Previous Article | Next Article ![]()
Infection and Immunity, December 1999, p. 6329-6334, Vol. 67, No. 12
Department of Biological Sciences,
Received 30 June 1999/Returned for modification 16 August
1999/Accepted 9 September 1999
Ov20 is a structurally novel 20-kDa retinol binding protein
secreted by Onchocerca volvulus. Immunological and
biological investigation of this protein has been hampered by the
inability to maintain O. volvulus in a laboratory setting.
In an effort to find a system more amenable to laboratory
investigation, we have cloned, sequenced, and expressed cDNA encoding
homologues of Ov20 from two closely related filarial species,
Brugia malayi (Bm20) and Acanthocheilonema
viteae (Av20). Sequence comparisons have highlighted differences
in glycosylation of the homologues. We present here an analysis of
mouse immune responses to Ov20, Bm20, and Av20. The results suggest a
strong genetic restriction in response to native Bm20 that is overcome
when recombinant, nonnative material is used. Reactivity of human
filarial sera to the three recombinant proteins confirmed previous
specificity studies with Ov20 but highlighted important differences in
the reactivity patterns of the O. volvulus and B. malayi homologues that may be due to differences in glycosylation
patterns. Ov20 is a dominant antigen in infected individuals, while
Bm20 is not. The availability of the B. malayi homologue
enabled us to use defined murine reagents and inbred strains for
genetic analysis of responsiveness in a way that is not possible for
Ov20. However, the close sequence similarity between Ov20 and Av20
suggests that the A. viteae model may be more suited to the
investigation of the biological functions of Ov20.
Infection of humans by parasitic
filariae leads to a spectrum of clinical manifestations ranging from a
remarkable absence of responsiveness to severe immunopathological
conditions like elephantiasis and irreversible blindness (17, 21,
22). The final outcome of an infection, whether it be protective
immunity, tolerance, or disease development, is largely dependent on
the way in which the host immune system recognizes and responds to these multicellular organisms (16, 21, 22). To understand and unravel these complex immunological interactions between parasites and their mammalian hosts, it is crucial to look at specific responses to individual antigens.
Ov20 is an immunodominant glycoprotein antigen of Onchocerca
volvulus, the causative agent of river blindness in humans. A major part of the clone (OvMBP20/11) has shown a high degree of specificity to onchocerciasis sera, with sera from related nematodes failing to react despite homologues of this protein being present in
the other species (3, 4). The protein has been incorporated in a serodiagnostic tool to analyze human immune responses to Onchocerca infection (4, 5, 24).
Fluorescence-based ligand binding assays show the protein to contain a
high-affinity ligand binding site for retinol; algorithms which predict
secondary structure indicate a predominance of alpha helices, with no
evidence of the beta structures seen in retinol binding proteins
characterized so far (15). Ov20, thus represents a new class
of helix-rich retinol binding protein of unknown function and appears
to be confined to nematodes (15, 31).
The full-length cDNA corresponding to Ov20 has been isolated, and
extensive database searches failed to detect similarity to proteins of
known function; however, its antigenic and sequence conservation in a
wide range of nematodes suggests an important biological role
(31). The only other family of retinol binding proteins of
similar size and helicity are individual units of the polyprotein
allergens of nematodes such as ABA-1 of Ascaris suum and
gp15/400 of Brugia malayi (13, 14).
Retinoids have been implicated in a variety of biological functions in
vertebrate and nonvertebrate systems (6, 7, 11, 12, 29).
O. volvulus is known to sequester retinol to a concentration eight times in excess of the surrounding host tissue (30).
Initial clinical manifestations of onchocercal eye damage include night blindness, a symptom consistent with retinol deficiency
(25). Although the in vivo function of Ov20 with respect to
both the worm and the host is yet to be established, retinol
segregation, initial symptoms compatible with retinol deficiency, and
secretion of a unique immunodominant retinol binding protein suggest
that this molecule is worthy of further investigation. The lack of an
animal model for onchocerciasis has hampered further characterization of Ov20, creating a need for homologues of this molecule to be cloned
and expressed in parasite systems where animal work is possible. We
selected the human filarial parasite B. malayi, the causative agent of lymphatic filariasis, and the rodent filarial parasite Acanthocheilonema viteae, which because of its
close phylogenetic relationship to O. volvulus has been
considered a model for onchocerciasis.
The objectives of this study were twofold: first, to identify by
cloning of the homologous proteins a reliable candidate for modelling
the immune response to Ov20 and second, to analyze the immune
reactivity of infected mice and humans to the different recombinants to elucidate differences in protein structure that may influence immune responsiveness. Here we report on the isolation and expression of cDNA encoding the homologues of Ov20 in B. malayi (Bm20) and A. viteae (Av20). Sequence
comparisons highlighted differences in the pattern of glycosylation in
the homologues, allowing evaluation of the role of glycosylation in
antigen recognition. Further, the availability of sera from inbred mice
inoculated with B. malayi allowed a genetic analysis of
responsiveness that would not be possible for Ov20.
Cloning of Av20.
DNA encoding the A. viteae
homologue was amplified from an adult cDNA library with PCR and cloned
into pET-15b (Novagen, Madison, Wis.), with an intermediate cloning
into pUC18. The oligonucleotide primers for Ov20 used for the PCR
(Ov20HTF [5' CTC CAT ATG GCA AAT GTT GTT CCG TTT TC 3'] and Ov20HTR
[5' CTC GGA TCC TTA ATG TTT TCC GGC ACC 3']) were designed to
generate a protein starting from the predicted cleavage site for the
signal peptide, Asn17, of the Ov20 sequence. The inserts which were
originally cloned into SmaI-digested pUC18 by blunt-end
ligation and transformed into the Escherichia coli DH5 Cloning of Bm20.
Oligonucleotides derived from the Ov20
sequence were used to find the Brugia homologues. To obtain
the full-length Brugia sequence, the upstream primer was
used with an oligo (dT) primer, and the downstream primer was used with
a primer for the spliced leader sequence found on most B. malayi transcripts. Template DNA was derived from
Brugia adult or microfilarial cDNA amplified with the
spliced leader and oligo (dT) primers courtesy of Bill Gregory.
Sequences were also obtained from conventional microfilarial and adult
cDNA libraries provided by Steve Williams, Smith College. Oligonucleotides included XBA-1, NdeI, PstI, and
BamHI sites for ease of cloning. 5' oligonucleotides used
were Ov20XN (TTTCTAGAACCATGGCAAATGTTGTTCCTG), Ov20PB (CCGGATCCTGCAGTCTCTAATTCTTTTGCAGAA),
SL1-f3 (GCTCTAGAGCGGCCGCGGGGTTTAATTACCCAAGTTGGAG), and dGdT (AATTGGATCCCCCGGGT). Positive PCR
products were cloned into pBluescript (Promega, Madison, Wis.) and
sequenced. For expression, a new upstream
oligonucleotide that corresponded to the newly determined
Brugia sequence, BM20XN
(GTTTCTAGAACCATGGCAAATGTTATTCCTTTCT), was synthesized.
This oligonucleotide was used with dGdT, and the amplified product was
cloned into pET-15b (Novagen). The NcoI site of pET-15b,
which allowed expression of the sequence without the histidine tag, was
used. The expressed sequence starts with Met15, two amino acids before
the predicted peptide cleavage site.
Expression and purification of Bm20, Av20, and Ov20.
Bm20
and Av20 were expressed in the E. coli BLD21(DE3) with 1 mM
isopropyl 1- Sequencing.
Template plasmid DNA for sequencing was prepared
according to the protocol for the Wizard Miniprep kit (Promega) or
Plasmid Mini-kit (Qiagen). Sequencing was performed with an ABI PRISM terminator cycle sequencing ready reaction kit (Perkin-Elmer) using the
vector-specific forward and reverse primers, and analyzed on an ABI
PRISM 377 (Perkin-Elmer). Sequences and chromatograms were compared and
verified by using SeqEd version 1.0.3; translation, reading frame, and
predictions of secondary structure, molecular weight, and pI were
performed with MacVector version 4.1.4.
Parasite extracts.
Live adult worms were obtained from the
peritoneal cavities of B malayi-infected jirds
(Meriones unguiculatus). B. malayi antigen was
prepared by homogenization of adult worms in phosphate-buffered saline
on ice followed by centrifugation at 10,000 × g for 20 min. The supernatant was passed through a 0.5-µm-pore-size filter, and the protein concentration was determined by Bradford analysis.
Immunization and implantation sera.
Immunization sera were
obtained from BALB/c (H-2D, CBA
(H-2K), BALB.k (H-2K),
and B10.D2 (H-2D) mice immunized with Bm20 or
whole Brugia malayi antigen in Freund's complete adjuvant
(Sigma Immuno-chemicals). Implantation sera were from C57BL/6, BALB/c,
CBA, and BALB.k mice implanted intraperitoneally with adult B. malayi. Sera were taken 3 to 4 weeks after implantation with six
viable adult females and three to six viable adult males. Antiserum to
recombinant Ov20 and Ov20/11 was generated by immunization of mice with
the recombinant molecules produced in E. coli
(31). Ov20/11 is the fragment encoded by the major part of
the Ov20 cDNA clone, which was selected as a serodiagnostic tool on the basis of its specificity.
Human sera.
Onchocerciasis sera (35 samples) were obtained
from confirmed microfilaria-positive patients from an area with a high
transmission of onchocerciasis, the Sanega river basin in Cameroon.
Wuchereria bancrofti-positive sera were obtained from
microfilaria-positive individuals living in the Philippines or Sri
Lanka (22 samples). The B. malayi sera (16 samples) were
obtained from Sulawesi, Indonesia. The control sera (8 to 10 samples)
were obtained from individuals from areas in Ecuador and Sudan where
onchoceriasis is not endemic.
ELISAs.
The reactivity of the expressed proteins to mice
sera was assessed by an enzyme-linked immunosorbent assay (ELISA) at an
antigen concentration of 1 µg/ml and a serum dilution of 1/100.
Antibody binding was revealed by using an anti-mouse peroxidase
conjugate (Dakinopatts, Copenhagen, Denmark) at a dilution of 1/1,000
and tetramethylbenzidine (microwell) as substrate. The human serum ELISAs had an anti-human immunoglobulin G (clone MO 6014; Oxoid, New
York, N.Y.) monoclonal antibody as the secondary antibody and an
anti-mouse peroxidase conjugate as the tertiary antibody. The plates
were read 15 min after addition of the substrate on an ELISA reader at
an optical density of 405 nm.
Statistical analysis.
Differences in mean for selected data
were analyzed for significance by using a paired or unpaired Student
t test, as appropriate. Degrees of freedom were calculated
accordingly. P < 0.05 was taken as significant.
Nucleotide sequence accession number.
The fully confirmed
Bm20 sequence was submitted to GenBank and given accession no. U69169.
Sequence comparison.
Homologues of Ov20 were cloned from
B. malayi and A. viteae and sequenced for
comparison with the Onchocerca molecule. Expression and
purification of the recombinant homologues allowed the immunological analysis detailed below. Sequence comparison of Ov20, Bm20, and Av20
showed Ov20 and Av20 to be very similar, sharing three N-linked glycosylation sites (NX[S/T]) and differing in only nine amino acids
(97% similarity) (Fig. 1). The codings
for the three glycosylation sites were identical except for the
presence of a serine residue at position 46 in Av20 instead of a
threonine as in Ov20. The Bm20 sequence was more divergent, with 26 amino acid differences from Ov20 (91% similarity), resulting in the
loss of all three glycosylation sites found in Ov20. However, a new
N-linked glycosylation site was located near the carboxy terminus. It
is unlikely that this site is used, as previous studies have shown no
evidence that Bm20 is glycosylated (1a, 31). The signal
peptide sequence in Ov20 was conserved in the B. malayi
homologue. The mature Bm20 and Av20 proteins were predicted to have
molecular masses of 18.545 and 18.648 kDa, respectively.
Serological responses in mice exposed to live parasites or
recombinant proteins.
We have previously done extensive analysis
of immune responses in mice implanted with B. malayi
(1, 19, 20). This provided the necessary reagents for
analysis of serum reactivity to Bm20. Sera from mice implanted
intraperitoneally with live adult B. malayi were assayed for
reactivity to parasite antigens Bm20 and whole B. malayi
antigen, with maltose binding protein (MBP) serving as a nonspecific
control. While the BALB/c (H-2D), CBA
(H-2K), BALB.k (H-2K)
mouse strains failed to show significant reactivity to Bm20, C57BL/6
(H-2B) mice showed a high reactivity that was
significantly different from background MBP (P < 0.01) (Fig.
2). The results suggest a strong genetic
restriction in response to native Bm20 as had previously been observed
for gp15/400. The genetic restriction observed for gp15/400 was shown
to have both H-2 and non-H-2 components
(1). To assess the role of H-2 genes in the Bm20
responsiveness, BALB.b (H-2B) mice were
implanted with adult Brugia parasites and found to produce
antibody to Bm20, suggesting that the response is at least in part
H-2 restricted (data not shown). When the Bm20-reactive C57BL/6 serum was tested against all three recombinant proteins, Av20
and Ov20 were not recognized despite their sequence similarity to Bm20
(Fig. 3). This finding confirms previous
specificity studies with Ov20 (4).
0019-9567/99/$04.00+0
Copyright © 1999, American Society for Microbiology. All rights reserved.
Comparative Analysis of Glycosylated and Nonglycosylated Filarial
Homologues of the 20-Kilodalton Retinol Binding Protein from
Onchocerca volvulus (Ov20)
![]()
ABSTRACT
Top
Abstract
Introduction
Materials and Methods
Results
Discussion
References
![]()
INTRODUCTION
Top
Abstract
Introduction
Materials and Methods
Results
Discussion
References
![]()
MATERIALS AND METHODS
Top
Abstract
Introduction
Materials and Methods
Results
Discussion
References
were subcloned into pET-15b by using the NdeI and
BamHI sites.
-D-thiogalactopyranoside (Sigma, Dorset,
United Kingdom) induction, and host cells were lysed by lysozyme
treatment and sonication as described by the manufacturer (Novagen).
Bm20 was purified by fast protein liquid chromatography using an
anion-exchange column (Mono Q HR 5/5; Pharmacia, Uppsala, Sweden).
Purification initially used an increasing gradient of sodium chloride,
and further purification involved the use of step gradients. Expression of Av20 in the pET-15b expression vector utilized the polyhistidine domain to facilitate purification. Studies on Ov20 have shown that the
biochemical properties of the Ov20 bearing the His6
affinity tag and protein in which the tag had been removed with
thrombin were indistinguishable (15). In the interest of
reducing manipulation, therefore, all assays reported here were carried
out with the His6 tag fusion protein. Purification of Av20
was by affinity column chromatography as instructed by the manufacturer
(Novagen) for high yield. The purity of the recombinants was verified
on 15% polyacrylamide gels. Previously prepared Ov20 was available in
E. coli BLD21(DE3). Expression and purification have been
previously described (15).
![]()
RESULTS
Top
Abstract
Introduction
Materials and Methods
Results
Discussion
References

View larger version (36K):
[in a new window]
FIG. 1.
Alignment of the predicted amino acid sequences of the
retinol binding proteins Bm20, Ov20, and Av20. N-linked glycosylation
sites are underlined, and areas of homology among the three
recombinants are indicated (*). The fragment representing Ov11 is
highlighted.

View larger version (28K):
[in a new window]
FIG. 2.
Reactivity of BALB/c, BALB.k, C57BL/6, and CBA sera from
mice implanted intraperitoneally with live adult B. malayi.
Plates were coated with MBP, Bm20, and B. malayi extract
(Bma). The y axis represents optical density at 405 nm.
Dotted bars, control unimplanted animals; solid bars, parasite-exposed
animals. Standard deviations represent two to four animals in control
groups and three to five animals in implanted group.

View larger version (17K):
[in a new window]
FIG. 3.
Reactivity of sera from C57BL/6 mice implanted
intraperitoneally with B. malayi. Plates were coated with
recombinant Bm20, Ov20, and Av20. Standard deviations represent four to
six animals in each group. C57cont and C57imp, control and implanted
C57BL/6 mouse sera; O.D., optical density.
|
Serological responses of human filarial sera. In B. malayi, a 15-kDa retinol and lipid binding polyprotein allergen (gp15/400) which is immunodominant in elephantiasis has been characterized (1, 14, 23). One of the objectives of this report was to establish whether Bm20 was an immunogen in human filarial infection. The reactivity of the three proteins with a panel of human onchocerciasis and lymphatic filariasis sera was tested. The lymphatic filariasis sera included sera from both B. malayi- and W. bancrofti-infected individuals. B. malayi and W. bancrofti are very closely related both phylogenetically and pathologically. They both cause mosquito-borne diseases with identical worm locations in the mammalian host and cause very similar clinical symptoms. Ov20 and Av20 were recognized strongly by onchocerciasis sera (P < 0.001) but not by lymphatic filariasis sera, confirming previous studies on the specificity of Ov20 (Fig. 5) (4). In contrast to Ov20 recognition by onchocerciasis sera, Bm20 recognition by B. malayi sera was only marginally significant despite the presence of the homologue in the parasite. W. bancrofti sera showed no significant reactivity to any of the three proteins. The slight differences in reactivity between B. malayi and W. bancrofti is most likely due to differences in geographic localization, as no significant reactivity to Bm20 was observed in 28 B. malayi sera representing four clinical categories from Sumatra, Indonesia (data not shown). In all cases, the sera showed strong reactivity to whole parasite extract.
|
| |
DISCUSSION |
|---|
|
|
|---|
Sequence comparison of the Ov20 homologues showed close similarity between Ov20 and Av20 at both nucleotide and amino acid levels, while the Bm20 sequence was more divergent. Significantly, major differences were seen in the coding for N-linked glycosylation sites. Three shared sites in Ov20 and Av20 were replaced by a single new site in Bm20. The closer relationship between Ov20 and Av20 compared to Bm20 is not supported by phylogenetic analysis based on small-subunit rRNA sequencing of O. volvulus, B. malayi, and A. viteae (2a), suggesting that the changes may reflect important functional differences between these molecules in the different organisms. The secondary structure predicted for Ov20 is a short alpha helix at the N terminus, corresponding to amino acids 30 to 46 of Ov20, followed by three longer alpha helices (15, 26). Two copies of a degenerate repeat (Ile-Pro-Glu-Glu-tyr/Val-Lys-Asn/Glu-Phe) seen in the region corresponding to the short alpha helix of Ov20 also appears to be conserved in the B. malayi and A. viteae homologues. The presence of a signal peptide in both Ov20 and Bm20 suggests that the proteins are secreted, but the localization of Bm20 has not been confirmed. Immunoprecipitation studies of the Av20 model have confirmed secretion in all life cycle stages (21a).
In this study, four inbred strains of mice were exposed to Bm20 in three contexts: by infection with live parasites, by adjuvant-assisted immunization with the native molecule, and by immunization with a recombinant molecule. Our results show that the antibody responses to the native molecule are controlled by factors within the H2 complex but that the restriction observed was overcome by immunization with the E. coli-derived recombinant protein. We have previously observed a high level of genetic restriction in the murine response to the polyprotein allergen gp15/400 of B. malayi at both antibody and T-cell levels (1). These results suggest that features of the native molecule interfere with its ability to be recognized by host T cells.
We had originally proposed that glycosylation alters processing or presentation of the antigen, but the absence of glycosylation in native Bm20 suggests that the restricted response is determined by other factors. It is intriguing to consider that Bm20 and gp15/400, both retinol binding proteins, may bind similar ligands in vivo, which may affect processing or recognition of these molecules. Sera from mice immunized with Ov20 and Bm20 E. coli recombinant molecules recognized all three homologues (Ov20, Av20, and Bm20). In contrast, human onchocerciasis sera recognized only Ov20 and Av20, consistent with the close sequence relationship between these two proteins. The difference in reactivity to Bm20 observed between mice immunized with Ov20 and its specific fragment Ov20/11 suggests that the central portion of the molecule determines species specificity (Fig. 4). The close relationship between Ov20 and Av20 suggests that Av20 could be used in an A. viteae infection model in mice to investigate the biological functions of Ov20, which have up to now been hampered by the inability to maintain O. volvulus in a laboratory setting.
The reactivity patterns of Bm20, however, were distinct from those of the other molecules, as sera from patients infected with B. malayi failed to recognize it, suggesting that antigenic epitopes are not exposed to the immune system during the natural course of the infection in humans. However, the ability of C57BL/6 to respond strongly to Bm20 during live infection suggests that antigenic epitopes are in fact accessible and that alternative explanations for the lack of reactivity in the human population may be needed. It is possible that active suppression of Bm20 or competition with more dominant antigens or rapid degradation contributes to this nonresponsiveness observed in the human host. Ov20 is immunodominant in O. volvulus, but its homologue in B. malayi is apparently not. It is unlikely that sequence differences alone could explain the nonresponsiveness of Brugia sera to Bm20.
The possible role of glycosylation in immunomodulation is an interesting area of future study. Carbohydrates may be important in determining which epitopes are processed or presented to the immune system (33), and the differential glycosylation observed in the three molecules may contribute to the differential reactivity observed. Furthermore, glycosylation may determine extracellular stability, as one of the key functions of glycosylation is to protect proteins from proteolytic degradation; i.e., Bm20 may be secreted but more rapidly degraded. Yet another possible explanation is the presence of a sheath in B. malayi microfilariae which could impede secretion of the protein into host tissue and thereby reduce tissue Bm20 levels significantly. It is intriguing to consider the possibility that gp15/400, a protein which has a profile of retinol binding similar to those of Ov20 (14) and Bm20 (12a) and is both immunodominant and glycosylated, may play the role of Ov20 in Brugia infection.
The function of Ov20 (and its homologues) in vivo remains to be established, but there are a number of reasons why this retinol binding molecule may play a critical role in the immunity and pathogenesis of filarial nematode infections. The role of retinoids other than in vision is an area considerable interest (2, 9, 10, 32). Filariae concentrate and store retinol in excess of host tissue (28, 30). Retinoids have been shown to be important in development of a type 2 immune response, with vitamin A-deficient mice displaying a tendency toward a type 1 response, an effect occurring at the level of antigen-presenting cells as well as at the T-cell level (6, 8). Retinoids influence collagen gene expression, and collagen formation plays a major role in the pathogenesis of onchocerciasis (7). It may be relevant here that a 19-kDa retinol binding protein from O. volvulus is reported to bind ivermectin, the drug currently used for control of the disease (18, 27, 28). The fact that Ov20 appears to have no counterpart in the mammalian host is encouraging in that it could provide a novel therapeutic target for onchocerciasis therapy.
It is crucial that further studies be done to establish the functional significance of this retinol binding protein, and it is our hope that the cloning of its homologues (Bm20 and Av20) and the availability of two different model systems will help achieve this objective. The greater similarity in both immune reactivity and glycosylation between Av20 and Ov20 suggests that Av20 would be the better model antigen. In addition, important differences in the reactivity patterns of the O. volvulus and B. malayi homologues suggest that differences in the immune recognition of this molecule in the two parasite systems may be due to differences in glycosylation.
| |
ACKNOWLEDGMENTS |
|---|
We thank Mark Blaxter, Andrew MacDonald, and Bill Gregory for valuable assistance.
J. Allen is an MRC senior research fellow. N. Nirmalan is a recipient of the Overseas research student award. This work was supported by the INCO-DC programme of the European Commission, the Edna McConnell Foundation, and the MRC.
| |
FOOTNOTES |
|---|
* Corresponding author. Mailing address: ICAPB Ashworth Laboratories, University of Edinburgh, Edinburgh EH9 3JT, United Kingdom. Phone: 44-131-650-7014. Fax: 44-131-650-5450. E-mail: J.Allen{at}ed.ac.uk.
Editor: J. M. Mansfield
| |
REFERENCES |
|---|
|
|
|---|
| 1. | Allen, J. E., R. A. Lawrence, and R. M. Maizels. 1995. Fine specificity of genetically controlled immune response to native and recombinant gp15/400 (polyprotein allergen) of Brugia malayi. Infect. Immun. 63:2892-2898[Abstract]. |
| 1a. | Allen, J. E. Unpublished data. |
| 2. | Andersen, B., and M. G. Rosenfield. 1995. New wrinkles in retinoids. Nature 374:118-119[Medline]. |
| 2a. | Blaxter, M. Personal communication. |
| 3. | Bradley, J. E., R. Helm, M. Lahaise, and R. M. Maizels. 1991. cDNA clones of Onchocerca volvulus low molecular weight antigens provide immunologically specific diagnostic probes. Mol. Biochem. Parasitol. 46:219-227[Medline]. |
| 4. | Bradley, J. E., K. R. Trenholme, A. Gillespie, R. Guderian, V. Titanji, Y. Hong, and L. McReynolds. 1993. A sensitive serodiagnostic test for onchocerciasis using a cocktail of recombinant antigens. Am. J. Trop. Med. Hyg. 48:198-204. |
| 5. | Bradley, J. E., L. Elson, T.I.M. Tree, G. Stewart, R. Guderian, M. Calvopina, W. Parredes, E. Araujo, and T. B. Nutman. 1995. Resistance to Onchocerca volvulus: differential cellular and humoral responses to a recombinant antigen Ov20/11. J. Infect. Dis. 172:831-837[Medline]. |
| 6. | Cantorna, M. T., F. E. Nashold, T. Y. Chun, and C. E. Hayes. 1996. Vitamin A down regulation of IFN-gamma synthesis in cloned mouse Thl lymphocytes depends on the CD28 costimulatory pathway. J. Immunol. 156:2674-2670[Abstract]. |
| 7. | Chen, M., S. Goyal, X. Cai, E. A. O'Toole, and D. T. Woodley. 1997. Modulation of type VII collagen (anchoring fibiril) expression by retinoids in human skin cells. Biochim. Biophys. Acta 1354:333-340. |
| 8. |
Garbe, A. J.,
J. Buck, and U. Hammerling.
1992.
Retinoids are important cofactors in T cell activation.
J. Exp. Med.
176:109-117 |
| 9. |
Giguere, B.
1994.
Retinoic acid receptors and cellular retinoid binding proteins: complex interplay and retinoid signalling.
Endocrine Rev.
15:61-79 |
| 10. | Gudas, L. J., M. B. Sporn, and A. B. Roberts. 1994. Cellular biology and biochemistry of retinoids, p. 443-520. In M. B. Sporn, A. B. Sporn, and D. S. Goodman (ed.), The retinoids. Raven Press, New York, N.Y. |
| 11. |
Hayashi, A.,
T. Suzuki, and S. Tajima.
1994.
Modulation of elastin expression and cell proliferation by retinoids in cultured vascular smooth muscle cells.
J. Biochem.
117:132-136 |
| 12. |
Hong, W. K., and M. B. Sporn.
1997.
Recent advances in chemoprevention of cancer.
Science
278:1073-1077 |
| 12a. | Kennedy, M. W. Personal communication. |
| 13. | Kennedy, M. W., A. Brass, A. B. McCruden, N. C. Price, S. M. Kelly, and A. Cooper. 1995. The ABA-1 allergen of the parasitic nematode Ascaris suum. Fatty acid and retinol binding function and structural characterisation. Biochemistry 34:6700-6710[Medline]. |
| 14. | Kennedy, M. W., J. E. Allen, A. S. Wright, A. B. McCruden, and A. Cooper. 1995. The gp15/400 polyprotein antigen of Brugia malayi binds fatty acids and retinoids. Mol. Biochem. Parasitol. 71:41-50[Medline]. |
| 15. |
Kennedy, M. W.,
L. H. Garside,
L. E. Goodrick,
L. McDermott,
A. Brass,
N. C. Price,
S. M. Kelly,
A. Cooper, and J. E. Bradley.
1997.
The Ov 20 protein on the parasitic nematode Onchocerca volvulus: a structurally novel class of small helix rich retinol binding protein.
J. Biol. Chem.
272:29442-29448 |
| 16. | King, C. L., and T. B. Nutman. 1991. Regulation of the immune response in lymphatic filariasis and onchocerciasis. Immunol. Today 12:A54-A57[Medline]. |
| 17. | Kirkwood, B., P. Smith, T. Marshal, and A. Prost. 1983. Relationships between mortality, visual acuity and microfilarial load in the area of the onchocerciasis control programme. Trans. R. Soc. Trop. Med. Hyg. 76:862-868. |
| 18. | Lal, P. G., and E. R. James. 1996. Onchocerca retinol- and ivermectin-binding protein activity. Parasitology 112:211-225. |
| 19. | Lawrence, R. A., J. E. Allen, W. F. Gregory, M. Kopf, and R. M. Maizels. 1995. Infection of IL-4 deficient mice with the parasitic nematode Brugia malayi demonstrates that host resistance is not dependent on a T helper 2 dominated immune response. J. Immunol. 154:5995-6001[Abstract]. |
| 20. | Lawrence, R. A., J. E. Allen, J. Osborne, and R. M. Maizels. 1994. Adult and microfilarial stages of the filarial parasite Brugia malayi stimulate contrasting cytokine and Ig isotype responses in BALB/c mice. J. Immunol. 154:1216-1224[Abstract]. |
| 21. | Maizels, R. M., and R. A. Lawrence. 1991. Immunological tolerance: the key feature in human filariasis? Parasitol. Today 7:271-276. [Medline] |
| 21a. | Nirmalan, N. Unpublished data. |
| 22. | Ottesen, E. A. 1992. Infection and disease in lymphatic filariasis: an immunological perspective. Parasitology 104:S71-S79. |
| 23. |
Paxton, W. A.,
M. Yazdanbakhsh,
I. Kurniawan,
F. Partono,
R. M. Maizels, and M. E. Selkirk.
1993.
Primary structure of immunoglobulin E responses to the repeat subunit of gp15/400 from human lymphatic filarial parasites.
Infect. Immun.
61:2827-2833 |
| 24. | Ramachandran, C. P. 1993. Improved immunodiagnostic tests to monitor onchocerciasis control programs: a multicenter effort. Parasitol. Today 9:76-79. |
| 25. | Rodger, F. C. 1962. A review of recent advances in scientific knowledge of the symptomatology, pathology and pathogenesis of onchocercal infections. Bull. W. H. O. 27:429-448[Medline]. |
| 26. | Rost, B., and C. Sander. 1993. Prediction of protein structure at better than 70% accuracy. J. Mol. Biol. 232:584-599[Medline]. |
| 27. | Sani, B. P., A. Vaid, J.C.W. Comley, and J. A. Montgomery. 1985. Novel retinol binding proteins from filarial parasites. Biochem. J. 232:577-583[Medline]. |
| 28. | Sani, B. P., and A. Vaid. 1988. Specific interaction of Ivermectin with retinol binding protein from filarial parasites. Biochem. J. 249:929-932[Medline]. |
| 29. | Semba, R. D., Muhilal, B. J. Ward, D. E. Griffin, A. L. Scott, G. Natadisastra, G. West, and A. Sommer. 1993. Abnormal T-cell subset proportions in vitamin-A-deficient children. Lancet 341:5-8[Medline]. |
| 30. | Sturchler, D. F., F. Wyss, and A. Hanck. 1981. Retinol, onchocerciasis and Onchocerca volvulus. Trans. R. Soc. Trop. Med. Hyg. 75:617[Medline]. |
| 31. | Tree, T.I.M., A. J. Gillespie, K. J. Shepley, M. L. Blaxter, R. S. Tuan, and J. E. Bradley. 1995. Characterisation of an immunodominant glycoprotein antigen of Onchocerca volvulus with homologues in other filarial nematodes and Caenorhabditis elegans. Mol. Biochem. Parasitol. 69:185-195[Medline]. |
| 32. | Wolf, G. 1996. The regulation of retinoic acid formation. Nutr. Rev. 54(b):182-184[Medline]. |
| 33. | Zhiyong, Q. Y., F. Tufaro, and S. Gillam. 1992. The influence of N-linked glycosylation on the antigenicity and immunogenicity of rubella E1 glycoprotein. Virology 190:876-881[Medline]. |
This article has been cited by other articles:
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Copyright © 2009 by the American Society for Microbiology. For an alternate route to Journals.ASM.org, visit: http://intl-journals.asm.org | More Info»