Previous Article | Next Article 
Infection and Immunity, December 1999, p. 6619-6630, Vol. 67, No. 12
0019-9567/99/$04.00+0
Copyright © 1999, American Society for Microbiology. All rights reserved.
WdChs4p, a Homolog of Chitin Synthase 3 in Saccharomyces
cerevisiae, Alone Cannot Support Growth of Wangiella
(Exophiala) dermatitidis at the Temperature
of Infection
Zheng
Wang,1
Li
Zheng,1
Melinda
Hauser,2
Jeffery M.
Becker,2 and
Paul J.
Szaniszlo1,*
Section of Molecular Genetics and
Microbiology, School of Biological Science and Institute for
Cellular and Molecular Biology, The University of Texas at Austin,
Austin, Texas 78712,1 and
Microbiology Department, University of Tennessee, Knoxville,
Tennessee 379192
Received 21 April 1999/Returned for modification 14 June
1999/Accepted 3 September 1999
 |
ABSTRACT |
By using improved transformation methods for Wangiella
dermatitidis, and a cloned fragment of its chitin synthase 4 structural gene (WdCHS4) as a marking sequence, the
full-length gene was rescued from the genome of this human pathogenic
fungus. The encoded chitin synthase product (WdChs4p) showed high
homology with Chs3p of Saccharomyces cerevisiae and other
class IV chitin synthases, and Northern blotting showed that
WdCHS4 was expressed at constitutive levels under all
conditions tested. Reduced chitin content, abnormal yeast clumpiness
and budding kinetics, and increased melanin secretion resulted from the
disruption of WdCHS4 suggesting that WdChs4p influences
cell wall structure, cellular reproduction, and melanin deposition,
respectively. However, no significant loss of virulence was detected
when the wdchs4
strain was tested in an acute mouse model. Using a wdchs1
wdchs2
wdchs3
triple mutant
of W. dermatitidis, which grew poorly but adequately at
25°C, we assayed WdChs4p activity in the absence of activities
contributed by its three other WdChs proteins. Maximal activity
required trypsin activation, suggesting a zymogenic nature. The
activity also had a pH optimum of 7.5, was most stimulated by
Mg2+, and was more inhibited by polyoxin D than by
nikkomycin Z. Although the WdChs4p activity had a broad temperature
optimum between 30 to 45°C in vitro, this activity alone did not
support the growth of the wdchs1
wdchs2
wdchs3
triple mutant at 37°C, a temperature commensurate with infection.
 |
INTRODUCTION |
Chitin, a linear molecule of
-(1-4)-linked N-acetylglucosamine, is a major
structural constituent of the fungal cell wall (16, 49).
Chitin quantity varies in different fungi and in different cell types
of the same fungus (3, 8, 59). It is a minor (1%) component
of cell walls of most yeasts, but amounts are usually higher in the
cell walls of filamentous fungi (14). In
Saccharomyces cerevisiae, more than 90% of the chitin
is located in the region of the yeast cell bud scar (38).
However, greater amounts of mislocalized chitin occur in a
variety of cell division cycle mutants of S. cerevisiae,
indicating that chitin synthesis is temporally and spatially regulated
during the yeast cell cycle (44, 47). In vegetative hyphae
of filamentous fungi, chitin deposition is most concentrated in septa
and at the apexes of growing hyphae (25, 59).
Chitin synthases are responsible for the polymerization of chitin and
are primarily zymogens associated with fungal plasma membranes
(12). In both S. cerevisiae and Candida
albicans, three chitin synthase structural genes (CHS)
have been identified and characterized (10, 37). Numerous
other CHS genes have been identified in other fungi. Based
on derived amino acid sequences of PCR products, fungal chitin
synthases were first grouped as three classes (7).
Additional classes were then defined, and now at least five isozyme
classes are recognized (33). However, only in the case of
S. cerevisiae has each isozyme (Chs) been linked with some
certainty to specific functions during cell growth and development
(9, 11, 51, 57). In this fungus, Chs3p, which belongs to the
class IV group of chitin synthases (7), produces 90% of the
cell wall chitin in yeast cells budding normally, and this chitin is
localized both in the lateral wall and in the chitin ring that serves
as the bud emergence locus (57). Although no single Chs
enzyme is essential for the viability of S. cerevisiae, strains without functional class II (Chs2p) and class IV (Chs3p) isozymes lose viability (11, 16). In contrast to this
central role for the class IV enzyme in S. cerevisiae,
in filamentous fungi the class III chitin synthases, which have no
homolog in yeast, are most often reported to be essential for normal
hyphal growth (34, 61, 62). In fact, the class IV chitin
synthases identified in Neurospora crassa,
Aspergillus nidulans, and A. fumigatus have
been regarded as redundant enzymes (1, 5, 40), even
though additional genes encoding class IV chitin synthase homologs were
found in both Aspergillus species (33, 35, 52).
Wangiella (Exophiala)
dermatitidis is an asexual fungal pathogen of humans that is
associated with cutaneous and subcutaneous phaeohyphomycosis
(30). In vivo, this member of the Fungi Imperfecti produces
a variety of vegetative growth forms with dark, melanized (dematiaceous) cell walls, such as ovoid yeasts, pseudohyphae, hyphae
and isotropically enlarged, spherical cells, and multicellular forms
(20, 32, 41). In vitro, yeast cells of W. dermatitidis are easily manipulated in ways that allow
morphological transitions to isotrophic multicellular forms and hyphae
(18, 24, 28, 54). This inherent vegetative polymorphism of
W. dermatitidis allows it to serve as a valuable model for
the study of the more than 100 other dematiaceous fungi known to cause
human infection (31, 55). The numerous new transformation
and gene disruption systems developed for the molecular manipulation of
this organism (31, 45, 64) also make it an unusually
attractive model for determining the function of potential cell
wall-related virulence factors, such as chitin, in dimorphic and
polymorphic pathogenic fungi.
In yeast cells of W. dermatitidis, chitin is found in
relatively low amounts and is localized primarily in septal regions (19, 26, 54, 56). Multicellular forms and hyphae also have
chitin in their septa but have considerable additional chitin in other
cell wall areas (54-56). Because these morphological
transitions are accompanied not only by increases in chitin but also
increases in cell wall 1,8-dihydroxynaphthalene melanin (19,
54), melanin biosynthesis has been studied extensively and shown
to contribute significantly to the pathogenicity and virulence of
W. dermatitidis (21-23, 48). However, the
specific role of chitin and its contribution to virulence have not been
similarly established for this pathogen.
Three different genes (WdCHS) encoding class I, II, and III
chitin synthases were initially identified in W. dermatitidis by PCR and Southern blotting and then cloned by
screening genomic and cDNA libraries (7, 31, 36, 56, 58,
63). In this study, we describe the cloning, characterization,
and effects of disruption of the fourth WdCHS gene
(WdCHS4) of W. dermatitidis, and we also
characterize the enzymatic activity of its gene product (WdChs4p). Our
results showed that this gene is most likely constitutively expressed,
that its product is grouped to class IV, and that the chitin
contributed by WdChs4p influences wall structure, cell surface
properties, cellular reproduction, and melanization but not virulence.
Our results also showed that WdChs4p could not alone support growth at
37°C of a triple chitin synthase mutant of W. dermatitidis
having only an intact WdCHS4 gene. However, because this
triple mutant grew adequately at 25°C, we were able to characterize
the activity of the class IV-type isozyme of W. dermatitidis
in the absence of any confounding influence of its other WdChs
activities. Furthermore, our comparative studies of the wild-type
strain with strains having only WdCHS4 disrupted and with
the triple mutant derived by the sequential disruption of
WdCHS1, WdCHS2, and WdCHS3 but not
WdCHS4, allowed us to suggest why WdChs4p of W. dermatitidis may not be particularly important to virulence.
 |
MATERIALS AND METHODS |
Strains and media.
General propagation of the laboratory
wild-type strain of W. dermatitidis 8656 (ATCC 34100;
E. dermatitidis CBS 527.6), the type strain (ATCC 28869),
and the temperature-sensitive mutants Mc3 (wdcdc2; ATCC
38716) and Hf1 was either in the rich medium YPD (1% yeast extract,
2% peptone, 2% glucose) or the synthetic medium CDN (19),
which was prepared by adding the following components (grams per liter)
to 0.05 M sodium succinate buffer (pH 6.5): glucose, 30;
NaNO3, 3; K2PO4, 1;
MgSO4 · 7H2O, 0.5; FeSO4 · 7H2O, 0.01; NH4Cl,
0.625; and thiamine, 0.003. The chitin synthase wdchs1
wdchs2
double mutant and wdchs1
wdchs2
wdchs3
triple mutant of W. dermatitidis were
obtained by consecutive gene disruptions using vectors with phleomycin,
sulfonyl urea, and hygromycin resistance genes as selective markers
(reference 63; details to be reported elsewhere).
Escherichia coli XL1-Blue (Stratagene, La Jolla, Calif.),
which was used for the subcloning and plasmid preparation, was grown in
LB medium supplemented with ampicillin (100 µg/ml) or chloramphenicol
(25 µg/ml).
Preparation and analysis of nucleic acids.
Genomic DNA was
isolated by spheroplasting with Zymolyase-20T (ICN Biomedicals, Inc.,
Aurora, Ohio) followed by detergent lysis, phenol-chloroform
extraction, and ethanol precipitation as previously described
(39). Total RNA was isolated by the hot phenol method
(2). Southern and Northern blotting were performed by
standard methods (2) except for Southern blotting of the
karyotype, which was done as previously described (64). DNA
fragments (25 ng) used for probes in Southern and Northern analysis
were labeled with [
32P]dATP by using a Prime-a-Gene
kit (Promega, Madison, Wis.). Plasmids containing WdCHS4
gene fragments were automatically sequenced by the Institute for
Cellular and Molecular Biology of The University of Texas at Austin.
Sequence analysis was performed with the Wisconsin Package G software
(Genetics Computer Group, Inc.). PCR amplifications, using
Taq DNA polymerase and nucleotides obtained from Promega, were carried out in a DNA thermal cycler (Perkin-Elmer, Norwalk, Conn.)
for 1 cycle of 4 min at 94°C, then 29 cycles of 2 min at 94°C, 3 min at 50°C, and 4 min at 72°C, and finally 1 cycle similar to the
previous ones but with a 10-min elongation step. The 366-bp PCR
fragment of the WdCHS4 gene was amplified from W. dermatitidis 8656 genomic DNA by using primers CAL1-1
(5' CAAGTGTTTGAGTACTATATTTCGCAT 3') and CAL1-2 (5'
CGTAGAATTAATCCATCTTCGACGCTG 3'). The 876-bp fragment was
amplified from a truncated WdCHS4 clone by using primers
CAL1-1 and CAL1-3 (5' GTCATAGTCACGGTAGGG 3').
Plasmid construction.
The marker rescue plasmid pPCS4 (Fig.
1A) was constructed by inserting the
870-bp ApaI-SacI fragment from pBF4 (provided by B. Feng) containing the 3'-end sequence of WdCHS4 into
pCB1004 (provided by J. Sweigard, DuPont Co., Wilmington, Del.), which is a pBluescript SK(+)-based vector that contains the hygromycin phosphotransferase gene (hph) from E. coli, which
confers resistance to hygromycin B (HmB), and the tryptophan synthase
(trpC) promoter from A. nidulans (13).
The 870-bp fragment was originally cloned by library screening using
the 366-bp PCR product as a probe (see above). The WdCHS4
disruption plasmid pDCS4 (see Fig. 4A) was constructed by inserting an
800-bp BamHI fragment from the rescued plasmid, pMRCHS4,
into pAN7-1 (45), which, unlike pCB1004, contains the
glyceraldehyde-3-phosphate dehydrogenase (gpd) promoter and the trpC terminator from A. nidulans, in
addition to the hph gene.

View larger version (22K):
[in this window]
[in a new window]
|
FIG. 1.
Cloning WdCHS4 by a marker rescue technique.
(A) The partial WdCHS4 gene fragment (876 bp) was used in a
marker rescue method to clone the whole gene by integrating this
fragment with HmB resistance (hph) and chloramphenicol
resistance (Cm) gene markers into the WdCHS4
locus. The recombinant plasmid pPCS4, which carried this PCR fragment
in the pCB1004 vector, was linearized with EcoRV and
transformed into W. dermatitidis 8656 yeast cells. (B)
Southern hybridization analysis of four transformants in which pPCS4
was integrated into the W. dermatitidis genome. Genomic DNA
of the wild type (wt) and transformants 1 to 4 was extracted, digested
with BglII, and subjected to Southern blotting using a
876-bp WdCHS4 PCR fragment as a probe. Transformants 1, 2, and 3 showed hybridization consistent with site-specific integration
into the WdCHS4 locus, whereas the plasmid was ectopically
integrated in transformant 4. (C) Restriction map of WdCHS4.
The gray box represents the 876-bp fragment used for marker rescue, the
black box represents the 800-bp BamHI-digested fragment used
for gene disruption, and the hatched box represents the 366-bp PCR
fragment used for library screening. Restriction enzyme abbreviations:
A, ApaI; B, BamHI; BX, BstXI; H,
HindIII; S, SacI.
|
|
Transformations.
Yeast cells of W. dermatitidis
cultivated for 20 h in YPD at 25°C were harvested and chilled on
ice for 30 min, after which time the cells were washed twice and
resuspended in cold 10% glycerol. Plasmid (~5 µg) was then mixed
with this cell suspension (200 µl), and electroporation was conducted
at 1.45-kV field strength, 200-
resistance, and 25-mF capacitance,
corresponding to a time range 4 to 6 ms. Transformed cells were
incubated with YPD (1 ml) with shaking at 25°C for 3 h before
being spread on HmB (40 µg/ml; Sigma, St. Louis, Mo.)-containing YPD
plate medium, which was incubated at 25°C for 4 to 6 days.
Microscopy.
Cellular morphology was documented by using a
Zeiss ICM 405 inverted microscope (Carl Zeiss Inc., Oberkochen,
Germany) with Nomarski differential interference, phase-contrast
optics, a 63× oil immersion objective, and M35 automatic camera. The
procedure for preparing specimens for scanning electron microscopy
(17) was modified as follows. Cells were harvested from
log-phase CDN cultures and fixed overnight in sodium
cacodylate-buffered 25% glutaraldehyde at 4°C. The fixed cells were
washed twice with phosphate-buffered saline, attached to coverslips
pretreated with 50 µl of poly-L-lysine (2 mg/ml;
molecular weight, 4,000,000), and dehydrated in an ethanol-acetone (10, 25, 40, 50%, and 100% ethanol) series followed by an acetone-amyl
acetate (50, 40, 25, 15, and 5% acetone) series. The dehydrated
specimens were then submerged in amyl acetate for 15 min,
critical-point dried (Tousimis Samdri-790), and sputter coated (Ladd
model 30800) with gold for 60 s at 2.5 kV and 20 mA. Specimens
were examined in a Philips 515 scanning electron microscope.
Chitin content and chitin synthase activity assays.
Chitin
contents were measured by a modification of the procedure described by
Yabe et al. (60). Log-phase yeast cells were harvested from
20-ml cultures, suspended in 4 M HCl (1 ml), and boiled for 4 h.
After dilution of hydrolysates with H2O (19 ml), the amount
of hexosamine in a diluent (1 ml) was determined by the Elson-Morgan
method (6), using
N-acetyl-D-glucosamine (GlcNAc) (Sigma) as a
standard. Cell dry weights for calculation of chitin content per
milligram of cells were determined by collection of cells from 20-ml
cultures on preweighed 0.45-mm-pore-size membrane filters (type HA;
Millipore Corp., Bedford, Mass.), which were subsequently washed with
distilled water and then dried at 65°C to a constant weight.
Cell membranes were prepared and activities of chitin synthase was
determined by the method of Orlean (
43). Membrane proteins
were dissolved in TM buffer (50 mM Tris-HCl, 40 mM MgCl
2)
except
for the membrane protein of the chitin synthase
wdchs1
wdchs2
wdchs3
triple mutant, which was dissolved in 50 mM
Tris-HCl.
Concentrations of membrane protein were measured by using the
Coomassie protein assay reagent (Pierce, Rockford, Ill.). All
chitin
synthase assays were carried out in 50-µl reaction mixtures
consisting of 3 µl of 0.5 M Tris-HCl (pH 7.5), 3 µl of 40 mM
magnesium
acetate, 2 µl of 0.8 M GlcNAc (Sigma), 5 µl of 10 mM
UDP-
N-acetyl-
D-[U-
14C]glucosamine
(specific activity, 271 mCi/mmol; Amersham, Arlington
Heights, Ill.)
and 10 mM UDP-GlcNAc (Sigma), and 30 µg of membrane
protein. For
trypsin-activated chitin synthase activity measurements,
trypsin (2 µl of 1 mg/ml) from bovine pancreas (type III; Sigma)
was added to
the membrane preparations, which were subsequently
incubated at 30°C
for 15 min. Soybean trypsin inhibitor (2 µl
of 1.5 mg/ml; Sigma) was
then added to terminate trypsin digestion.
The mixture was incubated at
30°C for 30 min, and reactions were
stopped by adding 1%
trichloroacetic acid (1 ml). After the chitin
precipitate was collected
by filtration on 25-mm-pore-size glass
fiber filters (type A/E; Gelman
Science, Ann Arbor, Mich.), the
filters were washed with 95% ethanol
(5 ml) and radioactivity
was counted with a model LS 6800 liquid
scintillation counter
(Beckman Inc., Irvine, Calif.).
Virulence studies of wdchs4
-1 in mice.
Test
strains (wdchs4
-1, the wild type, and the vector control
strain with pAN7) of W. dermatitidis were cultured in 5 ml of YPD overnight at 30°C with shaking. An aliquot of the overnight culture was used to inoculate 50-ml YPD cultures, which were then grown
overnight to mid-log phase. Cultures were harvested and washed three
times with sterile water. Yeast forms were counted on a hemacytometer
and adjusted to a final density of 7 × 107 cells/ml.
The virulence of these strains was then tested in a immunocompetent
(normal) mouse model system. Male ICR mice (22 to 25 g; Harlan
Sprague-Dawley) were housed five per cage; food and water were supplied
ad libitum, according to National Institutes of Health guidelines for
the ethical treatment of animals. Mice (10 per strain) were inoculated
via the lateral tail vein with 100 µl of the cell suspension (7 × 107 cells/ml), such that each mouse received a final
dose of 7 × 106 cells. To determine the number of
viable yeast forms injected into each mouse, an aliquot of the
suspension used for injection was diluted and plated in top agar (0.1%
Noble agar) onto YPD plates. The plates were incubated at 30°C for 48 to 72 h, and percent viability was determined. Mice were
checked three times daily for survival or signs of infection. Visible
signs of infection were torticollis, ataxia, or lethargy. Infected mice
were considered moribund when they were unable to access food or water.
Moribund mice were humanely sacrificed by cervical dislocation
under anesthesia.
Statistics analysis.
Differences in chitin and chitin
synthase activities among groups were evaluated for statistical
significance by the parametric one-way analysis of variance
Newman-Keuls test for paired data. The analysis was performed with
PRISM version 2.0 software (GraphPad Software, Inc., San Diego,
Calif.). Probability values of <0.05 were considered significant.
Survival fractions in virulence tests were calculated by the
Kaplan-Meier method, and survival curves were tested for significant
difference (P < 0.01) by the Mantel-Haenszel test
using GraphPad Prism version 3.00 for Windows.
Nucleotide sequence accession number.
The nucleotide
sequence of the WdCHS4 gene was assigned GenBank accession
no. AF126146.
 |
RESULTS |
Cloning of the WdCHS4 gene by a marker rescue
approach.
The WdCHS4 gene was initially identified as a
366-bp fragment by PCR amplifications (29, 46) using primers
based on the conserved sequences of the CHS3 gene of
S. cerevisiae, which encodes the class IV isozyme Chs3p in
that fungus. Because only an 870-bp fragment of the 3' end of
WdCHS4 gene could be cloned by the library screening
approaches used previously for WdCHS1, WdCHS2,
and WdCHS3 (31), a marker rescue strategy
(27) was used to clone WdCHS4. Plasmid pPCS4 was
linearized with EcoRV and then transformed into W. dermatitidis by electroporation. Homologous recombination between the plasmid and the genome resulted in an interrupted repeat that contained one hybrid intact WdCHS4 gene and one hybrid
876-bp sequence (Fig. 1A). Genomic DNA of four transformants digested with BglII and subjected to Southern analysis showed that
three had the expected site-specific integration pattern (Fig. 1B). Because Southern blotting suggested that no BglII site was
present in the WdCHS4 gene or in pPCS4, a plasmid carrying
the WdCHS4 gene was recovered by digestion of
genomic DNA of one transformant (Fig. 1B, lane 1) with
BglII, followed by ligation, transformation of E. coli XL1-Blue, and selection for chloramphenicol-resistant clones.
Two transformants were obtained. The 14-kb plasmid pMRCHS4 from one
clone was isolated, and the 5.2-kb WdCHS4 gene was located by restriction enzyme mapping (Fig. 1C).
WdCHS4 is a homolog of CHS3 of S. cerevisiae.
After a series of subclonings, the WdCHS4
gene was completely sequenced. Three in-frame ATGs were found at its 5'
end. Two TA-rich motifs at positions
56 and
20 bp were identified
upstream of the first putative translation start site. The deduced
1,238 amino acids, with a calculated mass of 138.8 Kda and a pI of
9.07, encoded by the 3,714-bp open reading frame showed 52.2% identity to Chs3p encoded by CHS3 of S. cerevisiae
(9, 57), and 68.8, 68.4, and 54.2% identity to the other
class IV chitin synthases encoded by CHS4 of N. crassa (5), CHSD of A. nidulans
(40), and CHS3 of C. albicans
(53), respectively (Fig.
2). Two
highly conserved regions were identified as amino acids 201 to 512 and 664 to 1183. The latter region has homology to corresponding regions in
all members of the other classes of chitin synthases and is reported to
contain the enzyme's catalytic domain (42). Hydropathy analysis (data not shown) indicated that WdChs4p is a
seven-transmembrane protein with hydrophilic regions located near both
its amino and carboxyl termini and a neutral region at its center,
which are similar to those of other class IV chitin synthases but
different from those of other chitin synthase classes. In contrast to
the other three WdCHS genes of W. dermatitidis
(unpublished data), no evidence for an intron was found in the single
open reading frame of WdCHS4. Karyotypic analysis with the
wild-type strain (ATCC 34100) and the type strain (ATCC 28869) probed
with the WdCHS4 366-bp PCR product showed strong
hybridization only with chromosome IV (data not shown), which has an
estimated size of 3 to 3.5 Mb and is the smallest of the four
chromosomes resolved in both strains (64).



View larger version (203K):
[in this window]
[in a new window]
|
FIG. 2.
Multiple sequence comparison by CLUSTAL analysis of the
deduced amino acid sequences of five class IV chitin synthases:
WdChs4p, AnChsDp (ChsDp from A. nidulans), NcChs4p (Chs4p
from N. crassa), CaChs3p (Chs3p from C. albicans), and ScChs3p (Chs3p from S. cerevisiae). *,
identical or conserved residue in all sequences in the alignment;
:, conserved substitution; ., semiconserved
substitution.
|
|
Expression levels of the WdCHS4 gene are not
dramatically affected by temperature shift, morphological transition,
or disruption of other WdCHS genes.
The two
temperature-sensitive morphological mutants of W. dermatitidis, Mc3 (cdc2) and Hf1, convert to isotropic
forms and hyphae with thicken cell walls, respectively, when shifted
from 25 to 37°C in YPD, whereas the wild-type strain retains its
ability to grow as a yeast when cultured identically. Total RNA
extracted from these strains, grown at 25 and 37°C for 24 h, was
subjected to Northern analysis using a 0.8-kb BamHI fragment
of WdCHS4 as a probe. A single transcript of about 3.7 kb
was detected in each strain cultured at both temperatures, and no
dramatic increase in transcription level was apparent in cells of the
same strain shifted from 25 to 37°C, using actin expression levels as
controls (Fig. 3). Total RNA of the other
chitin synthase single gene disruption strains, the
wdchs1
, wdchs2
, and wdchs3
mutants (31, 58, 63), was also probed by Northern blotting
(data not shown). The transcription levels of WdCHS4 in all
of these single wdchs
strains were similar to that in the
wild type, indicating that defects in other chitin synthase genes in
W. dermatitidis did not significantly affect the expression
level of WdCHS4. These data further suggested that neither
the shift of these strains to high temperature nor the transitions of
yeast cells to other vegetative phenotypes dramatically affected
WdCHS4 transcription.

View larger version (66K):
[in this window]
[in a new window]
|
FIG. 3.
Northern blot analysis of WdCHS4 expression.
Total RNA (20 µg) was prepared from wild-type W. dermatitidis 8656 (lanes 1 and 4) and the temperature-sensitive
morphological mutants Mc3 (lanes 2 and 5) and Hf1 (lanes 3 and 6) grown
at 25 and 37°C, respectively, for 24 h and electrophoresed in a
formaldehyde-containing 1.2% agarose gel before transfer to a nylon
membrane. The membrane was probed with a 32P-labeled 0.8-kb
BamHI fragment of WdCHS4 and a 0.6-kb PCR
fragment of the actin gene (WdACT1) of W. dermatitidis, as indicated.
|
|
The WdCHS4 gene is not essential for W. dermatitidis viability.
Using a strategy similar to that
used to clone WdCHS4, we used plasmid pDCS4, which contains
an 800-bp BamHI fragment of WdCHS4, to disrupt
this gene in such a way that site-specific integration at the
wdchs4 locus by homologous recombination would result in two
truncated fragments of WdCHS4 separated by the vector
sequence and the hph gene (Fig.
4A). Total DNA from three transformants obtained on YPD-HmB medium was digested with ApaI or
SacI and then subjected to Southern blotting using a
WdCHS4 BamHI 0.8-kb fragment as a probe. The expected
band shifts from 6.0 to 11.8 kb with ApaI-digested DNA and
from 3.5 to 9.3 kb with SacI-digested DNA confirmed that
these transformants were WdCHS4 disruptants (Fig. 4B; data
only for wdchs4
-1 are shown). Northern blotting also
indicated that the 3.6-kb transcript shifted to the
higher-molecular-weight position in the wdchs4
disruption
strain (data not shown). Disruption of WdCHS4 was also
achieved by using plasmid pHY1, which contained the same
WdCHS4 800-bp fragment but with the sulfonyl urea resistance gene marker. Southern blotting proved that at least one viable sulfonyl
urea-resistant WdCHS4 disruption strain has also been obtained, which was named wdchs4
(sur)
(62a).

View larger version (16K):
[in this window]
[in a new window]
|
FIG. 4.
Disruption of WdCHS4 gene in W. dermatitidis. (A) Predicted structure for integration of pDCS4-800
at the wdchs4 locus. (B) Southern hybridization analysis of
the wdchs4 -1 disruptant strain. The recombinant plasmid
pDCS4-800 linearized with BstXI was transformed into
W. dermatitidis 8656. Southern blots of genomic DNA
from W. dermatitidis 8656 (lanes 1 and 3) and
wdchs4 -1 strain (lanes 2 and 4), digested with
ApaI (lanes 1 and 2) and SacI (lanes 3 and 4),
were hybridized with a 0.8-kb WdCHS4 BamHI fragment.
|
|
The wdchs4
-1 disruptant strain grows slowly in poor
medium and shows abnormal yeast clumping, budding kinetics, and
pigmentation.
At 25°C, the growth rates of
wdchs4
-1 and wild-type strains were similar in both broth
YPD and CDN media (data not shown). At 37°C, the growth rate of
wdchs4
-1 was close to that of the wild type in YPD but
significantly lower than that of the wild type in CDN medium (Fig.
5), suggesting that WdChs4p makes a
significant contribution to the rate of cell growth in W. dermatitidis under some nutrient-poor growth conditions. The
wdchs4
-1 cells were also observed by light microscopy to
have a clumping tendency and a higher density (they tended to settle
faster than the wild type) at both 25 and 37°C when cultured in
liquid medium (data not shown). Although calcofluor staining for chitin
and fluorescence microscopy showed no obvious differences in cell wall
and septal regions between wdchs4
-1 and its
wild-type parent, a larger population of the multiply budding
yeast cells was detected among the disruptant cells in CDN medium at
37°C (Table 1). Scanning electron
microscopy showed that the wdchs4
-1 cells not only tended
to clump but also had abnormal multiple budding patterns among cells
cultured in CDN at 37°C (Fig. 6).
Furthermore, it was noted that colonies of the disruption strain
grown on agar (Fig. 7), as well as
cells cultured in liquid medium and culture supernatant fluids
after centrifugation (data not shown), were darker than those of the wild-type strain after growth for only a few days at 25 or 37°C, indicating that more melanin was being incorporated into their cell
walls and being leaked from the wdchs4
-1 disruptant
cells. However, the darker wdchs4
-1 strain could not
cross-feed the white melanin-deficient wdpks4
-1 mutant
(data not shown) in which the polyketide synthase gene was disrupted
(23a), indicating that pigmented molecules secreted from
this mutant were not precursors of melanin polymers but were probably
polymerized melanin itself. Similar, if not identical, abnormal
phenotypes have been observed with all other wdchs4
strains, including the wdchs4
(sur)
strain, although none of these strains have been characterized to
the same extent as wdchs4
-1. Finally, no
significant (P > 0.01) differences in survival rates
were detected in immunocompetent 4-week-old ICR mice inoculated
intravenously with the wild-type strain, a vector control strain with
pAN7-1 integrated ectopically, or the wdchs4
-1 mutant
(data not shown).

View larger version (15K):
[in this window]
[in a new window]
|
FIG. 5.
Comparison of the growth rates at 37°C of W. dermatitidis 8656 (wild type [wt]) and its
wdchs4 -1 mutant (chs4) in YPD or CDN medium. Late
log-phase cultures were transferred to YPD or CDN medium to the
final optical density at 600 nm (OD600) of 0.06 (measured with a
Beckman model 25 spectrophotometer). Cells were grown at 37°C
with shaking at 200 rpm. Results shown are the average of two
independent experiments.
|
|

View larger version (60K):
[in this window]
[in a new window]
|
FIG. 6.
Scanning electron micrograph showing morphology of
wild-type (wt) and wdchs4 -1 cells grown in CDN liquid
medium at 37°C for 24 h. Arrows point to multiple budding yeast
cells. Bars, 10 µm.
|
|

View larger version (58K):
[in this window]
[in a new window]
|
FIG. 7.
Growth of wild-type and wdchs4 -1 strains
on YPD agar medium incubated at 37°C for 4 days. Colonies of the
wdchs4 -1 strain are darker than those of the wild type.
Arrows point to zones in the YPD agar where melanin has accumulated.
|
|
Chitin content, but not chitin synthase activity, is reduced
in the wdchs4
-1 disruptant at 37°C.
The
chitin content of wdchs4
-1 was found to be significantly
less than that of the wild-type strain at 37°C, but not at 25°C (Fig. 8A). This result was the first
indication that any wdchs
in W. dermatitidis
could be correlated with a significant reduction in cell wall chitin
(references 58 and 63 and this
work). Apparently our current chitin assay method is not sensitive
enough to detect minor changes, if they exist, in the chitin contents of the wdchs4
-1 mutant at 25°C or in other single
wdchs1
, wdchs2
, and
wdchs3
mutants at either 25 or 37°C. Surprisingly,
however, the chitin synthase activity in the wdchs4
-1
strain did not decrease like that of the other wdchs
disruption mutants grown identically (58, 63), but instead
exhibited a consistent minor but not statistically significant increase
under the 37°C growth condition (Fig. 8B and C). These contradictory
data from assaying chitin contents and chitin synthase activities
may reflect that other chitin synthases compensate for the loss
of WdChs4p.

View larger version (18K):
[in this window]
[in a new window]
|
FIG. 8.
(A) Comparison of chitin contents of the wild type (wt)
and wdchs4 -1 mutant incubated at 25 and 37°C. Results
are derived from three independent experiments. Standard deviations are
shown. The significantly different (P < 0.05) chitin
content between the wild-type strain grown at 25 and at 37°C is
indicated by a single asterisk, whereas significant difference
(P < 0.05) between the wild-type and
wdchs4 -1 strains at 37°C is indicated by two asterisks.
(B and C) WdChs activities of the wild type and wdchs4 -1
mutant incubated at 25 or 37°C and assayed with (B) or without (C)
trypsin treatment. Results for each treatment are derived from three
independent experiments. Standard deviations are shown. No
significantly different (P > 0.05) activities were
found between the wild-type and wdchs4 -1 strains at each
temperature.
|
|
WdChs4p is characterized in the wdchs1
wdchs2
wdchs3
triple mutant.
Using three different selective
markers, we obtained the wdchs1
, wdchs2
,
wdchs3
triple mutant through three consecutive disruptions (63). Although this mutant grew much less
vigorously, had an obviously abnormal phenotype compared to the
wild-type or even the wdchs4
-1 mutant, and would not grow
at all at 37°C, adequate growth could be obtained at 25°C (Fig.
9) for WdChs4p assays: since all four
chitin synthase structural genes are thought to have been identified in
W. dermatitidis, WdChs4p was regarded as the only chitin
synthase present in this triple mutant, and thus its activity could be
characterized directly in membrane protein samples by biochemical
assay. Compared with the total chitin synthase activities of the wild
type and the wdchs4
-1 mutant (Fig. 8B), WdChs4p activity
in the triple mutant was very low (Fig.
10A). As expected, it could be
activated by trypsin treatment (Fig. 10B), indicating that although
WdChs4p was a zymogen, it did not contribute the majority of chitin
synthase activity in vitro. As also expected, certain divalent cations
were found to be required for stimulating the activity of the
trypsin-treated membranes above basal levels. Among the six
cations examined, Mg2+ was more effective than either
Co2+ or Mn2+ for stimulating WdChs4p activity,
whereas Ca2+, Cu2+, and Zn2+ were
ineffective (Fig. 10A). Although the pH profile was found to be
stringent for WdChs4p, with the optimal pH for maximal activity determined to be 7.5 (Fig. 10C), WdChs4p had lower activity at 25°C
and a broad temperature tolerance, from 30 to 45°C (Fig. 10D).
Moreover, WdChs4p was demonstrated to be more sensitive in vitro to
polyoxin D than to nikkomycin Z (Fig. 10E), which are two antifungal
agents that are known to competitively inhibit chitin synthases
(16).

View larger version (42K):
[in this window]
[in a new window]
|
FIG. 9.
Temperature sensitivity test for the wild-type (wt) and
wdchs4 -1, wdchs1 wdchs2 and
wdchs1 wdchs2 wdchs3 mutant strains. The strains were
grown on YPD plates at 25 and 37°C, as indicated, for 3 days.
|
|

View larger version (20K):
[in this window]
[in a new window]
|
FIG. 10.
Biochemical characteristics of WdChs4p activity of
membranes from the wdchs1 chs2 chs3 triple mutant.
Membrane proteins were isolated from mutant cells grown in YPD liquid
medium at 25°C for 40 h. The results were derived from two
independent experiments, and the assay of each sample was duplicated.
Standard deviations are shown.
|
|
 |
DISCUSSION |
Although a PCR fragment homologous to CAL1, the class
IV chitin synthase-encoding gene of S. cerevisiae had
been identified in W. dermatitidis some time ago (29,
46), the full-length WdCHS4 gene was resistant to
cloning by the library screening approaches used for
WdCHS1, WdCHS2, and WdCHS3.
Therefore, a gene marker rescue approach involving transformation was
used to clone this gene. One advantage of this method was that once a
fragment of WdCHS4 was obtained, it was easily integrated
with a shuttle vector into its endogenous genomic locus by
homologous recombination, and then regions both upstream and downstream
were recovered by selectively digesting genomic DNA,
transforming it into E. coli, and isolating replicative
plasmids. A second advantage was that the two truncated gene copies
derived from this integration resulted in a gene disruption. Thus,
insights into the function of the tagged gene were obtained even before
the gene was cloned.
The deduced WdCHS4 gene product was found to have most
homology to the class IV chitin synthases of the filamentous fungi N. crassa (5) and A. nidulans
(40) and less homology to those of the yeast species
S. cerevisiae (9, 57) and C. albicans (53), confirming again that the essentially filamentous, but polymorphic, asexual fungus W. dermatitidis is more closely
related to filamentous ascomycetes than to known or suspected yeast
ascomycete species (7, 29). Unlike members of other classes,
which have four transmembrane domains at C-terminal regions, WdChs4p
has seven transmembrane domains distributed at both ends of the protein and between which are located putative catalytic regions. It also has a
unique N-terminal region, as is common to all class IV chitin synthases
characterized to date, including Chs3p of S. cerevisiae.
The wdchs4
-1 strain is the only wdchs
disruption mutant detected to have a significantly reduced chitin
content at 37°C according to our current measurement protocols,
indicating that WdChs4p makes more chitin in W. dermatitidis, at least at 37°C, than do the other
isozymes. This is in agreement with the finding that the class IV
chitin synthase of S. cerevisiae is the major producer of
chitin in that fungus (9). Moreover, the clumping tendency and the multiple budding of the yeast cells of all the
wdchs4
mutants were similar to the phenotype reported for
the CAL1 mutants of S. cerevisiae
(50). We suspect that this phenotype is indicative of
structural changes in cell wall and in septal regions, although aberrant septation was not revealed by calcofluor staining. Also, the
increased melanin released from wdchs4
cells suggests
that melanin might normally be deposited in the chitin matrix
synthesized by WdChs4p. In this respect, we hypothesize that melanin in
W. dermatitidis is bound or trapped by the cell
wall matrix contributed by WdChs4p but is not retained as efficiently
in the cell walls of wdchs4
mutants. Alternatively, the
regulation of the melanin biosynthesis pathway might be related to
chitin synthesis. In this scenario, the chitin in the cell wall
synthesized by WdChs4p might inhibit melanin synthesis by a feedback
regulation mechanism.
Total chitin synthase activity in the wdchs4
-1 mutant did
not show significant changes compared to that of the wild type, which
is similar to the situation with wdchs1
mutants
(63) but not of wdchs2
or wdchs3
mutants (58). This may be due to the fact that four classes
of chitin synthases have been identified in W. dermatitidis
(31, 56). Possibly one or all of the other chitin synthases,
and most likely WdChs2p, which is a class I chitin synthase and
contributes most of the zymogenic activity associated with membranes of
W. dermatitidis (63, 64), compensates for the
lost WdChs4p activity when WdCHS4 is deleted. Alternatively, the lost WdChs4p activity is possibly compensated for by WdChs3p activity, which is induced to higher levels of production at 37°C (58). Finally, this paradox might simply be explained by the minor amount of chitin synthase activity contributed by WdChs4p in the
wild-type strain, which could not be shown to be reduced significantly
in the wdchs4
-1 strain. Evidence for a low level of
activity of WdChs4p comes from studies of the wdchs triple mutant, which has about 10-fold-lower total activity per milligram membrane protein than the wild-type strain (compare data in Fig. 10A
with those in Fig. 8B).
During the polymorphic transitions of W. dermatitidis, the
transcription levels of WdCHS4 did not appear to change
significantly in comparisons between cells of the same strain shifted
to 37°C, even though significantly more chitin is deposited in the
cell walls of the multicellular forms and hyphae (19, 26,
54). The expression level of WdCHS4 was also similar
to the wild-type level in the wdchs1
,
wdchs2
, and wdchs3
strains grown under standard growth conditions (58a). Thus, the expression of
this gene is probably constitutive during polymorphic growth, even in
the absence of one or another single chitin synthase. These particular
results argue against the possibility introduced above, that the
disruption of WdCHS4 might induce a higher expression of
other WdCHS genes for compensation, and instead suggest that WdChs4p, like Chs3p in S. cerevisiae (15),
is regulated at the translational or posttranslational level. However,
it is still very possible that the expression levels of
WdCHS4 are correlated with specific events associated with
yeast cell cycle progression, particularly the event of septation,
which is a possibility not addressed in this study.
The successful use of multiple selective markers in our
WdCHS gene disruption experiments (31) allowed us
to eliminate the three other WdCHS genes in W. dermatitidis, which in turn permitted the measurement of only the
class IV chitin synthase activity of WdChs4p. The protein responsible
for this activity was directly determined to be a zymogen, which could
be activated in vitro when treated with trypsin, even without the
protection of substrate UDP-GlcNAc. Our direct assay of the WdChs4p
activity also revealed its remarkable preference for certain divalent
ions, suggesting that metal ions are essential and specific for chitin
synthase activity in vitro: the higher efficiency of Mg2+
to stimulate the enzyme activity versus that of Co2+
suggests that the binding of Mg2+ was stronger than that of
Co2+, which is in agreement with the study of Chs3p of
S. cerevisiae (57). The optimal pH (pH 7.5) of
WdChs4p was also similar to Chs3p of yeast. However, the broad
temperature optimum for WdChs4p activity, unlike that for Chs3p
(25°C) (10), which is probably a reflection of the
thermotolerance known to be associated with W. dermatitidis,
may suggest that this enzyme is particularly well suited for
functioning at the higher temperatures associated with its poorly
characterized saprophic environment and with human infection. Like the
other chitin synthases of S. cerevisiae, WdChs4p was also
sensitive to polyoxin D and nikkomycin Z in vitro, indicating that this
chitin synthase shares domains that can be targeted by these and other drugs.
The disruption of WdCHS4 produced cells that showed no
significant reduction in virulence in an acute mouse model. We
speculate that this absence of virulence loss after the disruption of
WdCHS4 is because its product, WdChs4p, is not a
particularly important contributor of the specific chitin(s) required
for the survival and growth of W. dermatitidis at
temperature of infection. This speculation is based on our observations
that the wdchs1
wdchs2
wdchs3
triple mutant of this
pathogen, which presumably has only WdChs4p activity, grew at 25°C
(albeit poorly) but not at 37°C, even though chitin synthase activity
could be measured in vitro over a broad temperature range, including
37°C. Possibly at temperatures of infection, the WdChs4p zymogen is
not activated in vivo or, if activated, does not function efficiently
enough to compensate for the loss of the chitin contributed normally by
one or more of the other chitin synthases. We further speculate that
the chitin contributed by WdChs4p is not localized to positions in
cells necessary to compensate for the loss of the chitin products of other chitin synthases of W. dermatitidis, which are most
important for normal yeast growth. We base this suggestion on our
observation in this and other studies (63) that the cells of
the triple mutant that survive at 25°C, like those of the
wdchs1
wdchs2
double mutant, are very swollen,
multinucleate, largely inhibited in cell separation, and defective in
normal septum formation (reference 63 and results to
be reported elsewhere). In contrast, as shown in the present work, the
disruption of WdCHS4 alone results in only relatively minor
perturbations, which although more pronounced at 37°C are mainly
manifested by clumpiness, multiple budding, and slower growth in poor
but not rich medium, none of which should significantly alter virulence
in the rich environments associated with most infections. Thus,
additional similar studies, involving the cloning and disruption of
each of the other WdCHS genes of W. dermatitidis
individually and in as many combinations as possible, are required
before the contributions of each of their products to saprophytic and
parasitic growth and survival of this pathogen can be satisfactorily
defined. Such studies are in progress and are at very advanced stages
(31, 58, 63, 64).
 |
ACKNOWLEDGMENTS |
We thank S. M. Karuppayil and B. Feng for supplying PCR
fragments of the WdCHS4 gene, Z. Yin for helping with the
pulsed-field electrophoresis, C. R. Cooper, Jr., for the use of a
CHEF gel apparatus, W. Chen for supplying the WdACT1 gene
used for a probe in Northern analysis, P. McIntosh for help with
scanning electron microscopy, and H. Yarbrough for constructing and
characterizing wdchs4
(sur) mutant.
This work was supported by grant AI 33049 to P.J.S. from the National
Institute of Allergy and Infectious Diseases.
 |
FOOTNOTES |
*
Corresponding author. Mailing address: Section of
Molecular Genetics and Microbiology, School of Biological Sciences,
University of Texas at Austin, Austin, TX 78712. Phone: (512) 471-3384. Fax: (512) 471-7088. E-mail:
pjszaniszlo{at}mail.utexas.edu.
Editor:
T. R. Kozel
 |
REFERENCES |
| 1.
|
Aufauvre-Brown, A.,
E. Mellado,
N. A. R. Gow, and D. W. Holden.
1997.
Aspergillus fumigatus chsE: a gene related to CHS3 of Saccharomyces cerevisiae and important for hyphal growth and conidiophore development but not pathogenicity.
Fungal Genet. Biol.
21:141-152[Medline].
|
| 2.
|
Ausubel, F. M.,
R. Bent,
R. E. Kingston,
D. D. Moore,
J. G. Seidman,
J. A. Smith, and K. Struhl (ed.).
1989.
Current protocols in molecular biology.
John Wiley & Sons, New York, N.Y.
|
| 3.
|
Bartnicki-Garcia, S., and E. Reyes.
1968.
Chemical composition of sporangiophore walls of Mucor rouxii.
Biochim. Biophys. Acta
165:32-42[Medline].
|
| 4.
|
Bell, A. A., and M. H. Wheeler.
1986.
Biosynthesis and functions of fungal melanins.
Annu. Rev. Phytopathol.
24:411-451.
|
| 5.
|
Beth Din, A.,
C. A. Specht,
P. W. Robbins, and O. Yarden.
1996.
chs-4, a class IV chitin synthase gene from Neurospora crassa.
Mol. Gen. Genet.
250:214-222[Medline].
|
| 6.
|
Boas, N. F.
1953.
Method for the determination of hexosamines in tissues.
J. Biol. Chem.
204:553-563[Free Full Text].
|
| 7.
|
Bowen, A. R.,
J. L. Chen-Wu,
M. Momany,
R. Young,
P. J. Szaniszlo, and P. W. Robbins.
1992.
Classification of fungal chitin synthases.
Proc. Natl. Acad. Sci. USA
89:519-523[Abstract/Free Full Text].
|
| 8.
|
Braun, P. C., and R. A. Calderone.
1978.
Chitin synthesis in Candida albicans: comparison of yeast and hyphal forms.
J. Bacteriol.
135:1472-1477.
|
| 9.
|
Bulawa, C. E.
1992.
CSD2, CSD3, and CSD4 genes required for chitin synthesis in Saccharomyces cerevisiae: the CSD2 gene product is related to chitin synthases and to developmentally regulated proteins in Rhizobium species and Xenopus laevis.
Mol. Cell. Biol.
12:1764-1776[Abstract/Free Full Text].
|
| 10.
|
Bulawa, C. E.
1993.
Genetics and molecular biology of chitin synthase in fungi.
Annu. Rev. Microbiol.
47:505-534[Medline].
|
| 11.
|
Bulawa, C. E.,
M. Slater,
E. Cabib,
J. Au-Young,
A. Sburlati,
W. L. Adair, and P. W. Robbins.
1986.
The Saccharomyces cerevisiae structural gene for chitin synthase is not required for chitin synthase in vivo.
Cell
46:213-215[Medline].
|
| 12.
|
Cabib, E.,
S. J. Silverman,
A. Sburlati, and M. L. Slater.
1990.
Chitin synthesis in yeast (Saccharomyces cerevisiae), p. 31-41.
In
P. J. Kuhn, A. P. J. Trinci, M. J. Jung, M. W. Goosey, and L. G. Copping (ed.), Biochemistry of cell wall and membranes in fungi. Springer-Verlag, New York, N.Y.
|
| 13.
|
Carroll, A. M.,
J. A. Sweigard, and B. Valent.
1994.
Improved vectors for selecting resistance to hygromycin.
Fungal Genet. Newsl.
41:22.
|
| 14.
|
Cassone, A.
1986.
Cell wall of pathogenic yeasts and implication for antimycotic therapy.
Drugs Exp. Clin. Res.
12:635-643[Medline].
|
| 15.
|
Choi, W.,
B. Santos,
A. Duran, and E. Cabib.
1994.
Are yeast chitin synthases regulated at the transcriptional or the posttranscriptional level.
Mol. Cell. Biol.
14:7685-7694[Abstract/Free Full Text].
|
| 16.
|
Cid, V. J.,
A. Duran,
F. del Rey,
M. P. Synder,
C. Nombela, and M. Sanchez.
1995.
Molecular basis of cell integrity and morphogenesis in Saccharomyces cerevisiae.
Microbiol. Rev.
59:345-386[Abstract/Free Full Text].
|
| 17.
|
Cole, G. T.
1986.
Preparation of microfungi for scanning electron microscopy, p. 1-44.
In
H. C. Aldrich, and W. J. Todd (ed.), Ultrastructure techniques for microorganisms. Plenum Press, New York, N.Y.
|
| 18.
|
Cooper, C. R., Jr., and P. J. Szaniszlo.
1993.
Evidence for two cell division cycle (CDC) genes that govern yeast bud emergence in the pathogenic fungus Wangiella dermatitidis.
Infect. Immun.
61:2069-2081[Abstract/Free Full Text].
|
| 19.
|
Cooper, C. R., Jr.,
J. L. Harris,
C. W. Jacobs, and P. J. Szaniszlo.
1984.
Effects of polyoxin on cellular development in Wangiella dermatitidis.
Exp. Mycol.
8:349-363.
|
| 20.
|
de Hoog, G. S.,
K. Takeo,
S. Yoshida,
E. Gottlich,
K. Nishimura, and M. Miyaji.
1994.
Pleoanamorphic life cycle of Exophiala (Wangiella) dermatitidis.
Antonie Leeuwenhoek
65:143-153.
|
| 21.
|
Dixon, D. M.,
A. Polak, and P. J. Szaniszlo.
1991.
Pathogenicity and virulence of wild-type and melanin-deficient Wangiella dermatitidis.
J. Med. Vet. Mycol.
25:97-106.
|
| 22.
|
Dixon, D. M.,
P. J. Szaniszlo, and A. Polak.
1991.
Dihydroxynaphthalene (DHN) melanin and its relationship with virulence in the early stages of phaeohyphomycosis, p. 297-318.
In
G. T. Cole, and H. C. Hoch (ed.), The fungal spore and disease initiation in plants. Plenum Press, New York, N.Y.
|
| 23.
|
Dixon, D. M.,
J. Migliozzi,
C. R. Cooper,
O. Solis,
B. Breslin, and P. J. Szaniszlo.
1992.
Melanized and non-melanized multicellular form mutants of Wangiella dermatitidis in mice: mortality and histopathology studies.
Mycoses
35:17-21[Medline].
|
| 23a.
| Feng, B., and P. J. Szaniszlo. Unpublished
data.
|
| 24.
|
Geis, P. A., and C. W. Jacobs.
1985.
Polymorphism of Wangiella dermatitidis, p. 205-233.
In
P. J. Szaniszlo (ed.), Fungal dimorphism: with emphasis on fungi pathogenic for humans. Plenum Press, New York, N.Y.
|
| 25.
|
Gooday, G. W., and N. A. R. Gow.
1990.
Enzymology of tip growth in fungi, p. 31-58.
In
I. B. Health (ed.), Tip growth in plant and fungal cells. Academic Press, Inc., San Diego, Calif.
|
| 26.
|
Harris, J. L., and P. J. Szaniszlo.
1986.
Localization of chitin in walls of Wangiella dermatitidis using colloidal gold-labeled chitinase.
Mycologia
78:853-857.
|
| 27.
|
Jung, M. K., and B. R. Oakley.
1990.
Identification of an amino acid substitution in the benA, -tubulin gene of Aspergillus nidulans that confers thiabendazole resistance and benomyl supersensitivity.
Cell Motil. Cytoskel.
17:87-94[Medline].
|
| 28.
|
Karuppayil, S. M., and P. J. Szaniszlo.
1997.
Importance of calcium to the regulation of polymorphism in Wangiella (Exophiala) dermatitidis.
J. Vet. Med. Mycol.
35:379-388.
|
| 29.
|
Karuppayil, S. M.,
M. Peng,
L. Mendoza,
T. A. Levins, and P. J. Szaniszlo.
1996.
Identification of the conserved coding sequence of three chitin synthase genes in Fonsecaea pedrosoi.
J. Med. Vet. Mycol.
34:117-125[Medline].
|
| 30.
|
Kwon-Chung, K. J., and J. E. Bennet.
1992.
Medical mycology, p. 337-555.
Lea and Febiger, Philadelphia, Pa.
|
| 31.
|
Kwon-Chung, K. J.,
W. E. Goldman,
B. Klein, and P. J. Szaniszlo.
1998.
Fate of transforming DNA in pathogenic fungi.
Med. Mycol.
36(Suppl. I):38-44.
|
| 32.
|
Matsumoto, T.,
T. Matsuda, and M. R. McGinnis.
1993.
Clinical and mycological spectra of Wangiella dermatitidis.
Mycoses
36:145-155[Medline].
|
| 33.
|
Mellado, E.,
A. Aufauvre-Brown,
C. A. Specht,
P. W. Robbins, and D. W. Holden.
1995.
A multigene family related to chitin synthase genes of yeast in the opportunistic pathogen Aspergillus fumigatus.
Mol. Gen. Genet.
246:353-359[Medline].
|
| 34.
|
Mellado, E.,
A. Aufauvre-Brown,
N. A. R. Gow, and D. W. Holden.
1996.
The Aspergillus fumigatus chsC and chsG genes encode class III chitin synthases with different functions.
Mol. Microbiol.
20:667-679[Medline].
|
| 35.
|
Mellado, E.,
C. A. Specht,
P. W. Robbins, and D. W. Holden.
1996.
Cloning and characterization of chsD, a chitin synthase-like gene of Aspergillus fumigatus.
FEMS Microbiol. Lett.
143:69-76[Medline].
|
| 36.
|
Mendoza, A. L.
1995.
Cloning and molecular characterization of the chitin synthase 1 (WdCHS1) gene of Wangiella dermatitidis. Ph.D. thesis.
The University of Texas at Austin.
|
| 37.
|
Mio, T.,
T. Yabe,
M. Sudoh,
Y. Satoh,
T. Nakajima,
M. Arisawa, and H. Yamada-okabe.
1996.
Role of three chitin synthase genes in the growth of Candida albicans.
J. Bacteriol.
178:2416-2419[Abstract/Free Full Text].
|
| 38.
|
Molano, J.,
B. Bowers, and E. Cabib.
1980.
Distribution of chitin in the yeast cell wall: an ultrastructural and chemical study.
J. Cell Biol.
85:199-212[Abstract/Free Full Text].
|
| 39.
|
Momany, M., and P. J. Szaniszlo.
1994.
DNA isolation from Wangiella, p. 519-520.
In
B. Maresca, and G. S. Kobayashi (ed.), Molecular biology of pathogenic fungi a laboratory manual. Telos Press, New York, N.Y.
|
| 40.
|
Motoyama, T.,
M. Fujiwara,
N. Kojima,
H. Horiuchi,
A. Ohta, and M. Takagi.
1996.
The Aspergillus nidulans genes chsA and chsD encode chitin synthases which have redundant functions in conidia formation.
Mol. Gen. Genet.
251:442-450[Medline].
|
| 41.
|
Nachman, S. A.,
O. Alpan,
R. Malowitz, and E. D. Spitzer.
1996.
Catheter-associated fungemia due to Wangiella (Exophiala) dermatitidis.
J. Clin. Microbiol.
34:1011-1013[Abstract].
|
| 42.
|
Nagahashi, S.,
M. Sudoh,
N. Ono,
R. Saweda,
E. Yamaguchi,
Y. Uchida,
T. Mio,
M. Tagaki,
M. Arisawa, and H. Yamada-Okabe.
1995.
Characterization of chitin synthase 2 of Saccharomyces cerevisiae. Implication of two highly conserved domains as possible catalytic sites.
J. Biol. Chem.
270:13961-13967[Abstract/Free Full Text].
|
| 43.
|
Orlean, P.
1987.
Two chitin synthases in Saccharomyces cerevisiae.
J. Biol. Chem.
262:5732-5739[Abstract/Free Full Text].
|
| 44.
|
Orlean, P.
1997.
Yeast III, p. 229-362.
Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y.
|
| 45.
|
Peng, M.,
C. R. Cooper, Jr., and P. J. Szaniszlo.
1995.
Genetic transformation of the pathogenic fungus Wangiella dermatitidis.
Appl. Microbiol. Biotechnol.
44:444-450[Medline].
|
| 46.
|
Peng, M.,
S. M. Karuppayil,
L. Mendoza,
T. A. Levins, and P. J. Szaniszlo.
1995.
Use of the polymerase chain reaction to identify coding sequences for chitin synthase isozymes in Phialophora verrucosa.
Curr. Genet.
27:517-523[Medline].
|
| 47.
|
Roberts, R. L.,
B. Bowers,
M. L. Slater, and E. Cabib.
1983.
Chitin synthesis and localization in cell division cycle mutants of Saccharomyces cerevisiae.
Mol. Cell. Biol.
3:922-930[Abstract/Free Full Text].
|
| 48.
|
Schnitzler, N.,
H. Peltroche-Llacsahuanga,
N. Bestier,
J. Zundorf,
R. Lutticken, and G. Haase.
1999.
Effect of melanin and carotenoids of Exophala (Wangiella) dermatitidis on phagocytosis, oxidative burst, and killing by human neutrophils.
Infect. Immun.
67:94-101[Abstract/Free Full Text].
|
| 49.
|
Sentandreu, R.,
E. Hettero,
J. P. Martinez-Garcia, and G. Larriba.
1989.
Biogenesis of the yeast cell walls, p. 193-235.
In
D. B. Roodyn (ed.), Subcellular biochemistry. Plenum Press, New York, N.Y.
|
| 50.
|
Shaw, J. A.,
P. C. Mol,
B. Bowers,
S. J. Silverman,
M. H. Valdivieso,
A. Duran, and E. Cabib.
1991.
The function of chitin synthases 2 and 3 in the Saccharomyces cerevisiae cell cycle.
J. Cell Biol.
114:111-123[Abstract/Free Full Text].
|
| 51.
|
Silverman, S. J.,
A. Sburlati,
M. L. Slater, and E. Cabib.
1988.
Chitin synthase 2 is essential for septum formation and cell division in Saccharomyces cerevisiae.
Proc. Natl. Acad. Sci. USA
85:4735-4739[Abstract/Free Full Text].
|
| 52.
|
Specht, C. A.,
Y. Liu,
P. W. Robbins,
C. E. Bulawa,
N. Iartchouk,
K. R. Winter,
P. J. Riggle,
J. C. Rhodes,
C. L. Dodge,
D. W. Culp, and P. T. Borgia.
1996.
The chsD and chsE genes of Aspergillus nidulans and their roles in chitin synthesis.
Fungal Genet. Biol.
20:153-167[Medline].
|
| 53.
|
Sudoh, M.,
S. Nagahashi,
M. Doi,
A. Ohta,
M. Takagi, and M. Arisawa.
1993.
Cloning of the chitin synthase 3 gene from Candida albicans and its expression during yeast-hyphal transition.
Mol. Gen. Genet.
241:351-358[Medline].
|
| 54.
|
Szaniszlo, P. J.,
C. W. Jacobs, and P. A. Geis.
1983.
Dimorphism: morphological and biochemical aspects, p. 323-426.
In
D. H. Howard (ed.), Fungi pathogenic for humans and animals, part A. Biology. Marcel Dekker, New York, N.Y.
|
| 55.
|
Szaniszlo, P. J.,
L. Mendoza, and S. M. Karuppayil.
1993.
Clues about chromoblastomycotic and other dematiaceous fungal pathogens based on Wangiella as a model, p. 241-255.
In
H. Vanden Bossche, F. C. Odds, and D. Kerridge (ed.), Dimorphic fungi in biology and medicine. Plenum Press, New York, N.Y.
|
| 56.
|
Szaniszlo, P. J., and M. Momany.
1993.
Chitin, chitin synthase and chitin synthase conserved region homologues in Wangiella dermatitidis, p. 229-242.
In
B. Maresca, G. Kobayashi, and H. Yamaguchi (ed.), NATO ASI series, vol. H69. Molecular biology and its application to medical mycology. Springer-Verlag, Berlin, Germany.
|
| 57.
|
Valdivieso, M. H.,
P. C. Mol,
J. A. Shaw,
E. Cabib, and A. Duran.
1991.
Cloning of CAL1, a gene required for activity of chitin synthase 3 in Saccharomyces cerevisiae.
J. Cell Biol.
114:101-109[Abstract/Free Full Text].
|
| 58.
|
Wang, Z.
1998.
Cloning and characterization of the chitin synthase 3 (WdCHS3) and chitin synthase 4 (WdCHS4) genes of Wangiella dermatitidis and expression studies of WdCHS3. Ph.D. thesis.
The University of Texas at Austin.
|
| 58a.
| Wang, Z. Unpublished data.
|
| 59.
|
Wessels, J. G. H.
1986.
Cell wall synthesis in apical hyphal growth.
Int. Rev. Cytol.
104:38-79.
|
| 60.
|
Yabe, T.,
T. Yamada-Okabe,
S. Kasahara,
Y. Furuichi,
T. Nakajima,
E. Ichishima,
M. Arisawa, and H. Yamada-Okabe.
1996.
HKR1 encodes a cell surface protein that regulates both cell wall -glucan synthesis and budding pattern in the yeast Saccharomyces cerevisiae.
J. Bacteriol.
178:477-483[Abstract/Free Full Text].
|
| 61.
|
Yanai, K.,
N. Kojima,
N. Takaya,
H. Horiuchi,
A. Ohta, and M. Takagi.
1994.
Isolation and characterization of two chitin synthase genes from Aspergillus nidulans.
Biosci. Biotechnol. Biochem.
58:1828-1835[Medline].
|
| 62.
|
Yarden, O., and C. Yanofsky.
1991.
Chitin synthase 1 plays a major role in cell wall biogenesis in Neurospora crassa.
Genes Dev.
5:2420-2430[Abstract/Free Full Text].
|
| 62a.
| Yarbrough, H., and P. J. Szaniszlo. Unpublished
data.
|
| 63.
|
Zheng, L.
1997.
Establishment of genetic transformation systems in and molecular cloning of the chitin synthase 2 (WdCHS2) gene, and characterization of the WdCHS1 and WdCHS2 genes of Wangiella dermatitidis. Ph.D. thesis.
The University of Texas at Austin.
|
| 64.
|
Zheng, L., and P. J. Szaniszlo.
1999.
Cloning and use of the WdURA5 gene as a hisG cassette selection marker for potentially disrupting multiple genes of Wangiella dermatitidis.
Med. Mycol.
37:85-96.
[Medline] |
Infection and Immunity, December 1999, p. 6619-6630, Vol. 67, No. 12
0019-9567/99/$04.00+0
Copyright © 1999, American Society for Microbiology. All rights reserved.
This article has been cited by other articles:
-
Wheeler, M. H., Abramczyk, D., Puckhaber, L. S., Naruse, M., Ebizuka, Y., Fujii, I., Szaniszlo, P. J.
(2008). New Biosynthetic Step in the Melanin Pathway of Wangiella (Exophiala) dermatitidis: Evidence for 2-Acetyl-1,3,6,8-Tetrahydroxynaphthalene as a Novel Precursor. Eukaryot Cell
7: 1699-1711
[Abstract]
[Full Text]
-
Liu, H., Kauffman, S., Becker, J. M., Szaniszlo, P. J.
(2004). Wangiella (Exophiala) dermatitidis WdChs5p, a Class V Chitin Synthase, Is Essential for Sustained Cell Growth at Temperature of Infection. Eukaryot Cell
3: 40-51
[Abstract]
[Full Text]
-
Wang, Q., Liu, H., Szaniszlo, P. J.
(2002). Compensatory expression of five chitin synthase genes, a response to stress stimuli, in Wangiella (Exophiala) dermatitidis, a melanized fungal pathogen of humans. Microbiology
148: 2811-2817
[Abstract]
[Full Text]
-
Wang, Z., Zheng, L., Liu, H., Wang, Q., Hauser, M., Kauffman, S., Becker, J. M., Szaniszlo, P. J.
(2001). WdChs2p, a Class I Chitin Synthase, Together with WdChs3p (Class III) Contributes to Virulence in Wangiella (Exophiala) dermatitidis. Infect. Immun.
69: 7517-7526
[Abstract]
[Full Text]
-
Feng, B., Wang, X., Hauser, M., Kaufmann, S., Jentsch, S., Haase, G., Becker, J. M., Szaniszlo, P. J.
(2001). Molecular Cloning and Characterization of WdPKS1, a Gene Involved in Dihydroxynaphthalene Melanin Biosynthesis and Virulence in Wangiella (Exophiala) dermatitidis. Infect. Immun.
69: 1781-1794
[Abstract]
[Full Text]
-
Ye, X., Szaniszlo, P. J.
(2000). Expression of a Constitutively Active Cdc42 Homologue Promotes Development of Sclerotic Bodies but Represses Hyphal Growth in the Zoopathogenic Fungus Wangiella (Exophiala) dermatitidis. J. Bacteriol.
182: 4941-4950
[Abstract]
[Full Text]
-
Wang, Z., Szaniszlo, P. J.
(2000). WdCHS3, a Gene That Encodes a Class III Chitin Synthase in Wangiella (Exophiala) dermatitidis, Is Expressed Differentially under Stress Conditions. J. Bacteriol.
182: 874-881
[Abstract]
[Full Text]