleotide Sequence That Is Essential for Expression of These Genes. J. Bacteriol. 190: 447-451 [Abstract] [Full Text]  
  • Schlag, S., Nerz, C., Birkenstock, T. A., Altenberend, F., Gotz, F. (2007). Inhibition of Staphylococcal Biofilm Formation by Nitrite. J. Bacteriol. 189: 7911-7919 [Abstract] [Full Text]  
  • Frank, K. L., Patel, R. (2007). Poly-N-Acetylglucosamine Is Not a Major Component of the Extracellular Matrix in Biofilms Formed by icaADBC-Positive Staphylococcus lugdunensis Isolates. Infect. Immun. 75: 4728-4742 [Abstract] [Full Text]  
  • Rieu, A., Weidmann, S., Garmyn, D., Piveteau, P., Guzzo, J. (2007). agr System of Listeria monocytogenes EGD-e: Role in Adherence and Differential Expression Pattern. Appl. Environ. Microbiol. 73: 6125-6133 [Abstract] [Full Text]  
  • Cerca, N., Jefferson, K. K., Maira-Litran, T., Pier, D. B., Kelly-Quintos, C., Goldmann, D. A., Azeredo, J., Pier, G. B. (2007). Molecular Basis for Preferential Protective Efficacy of Antibodies Directed to the Poorly Acetylated Form of Staphylococcal Poly-N-Acetyl-{beta}-(1-6)-Glucosamine. Infect. Immun. 75: 3406-3413 [Abstract] [Full Text]  
  • Tormo, M. A., Ubeda, C., Marti, M., Maiques, E., Cucarella, C., Valle, J., Foster, T. J., Lasa, I., Penades, J. R. (2007). Phase-variable expression of the biofilm-associated protein (Bap) in Staphylococcus aureus. Microbiology 153: 1702-1710 [Abstract] [Full Text]  
  • Fuchs, S., Pane-Farre, J., Kohler, C., Hecker, M., Engelmann, S. (2007). Anaerobic Gene Expression in Staphylococcus aureus. J. Bacteriol. 189: 4275-4289 [Abstract] [Full Text]  
  • Rice, K. C., Mann, E. E., Endres, J. L., Weiss, E. C., Cassat, J. E., Smeltzer, M. S., Bayles, K. W. (2007). The cidA murein hydrolase regulator contributes to DNA release and biofilm development in Staphylococcus aureus. Proc. Natl. Acad. Sci. USA 104: 8113-8118 [Abstract] [Full Text]  
  • O'Neill, E., Pozzi, C., Houston, P., Smyth, D., Humphreys, H., Robinson, D. A., O'Gara, J. P. (2007). Association between Methicillin Susceptibility and Biofilm Regulation in Staphylococcus aureus Isolates from Device-Related Infections. J. Clin. Microbiol. 45: 1379-1388 [Abstract] [Full Text]  
  • Cerca, N., Maira-Litran, T., Jefferson, K. K., Grout, M., Goldmann, D. A., Pier, G. B. (2007). Protection against Escherichia coli infection by antibody to the Staphylococcus aureus poly-N-acetylglucosamine surface polysaccharide. Proc. Natl. Acad. Sci. USA 104: 7528-7533 [Abstract] [Full Text]  
  • Valle, J., Vergara-Irigaray, M., Merino, N., Penades, J. R., Lasa, I. (2007). {sigma}B Regulates IS256-Mediated Staphylococcus aureus Biofilm Phenotypic Variation. J. Bacteriol. 189: 2886-2896 [Abstract] [Full Text]  
  • Nostro, A., Roccaro, A. S., Bisignano, G., Marino, A., Cannatelli, M. A., Pizzimenti, F. C., Cioni, P. L., Procopio, F., Blanco, A. R. (2007). Effects of oregano, carvacrol and thymol on Staphylococcus aureus and Staphylococcus epidermidis biofilms. J Med Microbiol 56: 519-523 [Abstract] [Full Text]  
  • Sobral, R. G., Jones, A. E., Des Etages, S. G., Dougherty, T. J., Peitzsch, R. M., Gaasterland, T., Ludovice, A. M., de Lencastre, H., Tomasz, A. (2007). Extensive and Genome-Wide Changes in the Transcription Profile of Staphylococcus aureus Induced by Modulating the Transcription of the Cell Wall Synthesis Gene murF. J. Bacteriol. 189: 2376-2391 [Abstract] [Full Text]  
  • Frank, K. L., Reichert, E. J., Piper, K. E., Patel, R. (2007). In Vitro Effects of Antimicrobial Agents on Planktonic and Biofilm Forms of Staphylococcus lugdunensis Clinical Isolates. Antimicrob. Agents Chemother. 51: 888-895 [Abstract] [Full Text]  
  • Tu Quoc, P. H., Genevaux, P., Pajunen, M., Savilahti, H., Georgopoulos, C., Schrenzel, J., Kelley, W. L. (2007). Isolation and Characterization of Biofilm Formation-Defective Mutants of Staphylococcus aureus. Infect. Immun. 75: 1079-1088 [Abstract] [Full Text]  
  • Cerca, N., Jefferson, K. K., Oliveira, R., Pier, G. B., Azeredo, J. (2006). Comparative Antibody-Mediated Phagocytosis of Staphylococcus epidermidis Cells Grown in a Biofilm or in the Planktonic State.. Infect. Immun. 74: 4849-4855 [Abstract] [Full Text]  
  • Baillif, S., Casoli, E., Marion, K., Roques, C., Pellon, G., Hartmann, D. J., Freney, J., Burillon, C., Kodjikian, L. (2006). A Novel In Vitro Model to Study Staphylococcal Biofilm Formation on Intraocular Lenses under Hydrodynamic Conditions.. IOVS 47: 3410-3416 [Abstract] [Full Text]  
  • Pamp, S. J., Frees, D., Engelmann, S., Hecker, M., Ingmer, H. (2006). Spx Is a Global Effector Impacting Stress Tolerance and Biofilm Formation in Staphylococcus aureus. J. Bacteriol. 188: 4861-4870 [Abstract] [Full Text]  
  • Brady, R. A., Leid, J. G., Camper, A. K., Costerton, J. W., Shirtliff, M. E. (2006). Identification of Staphylococcus aureus Proteins Recognized by the Antibody-Mediated Immune Response to a Biofilm Infection.. Infect. Immun. 74: 3415-3426 [Abstract] [Full Text]  
  • Kelly-Quintos, C., Cavacini, L. A., Posner, M. R., Goldmann, D., Pier, G. B. (2006). Characterization of the Opsonic and Protective Activity against Staphylococcus aureus of Fully Human Monoclonal Antibodies Specific for the Bacterial Surface Polysaccharide Poly-N-Acetylglucosamine.. Infect. Immun. 74: 2742-2750 [Abstract] [Full Text]  
  • Schaffer, A. C., Solinga, R. M., Cocchiaro, J., Portoles, M., Kiser, K. B., Risley, A., Randall, S. M., Valtulina, V., Speziale, P., Walsh, E., Foster, T., Lee, J. C. (2006). Immunization with Staphylococcus aureus Clumping Factor B, a Major Determinant in Nasal Carriage, Reduces Nasal Colonization in a Murine Model. Infect. Immun. 74: 2145-2153 [Abstract] [Full Text]  
  • Grundling, A., Schneewind, O. (2006). Cross-Linked Peptidoglycan Mediates Lysostaphin Binding to the Cell Wall Envelope of Staphylococcus aureus.. J. Bacteriol. 188: 2463-2472 [Abstract] [Full Text]  
  • Luong, T. T., Dunman, P. M., Murphy, E., Projan, S. J., Lee, C. Y. (2006). Transcription Profiling of the mgrA Regulon in Staphylococcus aureus.. J. Bacteriol. 188: 1899-1910 [Abstract] [Full Text]  
  • Chang, W., Small, D. A., Toghrol, F., Bentley, W. E. (2006). Global Transcriptome Analysis of Staphylococcus aureus Response to Hydrogen Peroxide. J. Bacteriol. 188: 1648-1659 [Abstract] [Full Text]  
  • Erickson, D. L., Jarrett, C. O., Wren, B. W., Hinnebusch, B. J. (2006). Serotype Differences and Lack of Biofilm Formation Characterize Yersinia pseudotuberculosis Infection of the Xenopsylla cheopis Flea Vector of Yersinia pestis. J. Bacteriol. 188: 1113-1119 [Abstract] [Full Text]  
  • Tenover, F. C., McDougal, L. K., Goering, R. V., Killgore, G., Projan, S. J., Patel, J. B., Dunman, P. M. (2006). Characterization of a Strain of Community-Associated Methicillin-Resistant Staphylococcus aureus Widely Disseminated in the United States. J. Clin. Microbiol. 44: 108-118 [Abstract] [Full Text]  
  • Cerca, N., Martins, S., Sillankorva, S., Jefferson, K. K., Pier, G. B., Oliveira, R., Azeredo, J. (2005). Effects of Growth in the Presence of Subinhibitory Concentrations of Dicloxacillin on Staphylococcus epidermidis and Staphylococcus haemolyticus Biofilms. Appl. Environ. Microbiol. 71: 8677-8682 [Abstract] [Full Text]  
  • Johnson, M., Cockayne, A., Williams, P. H., Morrissey, J. A. (2005). Iron-Responsive Regulation of Biofilm Formation in Staphylococcus aureus Involves Fur-Dependent and Fur-Independent Mechanisms. J. Bacteriol. 187: 8211-8215 [Abstract] [Full Text]  
  • Blanco, A. R., Sudano-Roccaro, A., Spoto, G. C., Nostro, A., Rusciano, D. (2005). Epigallocatechin Gallate Inhibits Biofilm Formation by Ocular Staphylococcal Isolates. Antimicrob. Agents Chemother. 49: 4339-4343 [Abstract] [Full Text]  
  • Kropec, A., Maira-Litran, T., Jefferson, K. K., Grout, M., Cramton, S. E., Gotz, F., Goldmann, D. A., Pier, G. B. (2005). Poly-N-Acetylglucosamine Production in Staphylococcus aureus Is Essential for Virulence in Murine Models of Systemic Infection. Infect. Immun. 73: 6868-6876 [Abstract] [Full Text]  
  • Pelz, A., Wieland, K.-P., Putzbach, K., Hentschel, P., Albert, K., Gotz, F. (2005). Structure and Biosynthesis of Staphyloxanthin from Staphylococcus aureus. J. Biol. Chem. 280: 32493-32498 [Abstract] [Full Text]  
  • Trotonda, M. P., Manna, A. C., Cheung, A. L., Lasa, I., Penades, J. R. (2005). SarA Positively Controls Bap-Dependent Biofilm Formation in Staphylococcus aureus. J. Bacteriol. 187: 5790-5798 [Abstract] [Full Text]  
  • Brouillette, E., Hyodo, M., Hayakawa, Y., Karaolis, D. K. R., Malouin, F. (2005). 3',5'-Cyclic Diguanylic Acid Reduces the Virulence of Biofilm-Forming Staphylococcus aureus Strains in a Mouse Model of Mastitis Infection. Antimicrob. Agents Chemother. 49: 3109-3113 [Abstract] [Full Text]  
  • Shanks, R. M. Q., Donegan, N. P., Graber, M. L., Buckingham, S. E., Zegans, M. E., Cheung, A. L., O'Toole, G. A. (2005). Heparin Stimulates Staphylococcus aureus Biofilm Formation. Infect. Immun. 73: 4596-4606 [Abstract] [Full Text]  
  • Toledo-Arana, A., Merino, N., Vergara-Irigaray, M., Debarbouille, M., Penades, J. R., Lasa, I. (2005). Staphylococcus aureus Develops an Alternative, ica-Independent Biofilm in the Absence of the arlRS Two-Component System. J. Bacteriol. 187: 5318-5329 [Abstract] [Full Text]  
  • Chatterjee, I., Becker, P., Grundmeier, M., Bischoff, M., Somerville, G. A., Peters, G., Sinha, B., Harraghy, N., Proctor, R. A., Herrmann, M. (2005). Staphylococcus aureus ClpC Is Required for Stress Resistance, Aconitase Activity, Growth Recovery, and Death. J. Bacteriol. 187: 4488-4496 [Abstract] [Full Text]  
  • Tormo, M. A., Knecht, E., Gotz, F., Lasa, I., Penades, J. R. (2005). Bap-dependent biofilm formation by pathogenic species of Staphylococcus: evidence of horizontal gene transfer?. Microbiology 151: 2465-2475 [Abstract] [Full Text]  
  • Jefferson, K. K., Goldmann, D. A., Pier, G. B. (2005). Use of Confocal Microscopy To Analyze the Rate of Vancomycin Penetration through Staphylococcus aureus Biofilms. Antimicrob. Agents Chemother. 49: 2467-2473 [Abstract] [Full Text]  
  • Ramos, J. L., Martinez-Bueno, M., Molina-Henares, A. J., Teran, W., Watanabe, K., Zhang, X., Gallegos, M. T., Brennan, R., Tobes, R. (2005). The TetR Family of Transcriptional Repressors. Microbiol. Mol. Biol. Rev. 69: 326-356 [Abstract] [Full Text]  
  • Resch, A., Rosenstein, R., Nerz, C., Gotz, F. (2005). Differential Gene Expression Profiling of Staphylococcus aureus Cultivated under Biofilm and Planktonic Conditions. Appl. Environ. Microbiol. 71: 2663-2676 [Abstract] [Full Text]  
  • Sadovskaya, I., Vinogradov, E., Flahaut, S., Kogan, G., Jabbouri, S. (2005). Extracellular Carbohydrate-Containing Polymers of a Model Biofilm-Producing Strain, Staphylococcus epidermidis RP62A. Infect. Immun. 73: 3007-3017 [Abstract] [Full Text]  
  • Tormo, M. A., Marti, M., Valle, J., Manna, A. C., Cheung, A. L., Lasa, I., Penades, J. R. (2005). SarA Is an Essential Positive Regulator of Staphylococcus epidermidis Biofilm Development. J. Bacteriol. 187: 2348-2356 [Abstract] [Full Text]  
  • Fitzpatrick, F., Humphreys, H., O'Gara, J. P. (2005). Evidence for icaADBC-Independent Biofilm Development Mechanism in Methicillin-Resistant Staphylococcus aureus Clinical Isolates. J. Clin. Microbiol. 43: 1973-1976 [Abstract] [Full Text]  
  • Karaolis, D. K. R., Rashid, M. H., Chythanya, R., Luo, W., Hyodo, M., Hayakawa, Y. (2005). c-di-GMP (3'-5'-Cyclic Diguanylic Acid) Inhibits Staphylococcus aureus Cell-Cell Interactions and Biofilm Formation. Antimicrob. Agents Chemother. 49: 1029-1038 [Abstract] [Full Text]  
  • Fluckiger, U., Ulrich, M., Steinhuber, A., Doring, G., Mack, D., Landmann, R., Goerke, C., Wolz, C. (2005). Biofilm Formation, icaADBC Transcription, and Polysaccharide Intercellular Adhesin Synthesis by Staphylococci in a Device-Related Infection Model. Infect. Immun. 73: 1811-1819 [Abstract] [Full Text]  
  • Shaw, L. N., Golonka, E., Szmyd, G., Foster, S. J., Travis, J., Potempa, J. (2005). Cytoplasmic Control of Premature Activation of a Secreted Protease Zymogen: Deletion of Staphostatin B (SspC) in Staphylococcus aureus 8325-4 Yields a Profound Pleiotropic Phenotype. J. Bacteriol. 187: 1751-1762 [Abstract] [Full Text]  
  • Vuong, C., Kocianova, S., Voyich, J. M., Yao, Y., Fischer, E. R., DeLeo, F. R., Otto, M. (2004). A Crucial Role for Exopolysaccharide Modification in Bacterial Biofilm Formation, Immune Evasion, and Virulence. J. Biol. Chem. 279: 54881-54886 [Abstract] [Full Text]  
  • Arrizubieta, M. J., Toledo-Arana, A., Amorena, B., Penades, J. R., Lasa, I. (2004). Calcium Inhibits Bap-Dependent Multicellular Behavior in Staphylococcus aureus. J. Bacteriol. 186: 7490-7498 [Abstract] [Full Text]  
  • Frank, K. L., Hanssen, A. D., Patel, R. (2004). icaA Is Not a Useful Diagnostic Marker for Prosthetic Joint Infection. J. Clin. Microbiol. 42: 4846-4849 [Abstract] [Full Text]  
  • Conlon, K. M., Humphreys, H., O'Gara, J. P. (2004). Inactivations of rsbU and sarA by IS256 Represent Novel Mechanisms of Biofilm Phenotypic Variation in Staphylococcus epidermidis. J. Bacteriol. 186: 6208-6219 [Abstract] [Full Text]  
  • Beenken, K. E., Dunman, P. M., McAleese, F., Macapagal, D., Murphy, E., Projan, S. J., Blevins, J. S., Smeltzer, M. S. (2004). Global Gene Expression in Staphylococcus aureus Biofilms. J. Bacteriol. 186: 4665-4684 [Abstract] [Full Text]  
  • Bejarano, E. M., Schneider, R. P. (2004). Use of Fluorescent Lectin Probes for Analysis of Footprints from Pseudomonas aeruginosa MDC on Hydrophilic and Hydrophobic Glass Substrata. Appl. Environ. Microbiol. 70: 4356-4362 [Abstract] [Full Text]  
  • Gad, F., Zahra, T., Hasan, T., Hamblin, M. R. (2004). Effects of Growth Phase and Extracellular Slime on Photodynamic Inactivation of Gram-Positive Pathogenic Bacteria. Antimicrob. Agents Chemother. 48: 2173-2178 [Abstract] [Full Text]  
  • Handke, L. D., Conlon, K. M., Slater, S. R., Elbaruni, S., Fitzpatrick, F., Humphreys, H., Giles, W. P., Rupp, M. E., Fey, P. D., O'Gara, J. P. (2004). Genetic and phenotypic analysis of biofilm phenotypic variation in multiple Staphylococcus epidermidis isolates. J Med Microbiol 53: 367-374 [Abstract] [Full Text]  
  • Jefferson, K. K., Pier, D. B., Goldmann, D. A., Pier, G. B. (2004). The Teicoplanin-Associated Locus Regulator (TcaR) and the Intercellular Adhesin Locus Regulator (IcaR) Are Transcriptional Inhibitors of the ica Locus in Staphylococcus aureus. J. Bacteriol. 186: 2449-2456 [Abstract] [Full Text]  
  • Cucarella, C., Tormo, M. A., Ubeda, C., Trotonda, M. P., Monzon, M., Peris, C., Amorena, B., Lasa, I., Penades, J. R. (2004). Role of Biofilm-Associated Protein Bap in the Pathogenesis of Bovine Staphylococcus aureus. Infect. Immun. 72: 2177-2185 [Abstract] [Full Text]  
  • Lim, Y., Jana, M., Luong, T. T., Lee, C. Y. (2004). Control of Glucose- and NaCl-Induced Biofilm Formation by rbf in Staphylococcus aureus. J. Bacteriol. 186: 722-729 [Abstract] [Full Text]  
  • Neuhaus, F. C., Baddiley, J. (2003). A Continuum of Anionic Charge: Structures and Functions of D-Alanyl-Teichoic Acids in Gram-Positive Bacteria. Microbiol. Mol. Biol. Rev. 67: 686-723 [Abstract] [Full Text]  
  • Baddour, L. M., Bettmann, M. A., Bolger, A. F., Epstein, A. E., Ferrieri, P., Gerber, M. A., Gewitz, M. H., Jacobs, A. K., Levison, M. E., Newburger, J. W., Pallasch, T. J., Wilson, W. R., Baltimore, R. S., Falace, D. A., Shulman, S. T., Tani, L. Y., Taubert, K. A. (2003). Nonvalvular Cardiovascular Device-Related Infections. Circulation 108: 2015-2031 [Full Text]  
  • Knobloch, J. K.-M., Nedelmann, M., Kiel, K., Bartscht, K., Horstkotte, M. A., Dobinsky, S., Rohde, H., Mack, D. (2003). Establishment of an Arbitrary PCR for Rapid Identification of Tn917 Insertion Sites in Staphylococcus epidermidis: Characterization of Biofilm-Negative and Nonmucoid Mutants. Appl. Environ. Microbiol. 69: 5812-5818 [Abstract] [Full Text]  
  • Kodjikian, L., Burillon, C., Lina, G., Roques, C., Pellon, G., Freney, J., Renaud, F. N. R. (2003). Biofilm Formation on Intraocular Lenses by a Clinical Strain Encoding the ica Locus: A Scanning Electron Microscopy Study. IOVS 44: 4382-4387 [Abstract] [Full Text]  
  • Kodjikian, L., Burillon, C., Roques, C., Pellon, G., Freney, J., Renaud, F. N. R. (2003). Bacterial Adherence of Staphylococcus Epidermidis to Intraocular Lenses: A Bioluminescence and Scanning Electron Microscopy Study. IOVS 44: 4388-4394 [Abstract] [Full Text]  
  • Moretro, T., Hermansen, L., Holck, A. L., Sidhu, M. S., Rudi, K., Langsrud, S. (2003). Biofilm Formation and the Presence of the Intercellular Adhesion Locus ica among Staphylococci from Food and Food Processing Environments. Appl. Environ. Microbiol. 69: 5648-5655 [Abstract] [Full Text]  
  • Kaplan, J. B., Ragunath, C., Ramasubbu, N., Fine, D. H. (2003). Detachment of Actinobacillus actinomycetemcomitans Biofilm Cells by an Endogenous {beta}-Hexosaminidase Activity. J. Bacteriol. 185: 4693-4698 [Abstract] [Full Text]  
  • Beenken, K. E., Blevins, J. S., Smeltzer, M. S. (2003). Mutation of sarA in Staphylococcus aureus Limits Biofilm Formation. Infect. Immun. 71: 4206-4211 [Abstract] [Full Text]  
  • Caiazza, N. C., O'Toole, G. A. (2003). Alpha-Toxin Is Required for Biofilm Formation by Staphylococcus aureus. J. Bacteriol. 185: 3214-3217 [Abstract] [Full Text]  
  • Dobinsky, S., Kiel, K., Rohde, H., Bartscht, K., Knobloch, J. K.-M., Horstkotte, M. A., Mack, D. (2003). Glucose-Related Dissociation between icaADBC Transcription and Biofilm Expression by Staphylococcus epidermidis: Evidence for an Additional Factor Required for Polysaccharide Intercellular Adhesin Synthesis. J. Bacteriol. 185: 2879-2886 [Abstract] [Full Text]  
  • Kadurugamuwa, J. L., Sin, L., Albert, E., Yu, J., Francis, K., DeBoer, M., Rubin, M., Bellinger-Kawahara, C., Parr, T. R. Jr., Contag, P. R. (2003). Direct Continuous Method for Monitoring Biofilm Infection in a Mouse Model. Infect. Immun. 71: 882-890 [Abstract] [Full Text]  
  • Peacock, S. J., Moore, C. E., Justice, A., Kantzanou, M., Story, L., Mackie, K., O'Neill, G., Day, N. P. J. (2002). Virulent Combinations of Adhesin and Toxin Genes in Natural Populations of Staphylococcus aureus. Infect. Immun. 70: 4987-4996 [Abstract] [Full Text]  
  • Maira-Litran, T., Kropec, A., Abeygunawardana, C., Joyce, J., Mark III, G., Goldmann, D. A., Pier, G. B. (2002). Immunochemical Properties of the Staphylococcal Poly-N-Acetylglucosamine Surface Polysaccharide. Infect. Immun. 70: 4433-4440 [Abstract] [Full Text]  
  • Cucarella, C., Tormo, M. A., Knecht, E., Amorena, B., Lasa, I., Foster, T. J., Penades, J. R. (2002). Expression of the Biofilm-Associated Protein Interferes with Host Protein Receptors of Staphylococcus aureus and Alters the Infective Process. Infect. Immun. 70: 3180-3186 [Abstract] [Full Text]  
  • Li, Y.-H., Tang, N., Aspiras, M. B., Lau, P. C. Y., Lee, J. H., Ellen, R. P., Cvitkovitch, D. G. (2002). A Quorum-Sensing Signaling System Essential for Genetic Competence in Streptococcus mutans Is Involved in Biofilm Formation. J. Bacteriol. 184: 2699-2708 [Abstract] [Full Text]  
  • Campanac, C., Pineau, L., Payard, A., Baziard-Mouysset, G., Roques, C. (2002). Interactions between Biocide Cationic Agents and Bacterial Biofilms. Antimicrob. Agents Chemother. 46: 1469-1474 [Abstract] [Full Text]  
  • Dunne, W. M. Jr. (2002). Bacterial Adhesion: Seen Any Good Biofilms Lately?. Clin. Microbiol. Rev. 15: 155-166 [Abstract] [Full Text]  
  • Martin-Lopez, J. V., Perez-Roth, E., Claverie-Martin, F., Diez Gil, O., Batista, N., Morales, M., Mendez-Alvarez, S. (2002). Detection of Staphylococcus aureus Clinical Isolates Harboring the ica Gene Cluster Needed for Biofilm Establishment. J. Clin. Microbiol. 40: 1569-1570 [Full Text]  
  • de Silva, G. D. I., Kantzanou, M., Justice, A., Massey, R. C., Wilkinson, A. R., Day, N. P. J., Peacock, S. J. (2002). The ica Operon and Biofilm Production in Coagulase-Negative Staphylococci Associated with Carriage and Disease in a Neonatal Intensive Care Unit. J. Clin. Microbiol. 40: 382-388 [Abstract] [Full Text]  
  • Masalha, M., Borovok, I., Schreiber, R., Aharonowitz, Y., Cohen, G. (2001). Analysis of Transcription of the Staphylococcus aureus Aerobic Class Ib and Anaerobic Class III Ribonucleotide Reductase Genes in Response to Oxygen. J. Bacteriol. 183: 7260-7272 [Abstract] [Full Text]  

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowReprints and Permissions
Right arrow Copyright Information
Right arrow Books from ASM Press
Right arrow MicrobeWorld
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Cramton, S. E.
Right arrow Articles by Götz, F.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Cramton, S. E.
Right arrow Articles by Götz, F.