Previous Article | Next Article ![]()
Infection and Immunity, December 1999, p. 6434-6438, Vol. 67, No. 12
Cooperative Research Centre for Vaccine
Technology Unit,
Received 1 March 1999/Returned for modification 7 June
1999/Accepted 14 September 1999
A large-scale DNA vaccination trial was performed with sheep to
investigate whether an antigen targeted by CTLA-4 enhanced and
accelerated the humoral immune response. Vaccination with genetically
detoxified phospholipase D ( Since its first demonstration in
mice, a number of studies have shown that DNA vaccination can induce
specific antibody and cell-mediated immune responses to a variety of
bacterial, viral, and parasitic antigens (9). Although
nucleic acid vaccination has generated a great deal of interest within
veterinary research, there have been few published reports of the use
of DNA vaccination for domestic livestock species. One of the first
reports demonstrated that cattle immunized with DNA encoding a bovine
herpesvirus glycoprotein generated neutralizing-antibody titers
sufficient to reduce virus shedding following a herpesvirus infection
(6). However, a number of studies have since shown that
multiple doses of DNA encoding parasite and viral antigens in sheep
(19) and cattle (20) induce responses which are
weak and short-lived. Indeed, the level of protection provided by DNA
vaccines is often inferior to that provided by conventional and subunit
vaccines (19, 20). Recently, we devised a novel approach of
directing antigen to sites of immune induction by vaccination with DNA
encoding antigen as a CTLA-4 fusion protein (3). This study
showed that targeting the antigen as a fusion protein enhanced both the
speed and the magnitude of the immune response. On this basis we have
used this targeting strategy in the present study, in an attempt to
improve the poor immune responses following DNA vaccination in domestic outbred species.
Corynebacterium pseudotuberculosis, a gram-positive
intracellular pathogen, is the causative agent of caseous lymphadenitis (CLA) in sheep. Transmission of this disease is believed to occur via
skin wounds or by aerosol infection, and it is characterized by the
formation of abscesses within the superficial lymph nodes, in addition
to those draining the lungs. C. pseudotuberculosis secretes
phospholipase D (PLD), which is thought to mediate dissemination of the
pathogen within the host by increasing local vascular
permeability. This exotoxin has been characterized as a major
virulence factor, since PLD-specific antibodies are
correlated with protection against CLA (10) and a
genetically toxoided PLD ( In this study we investigated whether the genetically attenuated Generation of DNA constructs.
A pCI plasmid (Promega)
encoding a CD5 leader (CD5L)-human immunoglobulin (hIg) fusion protein
(3) was used to construct the plasmids encoding the proteins
used in the vaccine trial: bovine (bo) CTLA-4-hIg,
boCTLA-4-hIg-
0019-9567/99/$04.00+0
Copyright © 1999, American Society for Microbiology. All rights reserved.
Targeting Improves the Efficacy of a DNA Vaccine
against Corynebacterium pseudotuberculosis in
Sheep
![]()
ABSTRACT
Top
Abstract
Introduction
Materials and Methods
Results
Discussion
References
PLD) has been shown to be effective, at
least partially, against Corynebacterium
pseudotuberculosis, the causal agent of caseous lymphadenitis in
sheep. CTLA-4 binds to B7 on antigen-presenting cells and thus was used
to direct the fusion antigens to sites of immune induction. Here we
demonstrated that targeting
PLD as a CTLA-4 fusion protein
significantly enhanced the speed, magnitude, and longevity of the
antibody response compared to that obtained with DNA encoding
PLD.
While all groups of sheep vaccinated with DNA encoding
PLD were
afforded better protection against an experimental challenge with
C. pseudotuberculosis than those immunized with an
irrelevant plasmid or those left unimmunized, the best protection was
provided by the targeted DNA vaccine. We propose that targeting
antigens to antigen-presenting cells offers a generic strategy for
enhancing the efficacy of DNA vaccines.
![]()
INTRODUCTION
Top
Abstract
Introduction
Materials and Methods
Results
Discussion
References
PLD) has been demonstrated to
protect sheep from CLA (13). Although a commercial vaccine is currently produced from a formalin-inactivated, PLD-rich C. pseudotuberculosis supernatant, the potential of DNA to elicit a
long-lived humoral and cytotoxic T-lymphocyte response following a
single dose in mice (7) offers a great advantage over
such conventional attenuated vaccines.
PLD
delivered as a DNA vaccine could provide protection against CLA and
whether the protective humoral response could be accelerated and
enhanced by targeting
PLD as a CTLA-4 fusion protein.
![]()
MATERIALS AND METHODS
Top
Abstract
Introduction
Materials and Methods
Results
Discussion
References
PLD, and CD5L-hIg-
PLD. CD5L refers to the leader
sequence of the human CD5 molecule, which is required to ensure the
secretion of the hIg-
PLD fusion protein. By using site-specific
mutagenesis, the PLD gene was inactivated by replacing a histidine with
a serine residue within the enzyme active site (22); this
PLD gene was then subcloned into pCI.
PLD constructs, the signal sequence of
PLD
was removed by PCR using the forward
(ATAATAACGCGTGCGCCTGTTGTGCATAACCCA) and
reverse (ATAATATCTAGATCACCACGGGTTATCCTCTTCG)
primers, which incorporated restriction sites (in italics) for
cloning. This product was cloned into the
MluI/XbaI sites of boCTLA-4-hIg and CD5L-hIg to
create the constructs boCTLA-4-hIg-
PLD and CD5L-hIg-
PLD.
Analysis of protein expression.
Plasmid constructs (1 µg)
were transfected into COS-M6 cells (5 × 105) by using
the Lipofectamine-Plus reagent according to the protocol supplied
(Gibco-BRL). Three days posttransfection, the serum-free supernatants
were harvested and used to establish whether the plasmid constructs had
expressed functional proteins. The supernatants from COS-M6 cells
transfected with the plasmid encoding
PLD were analyzed by Western
blotting using a sheep polyclonal antibody raised against PLD
(13) and were compared to native PLD expressed in COS-M6
cells and C. pseudotuberculosis. To establish the level of
glycosylation, the
PLD protein was incubated at 37°C for 24 h
with three N-deglycosidases (H, F, and A) and one O-deglycosidase (Boehringer) prior to Western blot analysis.
PLD) were analyzed for their abilities to bind to
ovine lymphocytes isolated from afferent lymph by using flow cytometry
as previously described (15). Afferent lymph was obtained by
cannulation of the pseudoafferent duct following the removal of the
prescapular lymph node (11).
Serological assays.
Sera were collected from the sheep at
weekly intervals and assayed for the presence of antibodies to
PLD
and hIg by a standard enzyme-linked immunosorbent assay (ELISA).
Recombinant
PLD was expressed in a PLD-negative strain of C. pseudotuberculosis grown in CLA medium (kindly provided by CSL
Limited, Parkville, Australia) and dialyzed against phosphate-buffered
saline (PBS). The
PLD represented >90% of the protein in these
culture supernatants, as judged by sodium dodecyl
sulfate-polyacrylamide gel electrophoresis, and was used to coat the
ELISA plates at a 1/10 dilution. For the detection of anti-hIg
antibodies, the plates were coated with 5 µg of hIg protein (CSL
Limited)/ml. The sera were diluted in twofold steps, usually starting
at 1/100, although 1/10 dilutions were also used to increase the
sensitivity of the ELISA for the detection of low levels of antibody to
PLD and hIg. Antibody titers were calculated by linear regression on
a double logarithmic scale by using the linear part of the graph, and
the titer was defined as the dilution that resulted in an optical
density of 0.3. An arbitrary value of 1 was given when no antibody
titer could be determined.
Sheep vaccination and experimental challenge.
Three-month-old crossbred merino ewes were selected from a flock with
no history of vaccination or CLA. Animals were prescreened for the
presence of antibodies to
PLD and to a whole-cell C. pseudotuberculosis lysate by ELISA, and negative animals were divided into seven groups of 10 sheep. At day 0, animals received an
intramuscular injection in the left quadricep of 500 µg of plasmid
DNA (encoding either
PLD, boCTLA-4-hIg, boCTLA-4-hIg-
PLD, or
CD5L-hIg-
PLD) in 5 ml of PBS. Control animals received either the
commercial vaccine Glanvac 3 (CSL Limited) or the plasmid pCI or were
left unimmunized. Glanvac 3 contains formalin-inactivated toxins from
two clostridial species and the C. pseudotuberculosis PLD
component. All animals received a second injection of the same vaccine,
at the same dose, 4 weeks later. All sheep were challenged 6 weeks
after the primary immunization with a pathogenic wild-type strain of
C. pseudotuberculosis, C231. Bacterial cultures were grown
to late-log phase in brain heart infusion (BHI) broth (Difco
Laboratories), and 106 CFU of C. pseudotuberculosis C231 was injected just above the coronet of the
right hind lateral claw. A full necropsy of all animals was performed 6 weeks postchallenge to assess the efficacy of the treatments. The left
and right hind popliteal, inguinal, and prefemoral lymph nodes were
dissected to be visually assessed for the characteristic abscesses
associated with CLA. In addition, the lungs were palpated and samples
were taken from the abscesses identified in all sites for bacterial
culture on BHI plates containing sheep erythrocytes and
Rhodococcus equi supernatant (12) to confirm the
presence of C. pseudotuberculosis. Protection was defined by
the absence of the characteristic CLA abscesses after animal numbers
were matched with treatments at the end of the necropsy.
Statistical analysis. Statistical analysis was performed with the Systat program. The nonparametric Mann-Whitney U test was performed, and P values below 0.05 were considered significant.
| |
RESULTS |
|---|
|
|
|---|
Expression of
PLD in eukaryotic cells.
PLD is a
bacterial gene product and was cloned into pCI, retaining the
prokaryote signal sequence. To ensure that this protein was expressed
and secreted in eukaryotic cells,
PLD was transiently expressed in
COS-M6 cells. Supernatants from these COS-M6 cells reacted with
anti-PLD sera in a Western blot to reveal a band of 37 kDa (Fig.
1). This was larger than the size
expected for native PLD and for
PLD expressed in C. pseudotuberculosis, 31 kDa (Fig. 1). Furthermore, when
PLD
expressed in COS-M6 cells was treated with deglycosidases, the apparent
molecular mass of
PLD decreased from 37 to 31 kDa (Fig. 1). However,
the glycosylation of PLD in eukaryotic cells did not affect functional
activity, as evidenced by the fact that the native PLD expressed in
COS-M6 cells displayed the characteristic hemolytic activity associated with the native C. pseudotuberculosis PLD (data not shown).
|
Evaluation of CTLA-4 fusion proteins.
To establish whether the
construct encoding boCTLA-4-hIg-
PLD encoded a functional
CTLA-4-hIg fusion protein, this vector was transiently expressed
in COS-M6 cells and the supernatants were evaluated by staining
of ovine afferent lymphocytes using flow cytometry. COS-M6 supernatants
containing the boCTLA-4-hIg-
PLD fusion protein stained 21% of the
afferent lymphocytes, as determined by using an
anti-hIg-fluorescein isothiocyanate conjugate (data not shown).
However, supernatants from COS-M6 cells transfected with the
construct encoding CD5L-hIg-
PLD failed to stain ovine lymphocytes. Furthermore, the
PLD component of the
boCTLA-4-hIg-
PLD fusion protein did not affect the binding of
boCTLA-4, as shown by the fact that a similar percentage of cells
stained with a boCTLA-4-hIg fusion protein. Double staining revealed
that the majority of cells expressing CD80/CD86 as determined by
staining with the boCTLA-4-hIg fusion proteins had a dendritic-cell
phenotype, as indicated by their large size and expression of high
levels of major histocompatibility complex (MHC) class I, MHC class II, and CD1b (data not shown).
Improvement in the antibody response to hIg by targeting.
To
determine the antibody responses to both hIg and
PLD, the animals
were bled weekly and specific titers were determined by ELISA. Titers
of antibody to hIg following DNA vaccination reflect the antibody
response generated to the hIg part of the fusion proteins
boCTLA-4-hIg, boCTLA-4-hIg-
PLD, and CD5L-hIg-
PLD. By
directly comparing the antibody responses to hIg of the groups of
animals immunized with boCTLA-4-hIg-
PLD and boCTLA-4-hIg, on the
one hand, with that of the group receiving the DNA encoding CD5L-hIg-
PLD, on the other hand, it is possible to evaluate the effect of targeting hIg as a boCTLA-4 fusion protein. In the animals that received the DNA encoding CD5L-hIg-
PLD there was a weak antibody response to hIg (titers of <100), although the levels increased following a DNA boost at week 4, reaching a peak at week 6 (Fig. 2). In contrast, the antibody
response in the animals immunized with boCTLA-4-hIg was detected
earlier (week 3) and reached a peak response at week 4, which was two
times greater (P = 0.007) than the antibody titers
generated in the animals immunized with CD5L-hIg-
PLD. A similar
significantly (P < 0.05) enhanced early antibody
response was observed at weeks 2, 3, 4, and 5 for the animals
that received the boCTLA-4-hIg-
PLD construct (Fig. 2). The
antibody response to hIg was undetectable in all groups by week 10 (data not shown).
|
Improvement of the antibody response to
PLD by targeting.
The titers of antibody to
PLD were low in all the treatment groups
(<1,000) for the first 6 weeks prior to the experimental challenge
with C. pseudotuberculosis (Fig.
3A). Indeed, the only two groups that had
significant titers of antibody to
PLD in the first 4 weeks were
those immunized with either the DNA encoding boCTLA-4-hIg-
PLD or
Glanvac 3. These antibody titers were detected as early as 2 weeks
postimmunization and were significantly enhanced (P < 0.05) compared to those of all the other treatment groups up to
week 5. Although the antibody titers for the Glanvac 3 control group
increased following the boost at week 4, there appeared to be no boost
effect in the animals immunized with the DNA encoding boCTLA-4-hIg-
PLD. In contrast, the mean antibody titers in the animals immunized with DNA encoding
PLD had increased to levels similar to those of the animals receiving boCTLA-4-hIg-
PLD by week
6.
|
PLD had been successfully primed against native PLD, as
shown by the fact that by 2 weeks postchallenge the mean antibody
titers had increased to >5,000. Furthermore, this postchallenge antibody response generated by all the DNA constructs encoding
PLD
was equivalent to the peak antibody titers generated by the formalin-inactivated protein vaccine Glanvac 3. However, the antibody response to
PLD was short-lived in the groups of animals immunized with
PLD and CD5L-hIg-
PLD; these antibody titers dropped back to the level of the control group receiving DNA encoding boCTLA-4-hIg by week 9 (3 weeks postchallenge). In contrast, when
PLD was targeted as a boCTLA-4 fusion protein, the antibody titers remained at
levels significantly higher than those of the groups immunized with DNA
encoding CD5L-hIg-
PLD (P = 0.007) and
PLD
(P = 0.003) at week 10 (Fig. 3).
Necropsy examination of sheep.
The disease CLA is
characterized by the formation of abscesses in the lymphatic system
draining the site of a C. pseudotuberculosis infection.
Therefore, to evaluate the protective efficacy of the individual
treatments, a necropsy of all animals was performed at 6 weeks
postchallenge in order to visually assess them for abscess formation in
all the major draining lymph nodes. Hemolytic C. pseudotuberculosis organisms were isolated from all of the abscesses tested from the draining popliteal lymph node in 9 of 10 animals in the unvaccinated group, indicating that the experimental challenge with C. pseudotuberculosis had been successful.
Furthermore, 90% of the animals receiving Glanvac 3 lacked any signs
of CLA, confirming previous reports describing the level of protection provided by this commercial vaccine. Although there were quantitative differences in the level of protection provided by the different DNA
vaccination treatments (Fig. 4), due to
the group sizes these differences were not statistically significant.
DNA encoding
PLD or CD5L-hIg-
PLD provided reasonable levels of
protection (56 and 40%, respectively), while targeting
PLD as a
boCTLA-4 fusion protein provided the highest level of protection
(70%).
|
| |
DISCUSSION |
|---|
|
|
|---|
Recently it was demonstrated that targeting an antigen (hIg) as a
CTLA-4 fusion protein significantly enhanced the speed and magnitude of
antibody response in mice (3). These results have been
confirmed in the present study in an outbred population of large
animals and extended by the use of a challenge system to a clear
demonstration of the efficacy of this DNA vaccination strategy.
Moreover, we have shown that targeting
PLD as a CTLA-4 fusion
protein provided sheep with a level of protection against an
experimental challenge with C. pseudotuberculosis
similar to that provided by a formalin-inactivated subunit vaccine.
Indeed, this is the first animal trial that has clearly demonstrated
the efficacy of DNA vaccination in an outbred domestic species such as
sheep. This study clearly illustrates the generic nature of this
targeting strategy for enhancing the immune response and the subsequent
protection provided by DNA vaccines.
DNA vaccination has been shown to induce a long-lived antibody and
cell-mediated response in mice, and there have been numerous reports
demonstrating the efficacy of this approach against viral and parasitic
infections (9). In contrast, there have been few reports of
the use of DNA vaccination against bacterial infections, although the
potential of this approach has been demonstrated for
Mycobacterium tuberculosis (16), Mycoplasma
pulmonis (2), and Clostridium tetani
(1). It has been suggested that the use of DNA vaccination
against bacterial infections may be complicated by fundamental
differences between prokaryotic and eukaryotic genes (e.g., codon
usage) and gene products (e.g., due to different cellular machinery),
leading to the poor expression of a conformationally correct protein
(21). However, in the present study the prokaryotic signal
sequence of
PLD was shown to be functional in eukaryotic cells,
resulting in the successful secretion of this protein. Furthermore, the
glycosylated
PLD was capable of priming the immune response to
native PLD, as the antibody responses peaked 2 weeks after challenge
with a wild-type strain of C. pseudotuberculosis.
CTLA-4 has a high affinity for its ligands, CD80 and CD86 (formerly
B7-1 and B7-2). CD80 and CD86 are expressed at high levels by
antigen-presenting cells (APC), which are potent initiators of immune
responses. The weak immune responses that are often associated with DNA
vaccines are likely due to the low level of expression of the antigen
in transfected cells. Therefore, it is likely that the enhanced immune
response observed when
PLD was delivered as a CTLA-4 fusion protein
was due to targeting of the low levels of antigen to APC. Indeed, it
has been proposed that a possible mechanism of DNA vaccination is the
uptake of the DNA and/or the protein secreted by transfected myocytes
by specialized APC (dendritic cells), which subsequently present the
antigen to lymphocytes in the draining lymph nodes
(4). The findings of this study would support this as
a mechanism, as dendritic cells expressing high levels of CD80/CD86
were identified in the afferent lymph.
Although the titers of antibody to
PLD were enhanced when
PLD was
targeted as a CTLA-4 fusion protein, the antibody responses to
PLD
were low in all groups prior to challenge. This appears to be a
characteristic feature of the antibody response to PLD, as similar
kinetics have been shown for Glanvac and
PLD delivered by a live
recombinant vector (13). Despite the apparent role of
antibodies to proteins secreted by C. pseudotuberculosis in protective immunity, no correlation between the magnitude of the antibody response and protection has been shown (10).
Indeed, the differences in the level of protection between the
different groups receiving
PLD constructs or Glanvac 3 do not seem
to correlate with the antibody titers, which were in the same order of
magnitude for all groups 2 weeks postchallenge. It is possible,
however, that higher titers of antibody to
PLD at the time of
challenge, or the increased longevity of the antibody response in the
groups immunized with either CTLA-4-hIg-
PLD or Glanvac 3, accounts
for the increased levels of protection.
The
PLD used in the current study was inactivated by replacing a
histidine with a serine residue within the enzyme active site
(22). Recently it has been shown that this recombinant
PLD protein induces an antibody response in sheep similar to that
induced by Glanvac following a challenge with C. pseudotuberculosis (14). However, the level of
protection provided by this recombinant
PLD was poor (43%)
(14), albeit similar to the level of protection provided
when
PLD was delivered as a DNA construct in the present study.
Cell-mediated immunity may also play a role in the protective immunity
to C. pseudotuberculosis (23), which would be in
agreement with the findings of studies of mice that have established
that the induction of a T-helper 1 response is important in resistance to a number of facultatively intracellular bacteria (17).
Indeed, cell-mediated immune responses characterized by the production of gamma interferon have been established following immunization with
the wild-type strain of C. pseudotuberculosis
(12). Given that targeting an antigen as a CTLA-4 fusion
protein has previously been shown to enhance T-helper responses
(3), it is intriguing to speculate that the increased
protection of the animals immunized with CTLA-4-hIg-
PLD was due,
in part, to an enhanced cell-mediated immune response.
An important feature of the use of DNA is clearly the longevity of the
immune response, which has been demonstrated to last as long as 18 months in mice vaccinated against hepatitis B (7). However,
a study with sheep could find no evidence for the maintenance of
antibody levels following vaccination with DNA, or following a
subsequent boost with recombinant protein (20). A similar short-lived antibody response was also demonstrated in some primates following nucleic acid vaccination (8). Although it is
unclear whether this is a feature of particular antigens, the DNA
vaccination protocols for domestic animals have not been fully
optimized, and this may, in part, account for the weak, short-lived
responses observed in sheep. However, although optimizing factors such
as the volume, dose, and route of administration may improve the longevity of the immune response, it is clear that targeting
PLD as
a CTLA-4 fusion protein had a significant effect on increasing the
length of the humoral immune response generated to
PLD.
This study has clearly demonstrated the efficacy of vaccines using DNA encoding antigens as CTLA-4 fusion proteins for targeting to APC. This approach enhances the speed, magnitude, and longevity of the immune response and offers a novel strategy for overcoming the weak immune responses that have been associated with DNA vaccines.
| |
ACKNOWLEDGMENTS |
|---|
This work was supported by the Cooperative Research Centre for Vaccine Technology and by the NHMRC, Canberra, Australia.
| |
FOOTNOTES |
|---|
* Corresponding author. Present address: Bavarian Nordic Research Institute GmbH, Fraunhoferstrasse 18b, D-82152 Martinsried, Germany. Phone: 49-89-85651315. Fax: 49-89-85651333. E-mail: chaplin{at}bavarian-nordic.de.
Editor: R. N. Moore
| |
REFERENCES |
|---|
|
|
|---|
| 1. | Anderson, R., X. M. Goa, A. Papakonstantinopoulou, M. Roberts, and G. Dougan. 1996. Immune response in mice following immunization with DNA encoding fragment C of tetanus toxin. Infect. Immun. 64:3168-3173[Abstract]. |
| 2. | Barry, M. A., W. C. Lai, and S. A. Johnston. 1995. Protection against mycoplasma infection using expression-library immunization. Nature 377:632-635[Medline]. |
| 3. | Boyle, J. S., J. L. Brady, and A. M. Lew. 1998. Enhanced responses to a DNA vaccine encoding a fusion antigen that is directed to sites of immune induction. Nature 392:408-411[Medline]. |
| 4. |
Casares, S.,
K. Inaba,
T.-D. Brumeanu,
R. M. Steinman, and C. A. Bona.
1997.
Antigen presentation by dendritic cells after immunisation with DNA encoding a major histocompatibility complex class II-restricted viral epitope.
J. Exp. Med.
186:1481-1486 |
| 5. |
Chaplin, P. J.,
G. Entrican,
K. I. Gelder, and R. A. Collins.
1996.
Cloning and biologic activities of a bovine interferon- isolated from a rotavirus infected calf.
J. Interferon Cytokine Res.
16:25-30[Medline].
|
| 6. |
Cox, G. M.,
T. J. Zamb, and L. A. Babiuk.
1993.
Bovine herpesvirus 1: immune responses in mice and cattle injected with plasmid DNA.
J. Virol.
67:5664-5667 |
| 7. | Davis, H. L., M. Mancini, M. L. Michel, and R. G. Whalen. 1996. DNA-mediated immunization to hepatitis B surface antigen: longevity of primary response and effect of boost. Vaccine 14:910-915[Medline]. |
| 8. | Donnelly, J. J., A. Friedman, D. Martinez, D. L. Montgomery, J. W. Shiver, S. L. Motzel, J. B. Ulmer, and M. A. Liu. 1995. Preclinical efficacy of a prototype DNA vaccine: enhanced protection against antigenic drift in influenza virus. Nat. Med. 1:583-587[Medline]. |
| 9. | Donnelly, J. J., J. B. Ulmer, J. W. Shiver, and M. A. Liu. 1997. DNA vaccines. Annu. Rev. Immunol. 15:617-648[Medline]. |
| 10. | Eggleton, D. G., J. A. Haynes, H. D. Middleton, and J. C. Cox. 1991. Immunisation against caseous lymphadenitis: correlation between Corynebacterium pseudotuberculosis toxoid content and protective efficacy in combined clostridial-corynebacterial vaccines. Aust. Vet. J. 68:322-325[Medline]. |
| 11. | Hall, J. G., and B. Morris. 1962. The output of cells in lymph from the popliteal node in sheep. J. Exp. Physiol. 47:360-369. |
| 12. |
Hodgson, A. L.,
J. Krywult,
L. A. Corner,
J. S. Rothel, and A. J. Radford.
1992.
Rational attenuation of Corynebacterium pseudotuberculosis: potential cheesy gland vaccine and live delivery vehicle.
Infect. Immun.
60:2900-2905 |
| 13. |
Hodgson, A. L.,
M. Tachedjian,
L. A. Corner, and A. J. Radford.
1994.
Protection of sheep against caseous lymphadenitis by a single oral dose of live recombinant Corynebacterium pseudotuberculosis.
Infect. Immun.
62:5275-5280 |
| 14. | Hodgson, L. M., K. Carter, M. Tachedjian, J. Krywult, L. A. Corner, M. McColl, and A. Cameron. 1999. Efficacy of an ovine caseous lymphadenitis vaccine formulated using a genetically inactive form of the Corynebacterium pseudotuberculosis phospholipase D. Vaccine 17:802-808[Medline]. |
| 15. | Howard, C. J., P. Sopp, J. Brownlie, L. S. Kwong, K. R. Parsons, and G. Taylor. 1998. Identification of two distinct populations of dendritic cells in afferent lymph that vary in their ability to stimulate T cells. J. Immunol. 159:5372-5382[Abstract]. |
| 16. | Huygen, K., J. Content, O. Denis, D. L. Montgomery, A. M. Yawman, R. R. Deck, C. M. DeWitt, I. M. Orme, S. Baldwin, C. D'Souza, A. Drowart, E. Lozes, P. Vandenbussche, J. P. Van Vooren, M. A. Liu, and J. B. Ulmer. 1996. Immunogenicity and protective efficacy of a tuberculosis DNA vaccine. Nat. Med. 2:893-898[Medline]. |
| 17. | Kaufmann, S. H. 1993. Immunity to intracellular bacteria. Annu. Rev. Immunol. 11:129-163[Medline]. |
| 18. | Parsons, K. P., J. R. Young, R. A. Collins, and C. J. Howard. 1996. Cattle CTLA-4, CD28 and chicken CD28 bind CD86: MYPPPY is not conserved in cattle CD28. Immunogenetics 43:388-391[Medline]. |
| 19. | Rothel, J. S., D. B. Boyle, G. W. Both, A. D. Pye, J. G. Waterkeyn, P. R. Wood, and M. W. Lightowlers. 1997. Sequential nucleic acid and recombinant adenovirus vaccination induces host-protective immune responses against Taenia ovis infection in sheep. Parasite Immunol. 19:221-227[Medline]. |
| 20. | Schrijver, R. S., J. P. Langedijk, G. M. Keil, W. G. Middel, M. Maris-Veldhuis, J. T. Oirschot, and F. A. Rijsewijk. 1997. Immunisation of cattle with BHV1 vector vaccine or a DNA vaccine both encoding for the G protein of BRSV. Vaccine 15:1908-1916[Medline]. |
| 21. | Strugnell, R. A., D. Drew, J. Mercieca, S. Dinatale, N. Firez, S. J. Dunstan, C. P. Simmons, and J. Vadolas. 1997. DNA vaccines for bacterial infections. Immunol. Cell Biol. 75:364-369[Medline]. |
| 22. | Tachedjian, M., J. Krywult, R. J. Moore, and A. L. Hodgson. 1995. Caseous lymphadenitis vaccine development: site-specific inactivation of the Corynebacterium pseudotuberculosis phospholipase D gene. Vaccine 18:1785-1792. |
| 23. |
Walker, J.,
H. J. Jackson,
D. G. Eggleton,
E. N. Meeusen,
M. J. Wilson, and M. R. Brandon.
1994.
Identification of a novel antigen from Corynebacterium pseudotuberculosis that protects sheep against caseous lymphadenitis.
Infect. Immun.
62:2562-2567 |
This article has been cited by other articles:
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Copyright © 2009 by the American Society for Microbiology. For an alternate route to Journals.ASM.org, visit: http://intl-journals.asm.org | More Info»