Previous Article | Next Article ![]()
Infection and Immunity, February 1999, p. 986-988, Vol. 67, No. 2
Department of Microbiology,
Received 13 April 1998/Returned for modification 18 August
1998/Accepted 20 October 1998
Vaccination of mice with Escherichia coli expressing
Brucella Cu/Zn superoxide dismutase (SOD) [E.
coli(pBSSOD)] induced a significant level of protection
against virulent Brucella abortus challenge, although this
level was not as high as the one reached with B. abortus
vaccine strain RB51. In addition, vaccination with E. coli(pBSSOD) induced antibodies to Cu/Zn SOD and a strong proliferative response of splenocytes when stimulated in vitro with a
thioredoxin-Cu/Zn SOD fusion protein.
Mice and cattle can be protected
against Brucella abortus infection by vaccination with
viable B. abortus 19 or RB51 (2, 5, 8). At
present it is not clear which of the many Brucella antigens
in these vaccine strains are responsible for the induction of the
protective immunity. The induction of protection with strain RB51,
which does not evoke a detectable immune response to the O chain
(2, 8), clearly indicates that antigens unrelated to the O
chain play a crucial role. Protection induced by strain RB51 is cell
mediated, since passive transfer of antibodies does not confer
protection while transfer of lymphocytes does (3). In the
past, ribosomal protein L7/L12 and certain epitopes of the Cu/Zn
superoxide dismutase (SOD) of B. abortus have been
implicated in the induction of a protective cell-mediated immune
response (6, 12). Our objective in this study was to
evaluate the protective capacity of Brucella Cu/Zn SOD
in mice immunized with a recombinant Escherichia coli strain
expressing this Brucella antigen.
Animals, bacterial strains, and antigens used.
Two-month-old
female BALB/c mice were used in this study, as were the following
bacterial strains: B. abortus 2308 and RB51 (8), E. coli DH5
0019-9567/99/$04.00+0
Copyright © 1999, American Society for Microbiology. All rights reserved.
Vaccination with Live Escherichia coli Expressing
Brucella abortus Cu/Zn Superoxide Dismutase Protects
Mice against Virulent B. abortus
![]()
ABSTRACT
Top
Abstract
Text
References
![]()
TEXT
Top
Abstract
Text
References
(Gibco BRL) with plasmid
pBluescript SK(
) (E. coli pBS), and E. coli DH5
expressing Brucella Cu/Zn SOD [E. coli(pBSSOD)]. E. coli(pBSSOD) was constructed as follows. A clone, pBAII-3,
containing the gene for Brucella Cu/Zn SOD
(sodC) along with its own promoter was initially obtained
from a pUC9 genomic library of B. abortus 2308 (unpublished data). A 1.1-kb fragment containing the
sodC gene and its promoter sequence was excised
from the insert of pBAII-3 with ClaI and subcloned into pBluescript SK(
) (Stratagene); the resulting plasmid is
referred to as pBSSOD. In order to purify the recombinant Cu/Zn SOD
protein of B. abortus, it was overexpressed in
E. coli by using the pThioHis vector of the His-Patch
ThioFusion expression system (Invitrogen Corp., San Diego, Calif.). In
this vector, the product of the cloned foreign gene is expressed as a
fusion protein with a modified version of the E. coli
thioredoxin protein. These modifications allow the purification of the
recombinant fusion protein by metal affinity chromatography. The
sodC gene was PCR amplified from the genomic DNA of
strain 2308 by using a primer pair designed based on the nucleotide
sequence. (The forward primer was 5'
GAAGTGATGGAATTCTTATTTATTGC 3'; the reverse primer was 5'
AGCGCTGCAGGCTTATCGGAAT 3'.) A restriction site was
engineered into each primer by point mutation. The amplified gene fragment was digested with an appropriate restriction enzyme and
cloned into pThioHis.
, and a single recombinant colony was selected. Expression and purification of the recombinant fusion protein (Thio-SOD) and the
thioredoxin alone were performed according to the manufacturer's suggested procedure. Both preparations were tested for purity by
sodium dodecyl sulfate-polyacrylamide gel electrophoresis and Western blot analysis and were found to be devoid of other
E. coli proteins.

View larger version (37K):
[in a new window]
FIG. 1.
Western blot showing the expression of B. abortus Cu/Zn SOD protein by recombinant E. coli. The antigens separated by sodium dodecyl sulfate-15%
polyacrylamide gel electrophoresis were transferred to a nitrocellulose
membrane and reacted with different sera. The membranes were developed
with appropriate secondary antibodies conjugated with horseradish
peroxidase. Lanes 1 to 3 contain the antigens of B. abortus RB51, E. coli(pBSSOD), and
E. coli(pBS), respectively. Panels A to C were
reacted with hyperimmunized goat serum to sonicates of B. abortus RB51, goat antiserum to B. abortus
Cu/Zn SOD protein, and sera from mice vaccinated with strain RB51,
respectively. The arrow at the left of panel B indicates the Cu/Zn
SOD band. Numbers at the left of panel A indicate the positions of
molecular mass markers, in kilodaltons.
Protection experiments. To test the effects of different immunogens, groups of 10 mice each were vaccinated intraperitoneally (i.p.) with either 2 × 108 CFU of live B. abortus RB51, 1 × 106 CFU of E. coli(pBS), or 1 × 106 CFU of E. coli(pBSSOD). Unvaccinated control mice were injected with 10 mM phosphate-buffered saline (pH 7.2). Five weeks after vaccination, five mice from each group were challenged by i.p. injection of 104 CFU of B. abortus 2308. Experimentally infected mice were killed 2 weeks later by cervical dislocation, spleens were disrupted, and dilutions were plated to determine the number of Brucella CFU per spleen (3). The remaining five mice in each group were used for determinations of the antibody and lymphoproliferative responses to the immunizing antigens. The degrees of protection in vaccinated animals and controls were expressed as mean CFU for spleens in each group obtained after challenge following log10 conversion (5). This experiment was repeated three times, and results from the pooled data are shown. Statistical analyses were performed with Student's paired t test. Log10 units of protection were obtained by subtracting the mean log10 CFU for the experimental group from the mean log10 CFU of the corresponding control group (3, 9).
Analysis of antibody and lymphoproliferative responses. To evaluate the production of antibody against Cu/Zn SOD, mice were bled retro-orbitally 5 weeks postimmunization and sera were used for Western blot analysis (14). The lymphocyte proliferation assays were performed as described previously (7). Briefly, 5 weeks postvaccination, mice were killed and single cell suspensions were prepared from the spleens of both the control and vaccinated groups. After elimination of erythrocytes, the splenocytes were cultured in 96-well plates at a concentration of 4 × 105 cells/well in RPMI 1640 medium alone or in the presence of 0.4, 0.08, or 0.016 µg of Thio-SOD antigen or similar quantities of thioredoxin alone. Concentrations of antigen were determined by the Bradford protein assay (Bio-Rad). The cells were cultured for 3 days, pulsed with 0.4 µCi of thymidine (50 Ci/mmol; Amersham, London, United Kingdom) per well for 8 h, and harvested, and the radioactivity was measured in a liquid scintillation counter. Cell proliferation was expressed as mean counts per minute obtained from triplicate cultures obtained from a cell pool of each group. In addition, a stimulation index (SI) was obtained for each experimental group by dividing the counts per minute of cells with antigen by the counts per minute of cells without antigen.
Protection against challenge by E. coli(pBSSOD).
The results indicate that immunization
with viable E. coli(pBSSOD) and strain RB51 induced
significant protection (P < 0.004 and P < 0.001, respectively) against challenge with virulent B. abortus 2308 (Table 1). As described
previously, viable B. abortus RB51 conferred over 2 log
units of protection (3, 8, 11). E. coli
expressing the Brucella Cu/Zn SOD also conferred a
significant level of protection (1.77 log units), although this level
of protection was lower than the level conferred by strain RB51.
E. coli not expressing the Brucella antigen
did not confer protection (0.09 log unit). There is contradictory
information on the role of Cu/Zn SOD as a virulence factor of
Brucella, with one study indicating a weak role
(4) and another indicating that this protein does not
contribute to the virulence of Brucella (13). It
is nevertheless possible that E. coli(pBSSOD) may
be more virulent than its nonexpressing counterpart and thus may
survive longer within mice. Prolonged survival of the recombinant may
allow for the presence of activated macrophages at challenge time, and
the protection observed in this study may have been nonspecific. To
eliminate this possibility we infected mice with E. coli(pBSSOD), E. coli(pBS), and RB51 and
cultured their spleens at 1, 2, 3, 4, and 5 weeks postinfection. Neither E. coli strain could be isolated from the mice;
RB51 was last isolated in low numbers from some mice at 4 weeks
postimmunization, confirming previous studies carried out with the
original strain RB51 (8). In a previous study
RB51-vaccinated mice did not show substantial nonspecific immunity
against Listeria even though the vaccine organism could
still be isolated by the fourth week postvaccination (3).
The fact that neither E. coli strain could be isolated
at 1 week postvaccination indicates that it is highly unlikely that the
observed protection was nonspecific. These data indicate that the
complete Cu/Zn SOD protein can induce a protective immune response
in mice. This contrasts with the results of Tabatabai and Pugh
(12), who were unable to induce a protective response in
mice using a combination of adjuvants and purified recombinant Brucella Cu/Zn SOD protein as the vaccinal antigen,
although some level of protection was induced with synthetic peptides
of the protein and adjuvant. It is possible that the protection
obtained in our studies with the whole Brucella Cu/Zn
SOD protein was due to differences in antigen presentation mechanisms
obtained with the use of Cu/Zn SOD expressed in living
E. coli compared to its use as a purified protein
coadministered with adjuvant.
|
Stimulation of specific immune responses. Western blot analysis of the humoral immune response indicated that only the sera from mice immunized with recombinant E. coli(pBSSOD) reacted weakly with the Brucella Cu/Zn SOD (data not shown). Mice immunized with viable strain RB51 did not develop antibodies to SOD but did develop antibodies to other Brucella antigens, as described previously (Fig. 1C) (1, 6), a finding also observed in cattle (2, 10). The detection of a weak antibody response to Brucella Cu/Zn SOD in the mice immunized with recombinant E. coli(pBSSOD) is an indication that the mice specifically recognized the antigen and contrasts with the lack of response in the strain RB51-immunized mice. Cu/Zn SOD may be a poor inducer of antibodies due to its relatedness (27% homology) to eukaryotic Cu/Zn SOD (1), and it is possible that the amount of SOD produced by Brucella in vivo is insufficient to induce Cu/Zn SOD-specific antibodies. In contrast, recombinant E. coli(pBSSOD) may express higher levels of Cu/Zn SOD than Brucella and therefore is able to induce a weak but detectable antibody response. Passive transfer of mouse anti-strain RB51 sera does not confer protection on naive mice against challenge (3); however, it is not clear if the anti-SOD antibodies induced by the recombinant E. coli strain played a role in protection, since passive transfer experiments with sera containing the specific antibodies were not carried out in this study. It is unlikely that anti-SOD antibodies would confer protection, since Cu/Zn SOD has not been located on the surfaces of Brucella rough or smooth strains.
The lymphocyte proliferation response results suggest that splenocytes from mice immunized with recombinant E. coli(pBSSOD) and strain RB51 respond in vitro upon stimulation with 0.08 and 0.4 µg of Thio-SOD, while splenocytes from saline- and E. coli-immunized mice did not (Table 2). In vitro stimulation of splenocytes with thioredoxin protein alone never reached an SI above 2, indicating that the response observed with the E. coli(pBSSOD)- and RB51-vaccinated mice was Cu/Zn SOD specific. The ability of Thio-SOD fusion protein to induce an in vitro lymphoproliferative response in the splenocytes from E. coli(pBSSOD)-immunized mice is again an indication that these mice recognized the antigen immunologically. It cannot be concluded from these experiments that the lymphoproliferative response is an indicator of protective immunity, since a variety of other Brucella antigens which are capable of inducing such a response without inducing protection exists (11).
|
| |
ACKNOWLEDGMENTS |
|---|
This work was supported by FONDECYT grant 1961146, grant 96.036.002-1.1D from the Dirección de Investigación, Universidad de Concepción, and grant S-95-46 from the Dirección de Investigación, Universidad Austral de Chile.
| |
FOOTNOTES |
|---|
* Corresponding author. Mailing address: Department of Microbiology, Faculty of Biological Sciences, Universidad de Concepción, P.O. Box 152-C, Concepción, Chile. Phone: (056)-41-204118. Fax: (056)-41-245975. E-mail: aonate{at}udec.cl.
Editor: J. R. McGhee
| |
REFERENCES |
|---|
|
|
|---|
| 1. | Beck, B. L., L. B. Tabatabai, and J. E. Mayfield. 1991. A protein isolated from Brucella abortus is a Cu-Zn superoxide dismutase. Biochemistry 29:372-376. |
| 2. | Cheville, N. F., M. G. Stevens, A. E. Jensen, F. M. Tatum, and S. M. Halling. 1993. Immune response and protection against infection and abortion in cattle experimentally vaccinated with mutant strains of Brucella abortus. Am. J. Vet. Res. 54:1591-1597[Medline]. |
| 3. |
Jiménez de Bagüés, M. P.,
P. H. Elzer,
S. M. Jones,
J. M. Blasco,
F. M. Enright,
G. G. Schurig, and A. J. Winter.
1994.
Vaccination with Brucella abortus rough mutant RB51 protects BALB/c mice against virulent strains of Brucella abortus, Brucella melitensis, and Brucella ovis.
Infect. Immun.
62:4990-4996 |
| 4. | Latimer, E., J. Simmers, N. Sriranganathan, M. Roop, G. G. Schurig, and S. M. Boyle. 1992. Brucella abortus deficient in copper/zinc superoxide dismutase is virulent in Balb/C mice. Microb. Pathog. 12:105-113[Medline]. |
| 5. |
Montaraz, J. A., and A. J. Winter.
1986.
Comparison of living and nonliving vaccines for Brucella abortus in BALB/c mice.
Infect. Immun.
53:245-251 |
| 6. | Oliveira, S. C., and G. A. Splitter. 1996. Immunization of mice with recombinant L7/L12 ribosomal protein confers protection against Brucella abortus infection. Vaccine 14:959-962[Medline]. |
| 7. | Oñate, A., and H. Folch. 1995. 18.5 Kda protein: an interesting antigen of Brucella. Arch. Med. Vet. 27:93-102. |
| 8. | Schurig, G. G., R. M. Roop, T. Bagchi, S. Boyle, D. Buhrman, and N. Sriranganathan. 1991. Biological properties of RB51; a stable rough strain of Brucella abortus. Vet. Microbiol. 28:171-188[Medline]. |
| 9. | Snedecor, G. W., and W. G. Cochran. 1989. Statistical methods, 8th ed. Iowa State University, Ames. |
| 10. | Stevens, M. G., L. B. Tabatabai, C. S. Olsen, and N. F. Cheville. 1994. Immune response to superoxide dismutase and synthetic peptides of superoxide dismutase in cattle vaccinated with Brucella abortus strain 19 or RB51. Vet. Immunol. 41:383-389. |
| 11. | Stevens, M. G., S. C. Olsen, G. W. Pugh, Jr., and D. Brees. 1995. Comparison of immune responses and resistance to brucellosis in mice vaccinated with Brucella abortus 19 or RB51. Infect. Immun. 63:264-270[Abstract]. |
| 12. | Tabatabai, L. B., and G. W. Pugh, Jr. 1994. Modulation of immune response in BALB/c mice vaccinated with Brucella abortus Cu-Zn superoxide dismutase synthetic peptide vaccine. Vaccine 12:919-924[Medline]. |
| 13. |
Tatum, F. M.,
P. G. Detilleux,
J. M. Sacks, and S. M. Halling.
1992.
Construction of Cu-Zn superoxide dismutase deletion mutants of Brucella abortus: analysis of survival in vitro in epithelial and phagocytic cells and in vivo in mice.
Infect. Immun.
60:2863-2869 |
| 14. |
Towbin, H.,
T. Staehelin, and J. Gordon.
1979.
Electrophoretic transfer of proteins from polyacrylamide gels to nitrocellulose sheets: procedure and some applications.
Proc. Natl. Acad. Sci. USA
76:4350-4354 |
This article has been cited by other articles:
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Copyright © 2009 by the American Society for Microbiology. For an alternate route to Journals.ASM.org, visit: http://intl-journals.asm.org | More Info»