Previous Article | Next Article 
Infection and Immunity, March 1999, p. 1331-1337, Vol. 67, No. 3
0019-9567/99/$04.00+0
Copyright © 1999, American Society for Microbiology. All rights reserved.
Hyperproduction of Alpha-Hemolysin in a
sigB Mutant Is Associated with Elevated SarA Expression in
Staphylococcus aureus
Ambrose L.
Cheung,1,*
Yueh-tyng
Chien,1 and
Arnold S.
Bayer2,3,4
Laboratory of Bacterial Pathogenesis and
Immunology, The Rockefeller University, New York, New York
100211; St. John's Cardiovascular
Research Center2 and Division of
Infectious Diseases,3 Harbor-UCLA Medical
Center, Torrance, California 90509; and UCLA School of
Medicine, Los Angeles, California 900244
Received 9 October 1998/Returned for modification 4 December
1998/Accepted 14 December 1998
 |
ABSTRACT |
To evaluate the role of SigB in modulating the expression of
virulence determinants in Staphylococcus aureus, we
constructed a sigB mutant of RN6390, a prototypic S. aureus strain. The mutation in the sigB gene was
confirmed by the absence of the SigB protein in the mutant on an
immunoblot as well as the failure of the mutant to activate
B-dependent promoters (e.g., the sarC promoter) of S. aureus. Phenotypic analysis indicated that both
alpha-hemolysin level and fibrinogen-binding capacity were up-regulated
in the mutant strain compared with the parental strain. The increase in
fibrinogen-binding capacity correlated with enhanced expression of
clumping factor and coagulase on immunoblots. The effect of the
sigB mutation on the enhanced expression of the
alpha-hemolysin gene (hla) was primarily transcriptional.
Upon complementation with a plasmid containing the sigB
gene, hla expression returned to near parental levels in
the mutant. Detailed immunoblot analysis as well as a competitive
enzyme-linked immunosorbent assay of the cell extract of the
sigB mutant with anti-SarA monoclonal antibody 1D1 revealed
that the expression of SarA was higher in the mutant than in the
parental control. Despite an elevated SarA level, the transcription of
RNAII and RNAIII of the agr locus remained unaltered in the
sigB mutant. Because of a lack of perturbation in
agr, we hypothesize that inactivation of sigB
leads to increased expression of SarA which, in turn, modulates target
genes via an agr-independent but SarA-dependent pathway.
 |
INTRODUCTION |
Staphylococcus aureus is
a major cause of human infections, such as superficial abscesses,
pneumonia, endocarditis, and sepsis (6). The control of a
multitude of extracellular and cell wall virulence determinants in
S. aureus is growth phase dependent. In particular, cell
wall proteins are normally synthesized in the logarithmic phase, while
exoproteins are generally produced postexponentially. The growth phase
dependence of these virulence factors is mediated in part by global
regulatory loci, such as sar (12) and
agr (22). These modulators may either interact with the target gene directly (e.g., RNAIII with hla
[alpha-hemolysin gene] mRNA) or control another regulatory molecule
(e.g., sar regulation of the agr gene product)
which, in turn, alters the transcription of the target gene.
The sar locus is composed of three overlapping transcripts,
designated sarA (0.56 kb), sarC (0.8 kb), and
sarB (1.2 kb), initiated from the P1, P3, and P2 promoters,
respectively. Because of this multiplicity of promoters, the activation
of sar leading to the expression of SarA, the major
sar regulatory molecule, is complex and may be growth phase
dependent. Whereas the sarB transcript and the more abundant
sarA transcripts are maximally expressed during the
exponential phase, the transcription of sarC from the P3
promoter is most active during the postexponential phase
(3). Additional transcriptional analysis indicated that the
P3 promoter is
B dependent (17, 20, 25).
In contrast to the primary sigma factor (
A), which is required for
the expression of housekeeping genes, SigB (
B) is an alternate
transcription factor that has been shown to respond to environmental
stresses (e.g., stationary phase of growth) in gram-positive bacteria
(20). The core RNA polymerase associated with a particular
sigma factor recognizes a specific set of promoters with conserved
sequence motifs to initiate the transcription of genes programmed to
respond to certain environments (20, 22). For Bacillus
subtilis,
B activity is regulated posttranslationally by
complex networks of protein-protein interactions governed by a variety
of environmental stresses (1, 20). Because one of the
promoters (P3) within the sar locus is
B dependent, it is
conceivable that the SigB protein influences sar expression. As the sar locus activates the synthesis of alpha-hemolysin
at the transcriptional level, presumably in part through the
interaction of SarA with the agr locus (15), we
speculate that sigB may modulate sarA expression
and the ensuing hla transcription.
In this study, we report the construction and characterization of a
sigB mutant of RN6390, a prototypic S. aureus
strain. The specificity of the mutation was confirmed by the absence of the SigB protein on an immunoblot, but the protein was restored in the
mutant by a shuttle plasmid carrying the sigB gene.
Phenotypic analysis revealed that the sigB mutant strain
secreted more alpha-hemolysin than the parental strain, as determined
by immunoblotting and Northern analysis. Complementation of the mutant
with the sigB gene in trans reestablished
alpha-hemolysin expression to near parental levels. Interestingly, the
hyperproduction of alpha-hemolysin coincided with elevated SarA
expression in the sigB mutant. Using the rabbit endocarditis
model, we found that the sigB mutation was stable in vivo.
We hypothesize that the hyperproduction of alpha-hemolysin in S. aureus as a result of the sigB mutation is mediated by
an increase in the SarA level which, in turn, enhances the
transcription of hla via a direct pathway (i.e.,
agr independent).
 |
MATERIALS AND METHODS |
Bacterial strains, plasmids, and growth media.
The bacterial
strains and plasmids used in this study are listed in Table
1. Phage
11 was used as the
transducing phage for S. aureus strains. CYGP, 0.3GL medium
(26), and tryptic soy broth (TSB) were used for the growth
of S. aureus strains, while Luria-Bertani medium was used
for growing Escherichia coli. Antibiotics were used at the
following concentrations: erythromycin at 5 µg/ml and ampicillin at
50 µg/ml.
Genetic manipulations in S. aureus.
A sigB
mutant of RN6390 was constructed as described previously
(12) by transducing the parental strain with a phage lysate of strain RUSA168 carrying the sigB mutation
(30). Transductants were selected on agar containing
erythromycin. Correct insertion of Tn551 into the
sigB locus of RN6390 was confirmed by Southern blotting with
Tn917 and sigB probes as described previously
(12). One transductant, ALC1001, was chosen for further studies.
To complement the
sigB mutation in ALC1001, we introduced
into the shuttle plasmid pSK236 a 1.6-kb fragment (derived from
pDG148)
containing the pSpac promoter followed by the polylinker
site and the
lacI repressor of
E. coli, yielding pALC1456.
Plasmid
pALC1496 was constructed by cloning the
sigB open
reading frame
into the multiple cloning site of pALC1456. The shuttle
plasmid
was electroporated into RN4220 and then transduced into
sigB mutant
ALC1001 with phage

11 as described previously
(
12). The presence
of the recombinant plasmid was confirmed
by restriction
mapping.
Production of anti-SigB monoclonal antibodies.
Based on the
published sequence (30), we amplified by PCR the 768-bp
sigB gene with the following primers:
5'-GCCAT2687ATGGCGAAAGAGTCGAAATCAGCT2710-3'
(NdeI site underlined) and
5'-GCGGATCCCTA3454TTGATGTGCTGCTTCTTG3437-3'
(BamHI site underlined). The correct PCR
product, verified by automated sequencing, was cloned into the
NdeI-BamHI sites of expression vector pET14b
(Novagen, Madison, Wis.) and transformed into E. coli
BL21(DE3).pLys.S. The resulting plasmid, pALC1270, contained an
N-terminal His tag and the entire sigB coding region.
Recombinant protein expression was induced by adding
isopropyl-

-
D-thiogalactopyranoside (IPTG) (1 mM) to a
growing culture
(30°C) at an optical density at 600 nm
(OD
600) of 0.5. Three hours
after induction, the cells were
harvested, resuspended in binding
buffer (5 mM imidazole, 0.5 M NaCl,
20 mM Tris-HCl [pH 7.9]),
and sonicated on ice. After removal of the
cellular debris by
centrifugation (15,000 ×
g for 15 min), the clarified supernatant
was purified on a nickel affinity
column in accordance with the
manufacturer's instructions. The protein
(

30,000 kDa) eluted
from the column with elution buffer (1 M
imidazole, 0.5 M NaCl,
20 mM Tris-HCl [pH 7.9]) appeared homogeneous
on a sodium dodecyl
sulfate gel (data not shown) and was authenticated
by sequencing
of the N-terminal 15 residues after the His tag had been
removed
by digestion with
thrombin.
Purified SigB was used to immunize two (BALB/c × SJL/J)
F
1 mice (100 µg each) to obtain monoclonal antibodies as
described
by Jones et al. (
21). The titers of the immune
sera were determined
by an enzyme-linked immunosorbent assay (ELISA) in
which diluted
sera were added to microtiter wells precoated with
purified SigB
(5 µg/ml). After hybridoma fusion, antibodies from
limiting dilutions
were screened by an ELISA with immobilized SigB
protein. Monoclonal
antibody 2D7 was purified from culture supernatants
with a protein
A affinity column (
21) and tested for
reactivity with purified
SigB on
immunoblots.
Phenotypic analysis of the sigB mutant and its
isogenic parent.
Several virulence traits of the sigB
mutant were evaluated. First, the production of alpha-, beta-, and
delta-hemolysins in the sigB mutant and its parental
counterpart was assessed by cross-streaking the tested strain with
indicator strains as described previously (9). To verify the
production of alpha-hemolysin on immunoblots, equivalent volumes of
extracellular proteins that had been harvested at the stationary phase
and concentrated 50-fold by use of a Centriprep concentrator (Amicon
Inc., Beverly, Mass.) were blotted onto nitrocellulose and probed with
rabbit anti-alpha-hemolysin antibody (a gift from B. Menzies,
Nashville, Tenn.) diluted 1:2,000 and then with the F(ab)2
fragment of the goat anti-rabbit antibody-alkaline phosphatase conjugate (Jackson ImmunoResearch, West Grove, Pa.) as described previously (7). Reactive bands were visualized as described by Blake et al. (5).
Taking advantage of the cytolytic effects of alpha-hemolysin upon
rabbit erythrocytes and platelets (
2,
4), two functional
assays for alpha-hemolysin production were performed. First,
alpha-hemolysin
levels were quantitated by assaying the hemolytic
titers of serially
diluted stationary-phase culture supernatants for
1% washed rabbit
erythrocytes as described previously (
2,
4). Purified alpha-hemolysin
was used as the positive control.
The data were expressed as mean
units of hemolytic activity per
milliliter of culture supernatant
from two separate runs. The hemolytic
units were defined as the
reciprocal of the highest dilution of the
culture supernatant
causing 50% erythrocyte lysis. Second, the extent
of alpha-hemolysin
production was ascertained by measuring platelet
lysis spectrophotometrically
(at OD
600) upon exposure to
bacterial supernatants as described
previously (
2).
In addition to hemolysins, we also measured other putative virulence
traits, such as fibronectin- and fibrinogen-binding capacities.
The
fibronectin-binding capacity of the isogenic pair was compared
with an
125I fibronectin-binding assay as described previously
(
9). The
fibrinogen-binding capacity was determined
semiquantitatively
by immunoblotting. Cell wall proteins from
equivalent numbers
of bacterial cells grown overnight were extracted as
described
previously (
10). Equivalent volumes of cell wall
extracts (10
µl) were resolved on sodium dodecyl sulfate gels and
transferred
to nitrocellulose. The nitrocellulose membranes were then
blocked
with blocking buffer (0.01 M Tris, 0.5 M NaCl, 0.5% Tween 20 [pH
8.2]) containing 1% bovine serum albumin for 1 h at 37°C,
incubated
at 37°C with fibrinogen (1 mg/ml) in the same buffer, and
washed
three times with blocking buffer and finally with goat
antifibrinogen
antibody conjugated to alkaline phosphatase (1:1,000) as
described
previously (
13). As both coagulase and clumping
factor bind
fibrinogen (
14,
29), we assayed for the presence
of these
proteins in cell wall extracts by immunoblotting.
Nitrocellulose
membranes containing cell wall extracts were incubated
with blocking
buffer containing 0.1% human serum (for the blocking
protein A-Fc
interaction) for 1 h at room temperature. Rabbit
anticoagulase
(1:1,000) and anti-ClfA (1:1,000) antibodies were then
added to
separate blots, followed by goat anti-rabbit
antibody-alkaline
phosphatase conjugate (1:10,000). All reactive bands
were visualized
as described by Blake et al. (
5).
Isolation of RNA and Northern blot hybridization.
Overnight
cultures of S. aureus were diluted 1:50 in CYGP and grown to
the mid-log (OD650, 0.7), late log (OD650,
1.1), and postexponential (OD650, 1.7) phases. The cells
were pelleted and processed with a FastRNA isolation kit (Bio 101, Inc., Vista, Calif.) in combination with 0.1-mm-diameter
sirconia-silica beads in a FastPrep reciprocating shaker (Bio 101) as
described previously (8). Ten micrograms of each sample was
electrophoresed through a 1.5% agarose-0.66 M formaldehyde gel in
morpholinepropanesulfonic acid (MOPS) running buffer (20 mM MOPS, 10 mM
sodium acetate, 2 mM EDTA [pH 7.0]). Blotting of RNA onto Hybond
N+ membranes (Amersham, Arlington Heights, Ill.) was
performed with a Turboblotter alkaline transfer system (Schleicher
& Schuell, Inc., Keene, N.H.). For detection of specific transcripts
(agr, sar, and hla), gel-purified DNA
probes were radiolabeled with [
-32P]dCTP by the
random-primer method (Ready-To-Go labeling kit; Pharmacia) and
hybridized under high-stringency conditions (7). The blots
were subsequently washed and autoradiographed.
Preparation of cell extracts and immunoblot analysis of SigB and
SarA in the sigB mutant.
Cell extracts were prepared
for strain RN6390 and the corresponding sigB mutant. After
being pelleted, the cells were resuspended in 1 ml of TEG buffer (25 mM
Tris, 5 mM EGTA [pH 8]), and cell extracts were prepared from
lysostaphin-treated cells as described previously (15).
Cell extracts were immunoblotted onto nitrocellulose membranes as
described above. For the detection of SigB and SarA, monoclonal
antibodies 2D7 (1:1,000 dilution) and 1D1 (1:2,500 dilution),
respectively, were added to an immunoblot and allowed to incubate
with
the membrane for 3 h, followed by another h of incubation
with a
1:10,000 dilution of goat anti-mouse antibody-alkaline
phosphatase
conjugate. The reactive bands were visualized as described
previously
(
5).
Determination of SarA levels by a competitive ELISA.
Microtiter wells were coated with purified SarA protein (ca. 3 µg/ml)
in 0.1 M Tris-0.3 mM MgCl2 (pH 10) for 3 h at 37°C. After being washed with phosphate-buffered saline (PBS)-Brij (pH 7.4),
the wells were blocked with PBS-Brij containing 1% bovine serum
albumin overnight at 4°C. The optimal dilution of antibody, defined
as the dilution at which 50% of the antibody (i.e., 50% of the
maximum amount of bound antibody) bound to the protein-coated wells,
was determined to be 1:20,000. Using anti-SarA antibody 1D1 at the
optimal dilution (1:20,000), we constructed a standardized curve by
adding known quantities of purified SarA (0 to 25 µg/ml) to compete
for binding to the anti-SarA antibody, resulting in inhibition of
binding to the immobilized SarA protein. For the competitive assay,
triplicate cell extracts prepared from individual sar mutant
clones (see above for preparation methods) were substituted for
purified SarA. The protein concentrations in the cell extracts were
determined with a protein assay kit from Bio-Rad Laboratories, Hercules, Calif. By comparing the levels of inhibition to the standardized curve, the relative concentration of the SarA protein in
each extract was derived.
Rabbit model of endocarditis.
To ascertain the stability of
the sigB mutation in vivo, we chose the rabbit model of
endocarditis. Briefly, a bacterial suspension harvested from an
overnight culture was diluted in PBS, and bacterial numbers were
confirmed by plate counting. Endocarditis on the aortic valves of New
Zealand White rabbits (2 kg) was induced by catheterization as
previously described (9). At 48 h postcatheterization, groups of animals (three each) were separately challenged intravenously with an inoculum of either 2 × 105 or 2 × 106 CFU. Catheters remained in place until animals were
sacrificed by lethal intravenous injection of sodium pentobarbital (100 mg/kg of body weight). At the time of sacrifice (48 h postinfection), aortic valves and left ventricular vegetations from infected animals were removed, pooled, homogenized, and quantitatively cultured. Some
colonies were then examined for the retention of the sigB mutation after in vivo passage by Southern (with a Tn551
probe) and Western blotting.
 |
RESULTS |
Construction of a sigB mutant of RN6390.
The
mutation in a Tn551 insertion mutant, RUSA168, was
previously mapped to the sigB gene of S. aureus
COL (30). To assess the phenotypic effect of the
sigB mutation in a genetic background with well-defined
virulence determinants (9), we elected to transduce the
mutation from RUSA168 to RN6390 to yield mutant ALC1001. Southern blot
hybridization with a Tn917 probe which shows significant
homology with Tn551 revealed that the transposon insertion
in ALC1001 was analogous to that found in RUSA168 (data not shown). To
further confirm the mutation, we made use of the observation that the
P3 promoter of the sar locus of S. aureus is
B
dependent (17, 25). Northern analysis revealed that P3-initiated sarC transcription was absent in strain
ALC1001, whereas the
A-dependent P1 promoter of sar was
unaffected (Fig. 1). Complementation
studies with plasmid pALC1496, carrying the sigB gene,
revealed that complemented mutant ALC1497 showed sarC transcription. Of note, the pSpac promoter was found to be active in
S. aureus even in the absence of the inducing agent IPTG,
suggesting that, contrary to observations made for B. subtilis (18), this promoter is leaky in the
staphylococcal background.

View larger version (56K):
[in this window]
[in a new window]
|
FIG. 1.
Northern analysis of sar transcripts of
S. aureus RN6390, its isogenic sigB mutant
ALC1001, and complemented mutant ALC1497. Northern analysis revealed
that the sigB gene was transcribed in ALC1497 (data not
shown). Ten micrograms of total cellular RNA obtained at the stationary
phase (OD650, 1.7, as determined with an 18-mm borosilicate
glass tube) was applied to each lane. The probe was a 730-bp
sarA fragment (nucleotides 620 to 1349, based on the
published sequence) (3). Because the transcription of
sarB, the largest transcript within the sar
locus, was minimal during the late log and stationary phases, only data
for sarA and sarC transcripts are shown.
|
|
To ascertain if the mutation in ALC1001 was indeed due to
sigB, we probed a cell lysate of the mutant with anti-SigB
monoclonal
antibody 2D7 in an immunoblot. As shown in Fig.
2, SigB was not
detectable in the mutant,
while the parental strain (RN6390) as
well as the complemented mutant
strain (ALC1497) were found to
contain SigB, as confirmed by the
reactivity of the cell extract
with the anti-SigB antibody.
Additionally, SigB was not found
in the mutant strain carrying the
vector alone (data not shown).
Consistent with the observation that
SigB, being a regulatory
molecule, is present in a low quantity in
cells, we were able
to discern the presence of SigB only upon loading
at least 50
µg of cellular proteins from the parental strain.

View larger version (40K):
[in this window]
[in a new window]
|
FIG. 2.
Immunoblot of cell extracts of the parental strain,
sigB mutant strain ALC1001, and complemented mutant strain
ALC1497 probed with anti-sigB monoclonal antibody 2D7 (1:1,000
dilution). About 50 µg of cellular proteins was applied to each lane.
The experiment was repeated two times, with essentially the same
results. M. W., molecular weight. Numbers at left are in
thousands.
|
|
To determine the stability of the
sigB mutation in vivo, we
infected rabbits that had been previously catheterized to produce
thrombotic endocarditis with ALC1001. After harvesting the bacteria
obtained from the cardiac vegetations of this animal model, we
confirmed by Southern and Western analyses that the
sigB
mutation
remained stable after in vivo passage (data not
shown).
Phenotypic characterization of sigB mutant
ALC1001.
When ALC1001 and RUSA168 were streaked on blood agar
plates, it was observed that the clear zone of hemolysis surrounding 24-h cultures was significantly enhanced in both sigB
mutants compared with the respective parental strains. As the virulence determinants of RN6390 are well described (9), we chose to focus our analysis on sigB mutant ALC1001. In quantitative
hemolysis assays for alpha-hemolysin, the culture supernatant of mutant ALC1001 yielded a mean hemolytic titer of 1,560 U/ml, while the corresponding parental strain titer was 490 U/ml. Purified
alpha-hemolysin yielded a titer of 22,736 U/mg of protein. As an
additional assay for the functional aspects of alpha-hemolysin, we also
found that the culture supernatant of ALC1001 had a greater capacity to
lyse platelets than the isogenic parental strain, as monitored by a decrease in the OD600 in a turbidimetric assay (Fig.
3). An immunoblot of equivalent amounts
of extracellular proteins of ALC1001, RN6390, and complemented strain
ALC1497 disclosed that alpha-hemolysin was synthesized at a higher
level in the sigB mutant than in the parental strain but was
present at near the parental level in ALC1497 (Fig.
4A). In measuring the transcriptional
activity of hla by Northern blotting, we also found that the
hla mRNA level of ALC1001 was higher than that of RN6390
(Fig. 4B). Complementation of sigB mutant ALC1001 with a
sigB-carrying plasmid (pALC1496) expressing the
sigB transcript (data not shown) restored hla
transcription to the parental level (Fig. 4B). Similar results on the
expression of alpha-hemolysin were observed with RUSA168 complemented
with the sigB-carrying plasmid pALC1496 (data not shown).
Collectively, these data imply that the sigB mutation is
associated with enhanced hla expression initiated at the
transcriptional level.

View larger version (18K):
[in this window]
[in a new window]
|
FIG. 3.
Lysis of platelets monitored on the basis of
OD600. The supernatants of 18-h bacterial cultures in TSB
were mixed with platelets (109 platelets/ml). Platelet
lysis was monitored by measuring the decrease in the OD600
over time (2). The medium and purified alpha-toxin served as
the negative and positive controls, respectively. Symbols: diamonds,
TSB control plus washed platelets; squares, RN6390 (supernatant) plus
washed platelets; triangles, SigB (supernatant) plus washed platelets;
circles, purified alpha-toxin (1 mg/ml) plus washed platelets.
|
|

View larger version (23K):
[in this window]
[in a new window]
|
FIG. 4.
Western and Northern analyses of the alpha-hemolysin
gene product. (A) An immunoblot of extracellular proteins of ALC1001,
its isogenic parent RN6390, and complemented strain ALC1497 from the
late log phase was probed with rabbit anti-alpha-hemolysin antibody
(1:2,500 dilution). (B) Ten micrograms of total cellular RNA obtained
from the late log to early stationary phases was applied to each lane.
The probe was a 3-kb EcoRI-HindIII fragment
of the alpha-hemolysin gene (7). Similar complementation
results were obtained with another sigB mutant (RUSA168) and
plasmid pALC1496. These experiments were repeated three times, with
similar results. The results of a representative experiment are
shown.
|
|
The effect of the
sigB mutation on beta-hemolysin secretion,
as assayed on immunoblots, was more equivocal, with only a marginal
increase in ALC1001 and no change in RUSA168 compared with the
results
for the respective parental strains. In comparison to
that in RN6390,
the expression of delta-hemolysin (
hld) in ALC1001
on
cross-streaked blood agar plates was not altered (see below
for the
RNAIII transcript encoding
hld).
As cell wall-associated proteins such as fibronectin- and
fibrinogen-binding proteins likely play a role in mediating the
binding
of
S. aureus to catheters and host valvular tissues (
9,
11,
24,
28), we also assessed the ability of the isogenic
pair to
bind fibronectin and fibrinogen in vitro. The binding
of mutant strain
ALC1001 to radiolabeled fibronectin was similar
to that of parental
strain RN6390 (11,480 ± 856 [mean ± standard
error of the
mean] cpm versus 11,455 ± 816 cpm). In contrast,
the
sigB mutant bound more fibrinogen than its parental
counterpart
(Fig.
5A). Recognizing that
multiple fibrinogen-binding proteins
may be affected by the
sigB mutation, we probed immunoblots containing
cell wall
extracts of the isogenic pair with anti-clumping factor
(ClfA) and
anticoagulase (Coa) antibodies (Fig.
5B and
3C). In
comparison to that
in RN6390, the expression of ClfA and Coa in
sigB mutant
ALC1001 was augmented, confirming the observation
that the
sigB mutant strain has a higher fibrinogen-binding capacity
than the isogenic parental strain.

View larger version (17K):
[in this window]
[in a new window]
|
FIG. 5.
Immunoblots of cell wall extracts of RN6390 and ALC1001
probed with fibrinogen (A), anti-ClfA antibody (B), and anti-Coa
antibody (C). Equivalent amounts of cell extracts were applied to the
lanes. The positive controls were fibrinogen (A) and purified coagulase
(C). M.W., molecular weight. Numbers at left are in thousands.
|
|
Expression of agr and sar in
sigB mutant ALC1001.
The expression of alpha-hemolysin
is influenced by global regulatory loci such as agr and
sar. To assess if the sigB mutation in ALC1001
affected the ability of these loci to modulate alpha-hemolysin expression, we performed Northern blotting and showed that the expression of RNAII and RNAIII of the agr locus was not
altered in the mutant strain relative to the parental strain (data not shown).
We have shown that the
sarC transcript was absent in
sigB mutant ALC1001 but was restored upon complementation
(Fig.
1). Concomitant
with the decrease in
sarC
transcription in
sigB mutant ALC1001
was the repeated
observation of an increase in
sarA transcription
in that
strain (Fig.
1) as well as in RUSA168 (data not shown).
Notably,
sarA transcription was present at near the parental level
in
complemented mutant ALC1497. In contrast to RNA-mediated control
of the
agr locus, genetic analyses have indicated that the major
regulatory molecule of
sar is the SarA protein (
7,
15). To
assess SarA expression, we probed an immunoblot of cell
extracts
of the isogenic pair with anti-SarA monoclonal antibody 1D1.
The
binding epitope of this antibody was recently mapped to residues
16 to 43 of the N terminus of the SarA molecule (
16). Our data
indicated that the expression of SarA, as determined by immunoblotting,
was higher in ALC1001 than in its isogenic parent RN6390 (Fig.
6). This pattern of SarA expression held
true in three repetitions
of the experiment. Using a recently described
competitive ELISA
(
16) and the cell extracts of these two
strains as competitors
of 1D1 binding to immobilized purified SarA, we
confirmed that
the SarA level was elevated in mutant strain ALC1001
(280 ± 25
ng/mg of extract proteins) compared with the parental
strain (170
± 9 ng/mg). Collectively, these data support the
notion that a
sigB mutation results in enhanced SarA
expression, thereby leading
to an ensuing increase in alpha-hemolysin
expression via an
agr-independent
mechanism.

View larger version (30K):
[in this window]
[in a new window]
|
FIG. 6.
Immunoblot of cell extracts of RN6390 and ALC1001 probed
with anti-SarA monoclonal antibody 1D1 (1:2,500 dilution). About 30 µg of protein was applied to each lane. The positive control was
purified SarA protein (14.5 kDa). M.W., molecular weight. Numbers at
left are in thousands.
|
|
 |
DISCUSSION |
The sigB locus of S. aureus, contrary to the
eight-gene sigB operon of B. subtilis
(rsbR-rsbS-rsbT-rsbU-rsbV-rsbW-sigB-rsbX), comprises in
sequential order four open reading frames which show sequence
similarity to the rsbU-rsbV-rsbW-sigB gene cluster of B. subtilis (Fig. 7)
(30). Transcriptional analysis indicated that the
sigB operon in B. subtilis is transcribed from
two distinct but convergent promoters, the
A and
B promoters
upstream of rsbR and rsbV, respectively. Although
sequence analysis of the sigB locus of S. aureus
disclosed potential
A- and
B-like promoter sequences upstream of
rsbU and rsbV, respectively, the transcription start sites attributed to these putative promoters have not been experimentally confirmed. Irrespective of whether these two putative promoters or possibly another or others are active, it is likely that
sigB is the last gene encoded with the mRNA message.

View larger version (9K):
[in this window]
[in a new window]
|
FIG. 7.
Organization of the sigB operon in B. subtilis and S. aureus. In contrast to those in
B. subtilis, the functions of the putative rsbU,
rsbV, and rsbW genes in S. aureus have
not been demonstrated. Similarly, the putative A and B promoters
in S. aureus have not been experimentally confirmed.
|
|
Because the Tn551 insertion site in sigB mutant
RUSA168 has been mapped to approximately nucleotide position 3254 (30) (or 189 residues from the initiation codon and 67 residues from the termination codon), we wanted to assess if the SigB
protein was indeed absent in sigB mutant ALC1001. Immunoblot
analysis with anti-SigB monoclonal antibody 2D7 revealed the absence of
the SigB protein in the mutant strain compared with parental strain RN6390 (Fig. 2). This finding was also confirmed with an additional blot probed with mouse anti-SigB polyclonal antibody (data not shown),
indicating that it is unlikely that SigB is synthesized as a truncated
form. As the transposon insertion site in the sigB mutant is
near the 3' end of the sigB coding region and
sigB may be the last gene transcribed in the polycistronic
message, it is unlikely that the Tn551 insertion in the
mutant significantly alters the transcription and translation of genes
upstream (i.e., rsbU, rsbV, and rsbW).
As an additional confirmation that sigB was altered in
mutant ALC1001, we took advantage of the fact that the sarC
promoter within the triple-promoter system of sar is
B
dependent (17, 25). Predictably, the sarC
transcript was absent in mutant ALC1001 but was restored upon
complementation with a plasmid carrying a functional copy of the
sigB gene (Fig. 1). Collectively, these data clearly
indicated that mutant ALC1001 is defective in the synthesis of SigB.
In analyzing some of the phenotypes related to virulence in
sigB mutant ALC1001, we found that both extracellular and
cell wall proteins were altered. In particular, the capacity to bind fibrinogen as well as the production of alpha-hemolysin were enhanced in the sigB mutant compared with the parent. The augmented
fibrinogen-binding capacity was probably mediated by upregulation in
the expression of both clumping factor and coagulase in sigB
mutant ALC1001 (Fig. 5). Clearly, the sigB mutation was
linked to elevated expression of functional alpha-hemolysin at the
transcriptional level in two S. aureus strains (ALC1001 and
RUSA168) that we examined (Fig. 4B). This linkage was confirmed by
complementation studies showing that the hyperproduction of
alpha-hemolysin in the mutant could be restored to near the parental
level when sigB was supplied in trans on a
shuttle plasmid. In addition to these phenotypic alterations, Kullik et
al. (23) recently reported that a cytoplasmic protein
identified as alkaline shock protein 23 was missing in a
sigB deletion mutant, while staphylococcal thermonuclease,
an extracellular protein, was secreted at a higher level than in the
nonmutated controls. However, despite the pleiotropic nature of SigB in
modulating a variety of genes, our results demonstrated that the effect
of a sigB mutation on target gene expression can also be
selective. For instance, a mutation in sigB in S. aureus can upregulate the expression of alpha-hemolysin but leave
beta-hemolysin expression relatively unaltered. Similarly, such a
mutation can enhance the expression of coagulase and clumping factor
but not fibronectin-binding proteins.
It was recently shown that the SigB protein of S. aureus can
activate
B-dependent promoters in vitro (17). In
addition, we have shown (25), as have others
(17), that one of the promoters within the sar
locus (i.e., the sarC, or P3, promoter) is
B dependent. Because of the observation that a sigB mutant has phenotypes
consistent with the upregulation of sar (increased
alpha-hemolysin production and increased fibrinogen-binding capacity),
it seemed reasonable to explore if SigB may directly or indirectly
modulate global regulatory loci, such as sar and/or
agr, to effect these phenotypic changes. However, scrutiny
of the agr promoter region did not reveal any
B-dependent
promoter sequences. Additionally, Northern analysis indicated that the
transcription of RNAII and RNAIII in the agr locus was not
altered in ALC1001, implying that SigB does not modulate
agr-related transcription.
The sar locus has a triple-promoter system for which the
major regulatory element is the 14.5-kDa SarA protein (124 residues) (3, 7, 15). The sarA gene is encoded by each of
three transcripts initiated from three distinct promoters, designated P1, P2, and P3 (3). In particular, the
A-dependent
proximal P1 and distal P2 promoters of sar are maximally
expressed during the exponential phase, while
B-dependent P3
promoter expression peaks postexponentially (7, 25). We
speculate that differential promoter activation within sar
may lead to disparate expression of the SarA protein (16,
25), the major regulatory molecule in the control of hemolysin
production in S. aureus (7). To assess if a
sigB mutation would lead to an increase in SarA expression and hence overproduction of alpha-hemolysin, we first established by
immunoblotting and an ELISA that the SarA level was higher in the
sigB mutant than in the parental control. Based on the phenotypes related to sar (9), a higher SarA
protein level will likely enhance the expression of alpha-hemolysin
(16). This notion was confirmed by Northern and Western
analyses showing that the expression of hla was increased in
a sigB mutant but was restored to normal levels upon
complementation with a plasmid carrying sigB. Notably, the
effect of a higher SarA level on target gene expression could not be
mediated by agr, as evidenced by the fact that
agr-related transcription was no different in mutant ALC1001
than in RN6390. In previous studies (9, 14), we inferred from phenotypic analysis that the sar locus may have its own
direct effect on target gene expression (e.g., beta-hemolysin and
fibrinogen-binding proteins). In addition, we demonstrated that the
SarA protein may bind to target gene promoters (e.g., the
fibronectin-binding protein gene) in gel shift assays (14).
Collectively, these data suggested that an increase in alpha-hemolysin
expression as well as an upregulation of fibrinogen-binding proteins
may occur by an agr-independent but SarA-dependent
mechanism. As agr is not substantially altered in the
sigB mutant, it is likely that a factor(s) other than SarA
also is involved in the expression of genes perturbed by SigB. Because
SigB participates in the general stress response of gram-positive
bacteria (20), it seems plausible that
B-dependent genes
act in concert with SarA to modulate target gene expression.
The mechanism by which inactivation of sigB leads to
elevated SarA protein levels is not fully understood. Using
sar promoter-XylE reporter fusions, we recently showed that
a combined P3-P1 promoter is less active than a P1 promoter alone,
suggesting that the P3 promoter may have a downregulatory effect on
transcription from the P1 promoter of sar. A careful
analysis of the sequence between the P3 and P1 promoters revealed a
16-bp inverted repeat. Gel shift studies revealed that a 12-kDa protein
binds to this repeat (25). Additional genetic analysis
indicated that the 12-kDa protein may be a repressor (unpublished
data). Based on these data, we hypothesize that the P3 promoter (from
which the sarC transcript is generated), upon activation by
SigB, may undergo conformational changes to allow binding by the
repressor protein. Presumably, a lack of SigB may interfere with the
binding of this repressor protein, resulting in enhanced transcription
from the P1 promoter and the ensuing elevated SarA expression. In
concordance with this hypothesis is the observation that the level of
sarA transcription was found to be consistently higher in
sigB mutant strain ALC1001 than in the parental strain but
returned to near the parental level upon complementation (Fig. 1).
Additional experiments to address the interaction between SigB and this
repressor protein are currently in progress.
 |
ACKNOWLEDGMENTS |
We thank Alexander Tomasz for providing the sigB
mutant strain RUSA168; Bill Haldenwang for supplying pDG148; Tim Foster
for providing anti-ClfA antibody; H. Igarishi for providing
anti-coagulase antibody; Michael Yeaman for providing guidance in the
platelet lysis assays; and Kelly Eberhardt, Cong Li, and Iri
Kupferwasser for excellent technical assistance.
This work was supported in part by grants-in-aid from the American
Heart Association and the New York Heart Association and by NIH grants
AI30061 and AI37142 to A.L.C. and by NIH grant AI39108 to A.S.B.
Y.-T.C. was supported by a New York Heart Participatory Laboratory
Award. A.L.C. is a recipient of the Irma T. Hirshl Career Scientist
Award as well as the AHA-Genentech Established Investigator Award from
the American Heart Association.
 |
FOOTNOTES |
*
Corresponding author. Mailing address: Laboratory of
Bacterial Pathogenesis and Immunology, The Rockefeller University, 1230 York Ave., New York, NY 10021. Phone: 212-327-8163. Fax: 212-327-7584. E-mail: cheunga{at}rockvax.rockefeller.edu.
Editor:
E. I. Tuomanen
 |
REFERENCES |
| 1.
|
Akbar, S.,
C. M. Kang,
T. A. Gaidenko, and C. W. Price.
1997.
Modulator protein RsbR regulates environmental signalling in the general stress pathway of Bacillus subtilis.
Mol. Microbiol.
24:567-578[Medline].
|
| 2.
|
Bayer, A. S.,
M. D. Ramos,
B. E. Menzies,
M. R. Yeaman,
A. Shen, and A. L. Cheung.
1997.
Hyperproduction of alpha-toxin by Staphylococcus aureus results in paradoxically reduced virulence in experimental endocarditis host defense role for platelet microbicidal protein.
Infect. Immun.
65:4652-4660[Abstract].
|
| 3.
|
Bayer, M. G.,
J. H. Heinrichs, and A. L. Cheung.
1996.
The molecular architecture of the sar locus in Staphylococcus aureus.
J. Bacteriol.
178:4563-4570[Abstract/Free Full Text].
|
| 4.
|
Bernheimer, A. S. W.
1988.
Assay of hemolytic toxins.
Methods Enzymol.
165:213-217[Medline].
|
| 5.
|
Blake, M. S.,
K. H. Johnston,
G. J. Russell-Jones, and E. C. Gotschlich.
1984.
A rapid sensitive method for detection of alkaline phosphatase-conjugated anti-antibody on Western blots.
Anal. Biochem.
136:175-179[Medline].
|
| 6.
|
Boyce, J. M.
1997.
Epidemiology and prevention of nosocomial infections, p. 309-329.
In
K. B. Crossley, and G. L. Archer (ed.), The staphylococci in human disease. Churchill Livingstone, New York, N.Y.
|
| 7.
|
Cheung, A. L.,
M. G. Bayer, and J. H. Heinrichs.
1997.
sar genetic determinants necessary for transcription of RNAII and RNAIII in the agr locus of Staphylococcus aureus.
J. Bacteriol.
179:3963-3971[Abstract/Free Full Text].
|
| 8.
|
Cheung, A. L.,
K. Eberhardt, and V. A. Fischetti.
1994.
A method to isolate RNA from gram-positive bacteria and Mycobacteria.
Anal. Biochem.
222:511-514[Medline].
|
| 9.
|
Cheung, A. L.,
K. J. Eberhardt,
E. Chung,
M. R. Yeaman,
P. M. Sullam,
M. Ramos, and A. S. Bayer.
1994.
Diminished virulence of a sar agr mutant of Staphylococcus aureus in the rabbit model of endocarditis.
J. Clin. Investig.
94:1815-1822.
|
| 10.
|
Cheung, A. L., and V. A. Fischetti.
1988.
Variation in the expression of cell wall proteins of Staphylococcus aureus grown on solid and liquid media.
Infect. Immun.
56:1061-1065[Abstract/Free Full Text].
|
| 11.
|
Cheung, A. L., and V. A. Fischetti.
1990.
The role of fibrinogen in staphylococcal adherence to catheters in vitro.
J. Infect. Dis.
161:1177-1186[Medline].
|
| 12.
|
Cheung, A. L.,
J. M. Koomey,
C. A. Butler,
S. J. Projan, and V. A. Fischetti.
1992.
Regulation of exoprotein expression in Staphylococcus aureus by a locus (sar) distinct from agr.
Proc. Natl. Acad. Sci. USA
89:6462-6466[Abstract/Free Full Text].
|
| 13.
|
Cheung, A. L.,
S. J. Projan,
R. Edelstein, and V. A. Fischetti.
1995.
Cloning, expression, and nucleotide sequencing of a Staphylococcus aureus gene (fbpA) encoding a fibrinogen binding protein.
Infect. Immun.
63:1914-1920[Abstract].
|
| 14.
|
Cheung, A. L., and C. Wolz.
1997.
Regulation of fibronectin binding by the sar locus of Staphylococcus aureus, abstr. B-60, p. 37.
In
Abstracts of the 37th Intersceince Conference on Antimicrobial Agents and Chemotherapy. American Society for Microbiology, Washington, D.C.
|
| 15.
|
Chien, Y., and A. L. Cheung.
1998.
Molecular interactions between two global regulators, sar and agr, in Staphylococcus aureus.
J. Biol. Chem.
237:2645-2652.
|
| 16.
|
Chien, Y. T.,
A. C. Manna, and A. L. Cheung.
1998.
SarA level is a determinant of agr activation in Staphylococcus aureus.
Mol. Microbiol.
31:991-1001.
|
| 17.
|
Deora, R.,
T. Tseng, and T. K. Misra.
1997.
Alternative transcription factor SB of Staphylococcus aureus: characterization and role in transcription of the global regulatory locus sar.
J. Bacteriol.
179:6355-6359[Abstract/Free Full Text].
|
| 18.
|
Dufour, A.,
U. Voelker,
A. Voelker, and W. G. Haldenwang.
1996.
Relative levels and fractionation properties of Bacillus subtilis sigma B and its regulators during balanced growth and stress.
J. Bacteriol.
178:3701-3709[Abstract/Free Full Text].
|
| 19.
|
Gaskill, M. E., and S. A. Khan.
1988.
Regulation of the enterotoxin B gene in Staphylococcus aureus.
J. Biol. Chem.
263:6276-6280[Abstract/Free Full Text].
|
| 20.
|
Haldenwang, W. G.
1995.
The sigma factors of Bacillus subtilis.
Microbiol. Rev.
59:506-531[Abstract/Free Full Text].
|
| 21.
|
Jones, K. F.,
B. N. Manjula,
K. H. Johnston,
S. K. Hollingshead,
J. R. Scott, and V. A. Fischetti.
1985.
Location of variable and conserved epitopes among the multiple serotypes of streptococcal M protein.
J. Exp. Med.
161:623-628[Abstract/Free Full Text].
|
| 22.
|
Kornblum, J.,
B. Kreiswirth,
S. J. Projan,
H. Ross, and R. P. Novick.
1990.
agr: a polycistronic locus regulating exoprotein synthesis in Staphylococcus aureus, p. 373-402.
In
R. P. Novick (ed.), Molecular biology of the staphylococci. VCH Publishers, New York, N.Y.
|
| 23.
|
Kullik, I.,
P. Gianchino, and T. Fuchs.
1998.
Deletion of the alternative sigma factor B in Staphylococcus aureus reveals its function as a global regulator of virulence genes.
J. Bacteriol.
180:4814-4820[Abstract/Free Full Text].
|
| 24.
|
Kuypers, J. M., and R. A. Proctor.
1989.
Reduced adherence to traumatized rat heart valves by a low-fibronectin-binding mutant of Staphylococcus aureus.
Infect. Immun.
57:2306-2312[Abstract/Free Full Text].
|
| 25.
|
Manna, A. C.,
M. G. Bayer, and A. L. Cheung.
1998.
Transcriptional analysis of different promoters in the sar locus in Staphylococcus aureus.
J. Bacteriol.
180:3828-3836[Abstract/Free Full Text].
|
| 26.
|
Novick, R. P.
1990.
The staphylococcus as a molecular genetic system, p. 1-40.
In
R. P. Novick (ed.), Molecular biology of the staphylococci. VCH Publishers, New York, N.Y.
|
| 27.
|
O'Reilly, M.,
J. C. S. de Azavedo,
S. Kennedy, and T. J. Foster.
1986.
Inactivation of the alpha-hemolysin of Staphylococcus aureus 8325-4 by site directed mutagenesis and studies on the expression of its haemolysins.
Microb. Pathog.
1:125-138[Medline].
|
| 28.
|
Scheld, W. M.,
J. A. Valone, and M. A. Sande.
1978.
Bacterial adherence in the pathogenesis of endocarditis. Interaction of bacterial dextran, platelets and fibrin.
J. Clin. Investig.
61:1394-1404.
|
| 29.
|
Wolz, C.,
D. McDevitt,
T. J. Foster, and A. L. Cheung.
1996.
The influence of agr on fibrinogen binding in Staphylococcus aureus Newman.
Infect. Immun.
64:3142-3147[Abstract].
|
| 30.
|
Wu, S.,
H. de Lencastre, and A. Tomasz.
1996.
Sigma-B, a putative operon encoding alternate sigma factor of Staphylococcus aureus RNA polymerase: molecular cloning and DNA sequencing.
J. Bacteriol.
178:6036-6042[Abstract/Free Full Text].
|
Infection and Immunity, March 1999, p. 1331-1337, Vol. 67, No. 3
0019-9567/99/$04.00+0
Copyright © 1999, American Society for Microbiology. All rights reserved.
This article has been cited by other articles:
-
Somerville, G. A., Proctor, R. A.
(2009). At the Crossroads of Bacterial Metabolism and Virulence Factor Synthesis in Staphylococci. Microbiol. Mol. Biol. Rev.
73: 233-248
[Abstract]
[Full Text]
-
Fu, Z., Tamber, S., Memmi, G., Donegan, N. P., Cheung, A. L.
(2009). Overexpression of MazFSa in Staphylococcus aureus Induces Bacteriostasis by Selectively Targeting mRNAs for Cleavage. J. Bacteriol.
191: 2051-2059
[Abstract]
[Full Text]
-
Cheung, A. L., Nishina, K., Manna, A. C.
(2008). SarA of Staphylococcus aureus Binds to the sarA Promoter To Regulate Gene Expression. J. Bacteriol.
190: 2239-2243
[Abstract]
[Full Text]
-
Rogasch, K., Ruhmling, V., Pane-Farre, J., Hoper, D., Weinberg, C., Fuchs, S., Schmudde, M., Broker, B. M., Wolz, C., Hecker, M., Engelmann, S.
(2006). Influence of the Two-Component System SaeRS on Global Gene Expression in Two Different Staphylococcus aureus Strains.. J. Bacteriol.
188: 7742-7758
[Abstract]
[Full Text]
-
Palma, M., Bayer, A., Kupferwasser, L. I., Joska, T., Yeaman, M. R., Cheung, A.
(2006). Salicylic Acid Activates Sigma Factor B by rsbU-Dependent and -Independent Mechanisms.. J. Bacteriol.
188: 5896-5903
[Abstract]
[Full Text]
-
Kazmierczak, M. J., Wiedmann, M., Boor, K. J.
(2005). Alternative Sigma Factors and Their Roles in Bacterial Virulence. Microbiol. Mol. Biol. Rev.
69: 527-543
[Abstract]
[Full Text]
-
Senn, M. M., Giachino, P., Homerova, D., Steinhuber, A., Strassner, J., Kormanec, J., Fluckiger, U., Berger-Bachi, B., Bischoff, M.
(2005). Molecular Analysis and Organization of the {sigma}B Operon in Staphylococcus aureus. J. Bacteriol.
187: 8006-8019
[Abstract]
[Full Text]
-
Senn, M. M., Bischoff, M., von Eiff, C., Berger-Bachi, B.
(2005). {sigma}B Activity in a Staphylococcus aureus hemB Mutant. J. Bacteriol.
187: 7397-7406
[Abstract]
[Full Text]
-
Kahl, B. C., Belling, G., Becker, P., Chatterjee, I., Wardecki, K., Hilgert, K., Cheung, A. L., Peters, G., Herrmann, M.
(2005). Thymidine-Dependent Staphylococcus aureus Small-Colony Variants Are Associated with Extensive Alterations in Regulator and Virulence Gene Expression Profiles. Infect. Immun.
73: 4119-4126
[Abstract]
[Full Text]
-
Cheung, A. L., Manna, A. C.
(2005). Role of the Distal sarA Promoters in SarA Expression in Staphylococcus aureus. Infect. Immun.
73: 4391-4394
[Abstract]
[Full Text]
-
Zhang, H., Morikawa, K., Ohta, T., Kato, Y.
(2005). In vitro resistance to the CS{alpha}{beta}-type antimicrobial peptide ASABF- is conferred by overexpression of sigma factor sigB in Staphylococcus aureus. J Antimicrob Chemother
55: 686-691
[Abstract]
[Full Text]
-
Li, D., Renzoni, A., Estoppey, T., Bisognano, C., Francois, P., Kelley, W. L., Lew, D. P., Schrenzel, J., Vaudaux, P.
(2005). Induction of Fibronectin Adhesins in Quinolone-Resistant Staphylococcus aureus by Subinhibitory Levels of Ciprofloxacin or by Sigma B Transcription Factor Activity Is Mediated by Two Separate Pathways. Antimicrob. Agents Chemother.
49: 916-924
[Abstract]
[Full Text]
-
Entenza, J.-M., Moreillon, P., Senn, M. M., Kormanec, J., Dunman, P. M., Berger-Bachi, B., Projan, S., Bischoff, M.
(2005). Role of {sigma}B in the Expression of Staphylococcus aureus Cell Wall Adhesins ClfA and FnbA and Contribution to Infectivity in a Rat Model of Experimental Endocarditis. Infect. Immun.
73: 990-998
[Abstract]
[Full Text]
-
Conlon, K. M., Humphreys, H., O'Gara, J. P.
(2004). Inactivations of rsbU and sarA by IS256 Represent Novel Mechanisms of Biofilm Phenotypic Variation in Staphylococcus epidermidis. J. Bacteriol.
186: 6208-6219
[Abstract]
[Full Text]
-
Chaturongakul, S., Boor, K. J.
(2004). RsbT and RsbV Contribute to {sigma}B-Dependent Survival under Environmental, Energy, and Intracellular Stress Conditions in Listeria monocytogenes. Appl. Environ. Microbiol.
70: 5349-5356
[Abstract]
[Full Text]
-
Renzoni, A., Francois, P., Li, D., Kelley, W. L., Lew, D. P., Vaudaux, P., Schrenzel, J.
(2004). Modulation of Fibronectin Adhesins and Other Virulence Factors in a Teicoplanin-Resistant Derivative of Methicillin-Resistant Staphylococcus aureus. Antimicrob. Agents Chemother.
48: 2958-2965
[Abstract]
[Full Text]
-
Bischoff, M., Dunman, P., Kormanec, J., Macapagal, D., Murphy, E., Mounts, W., Berger-Bachi, B., Projan, S.
(2004). Microarray-Based Analysis of the Staphylococcus aureus {sigma}B Regulon. J. Bacteriol.
186: 4085-4099
[Abstract]
[Full Text]
-
Gao, J., Stewart, G. C.
(2004). Regulatory Elements of the Staphylococcus aureus Protein A (Spa) Promoter. J. Bacteriol.
186: 3738-3748
[Abstract]
[Full Text]
-
Shaw, L., Golonka, E., Potempa, J., Foster, S. J.
(2004). The role and regulation of the extracellular proteases of Staphylococcus aureus. Microbiology
150: 217-228
[Abstract]
[Full Text]
-
Novick, R. P., Jiang, D.
(2003). The staphylococcal saeRS system coordinates environmental signals with agr quorum sensing. Microbiology
149: 2709-2717
[Abstract]
[Full Text]
-
Utaida, S., Dunman, P. M., Macapagal, D., Murphy, E., Projan, S. J., Singh, V. K., Jayaswal, R. K., Wilkinson, B. J.
(2003). Genome-wide transcriptional profiling of the response of Staphylococcus aureus to cell-wall-active antibiotics reveals a cell-wall-stress stimulon. Microbiology
149: 2719-2732
[Abstract]
[Full Text]
-
Somerville, G. A., Said-Salim, B., Wickman, J. M., Raffel, S. J., Kreiswirth, B. N., Musser, J. M.
(2003). Correlation of Acetate Catabolism and Growth Yield in Staphylococcus aureus: Implications for Host-Pathogen Interactions. Infect. Immun.
71: 4724-4732
[Abstract]
[Full Text]
-
Nair, S. P., Bischoff, M., Senn, M. M., Berger-Bachi, B.
(2003). The {sigma}B Regulon Influences Internalization of Staphylococcus aureus by Osteoblasts. Infect. Immun.
71: 4167-4170
[Abstract]
[Full Text]
-
Price, C. T. D., Singh, V. K., Jayaswal, R. K., Wilkinson, B. J., Gustafson, J. E.
(2002). Pine Oil Cleaner-Resistant Staphylococcus aureus: Reduced Susceptibility to Vancomycin and Oxacillin and Involvement of SigB. Appl. Environ. Microbiol.
68: 5417-5421
[Abstract]
[Full Text]
-
Somerville, G. A., Chaussee, M. S., Morgan, C. I., Fitzgerald, J. R., Dorward, D. W., Reitzer, L. J., Musser, J. M.
(2002). Staphylococcus aureus Aconitase Inactivation Unexpectedly Inhibits Post-Exponential-Phase Growth and Enhances Stationary-Phase Survival. Infect. Immun.
70: 6373-6382
[Abstract]
[Full Text]
-
Horsburgh, M. J., Aish, J. L., White, I. J., Shaw, L., Lithgow, J. K., Foster, S. J.
(2002). {sigma}B Modulates Virulence Determinant Expression and Stress Resistance: Characterization of a Functional rsbU Strain Derived from Staphylococcus aureus 8325-4. J. Bacteriol.
184: 5457-5467
[Abstract]
[Full Text]
-
Cordwell, S. J., Larsen, M. R., Cole, R. T., Walsh, B. J.
(2002). Comparative proteomics of Staphylococcus aureus and the response of methicillin-resistant and methicillin-sensitive strains to Triton X-100. Microbiology
148: 2765-2781
[Abstract]
[Full Text]
-
Bateman, B. T., Donegan, N. P., Jarry, T. M., Palma, M., Cheung, A. L.
(2001). Evaluation of a Tetracycline-Inducible Promoter in Staphylococcus aureus In Vitro and In Vivo and Its Application in Demonstrating the Role of sigB in Microcolony Formation. Infect. Immun.
69: 7851-7857
[Abstract]
[Full Text]
-
Palma, M., Cheung, A. L.
(2001). sigma B Activity in Staphylococcus aureus Is Controlled by RsbU and an Additional Factor(s) during Bacterial Growth. Infect. Immun.
69: 7858-7865
[Abstract]
[Full Text]
-
Bischoff, M., Entenza, J. M., Giachino, P.
(2001). Influence of a Functional sigB Operon on the Global Regulators sar and agr in Staphylococcus aureus. J. Bacteriol.
183: 5171-5179
[Abstract]
[Full Text]
-
Schmidt, K. A., Manna, A. C., Gill, S., Cheung, A. L.
(2001). SarT, a Repressor of {alpha}-Hemolysin in Staphylococcus aureus. Infect. Immun.
69: 4749-4758
[Abstract]
[Full Text]
-
Giachino, P., Engelmann, S., Bischoff, M.
(2001). {sigma}B Activity Depends on RsbU in Staphylococcus aureus. J. Bacteriol.
183: 1843-1852
[Abstract]
[Full Text]
-
Manna, A., Cheung, A. L.
(2001). Characterization of sarR, a Modulator of sar Expression in Staphylococcus aureus. Infect. Immun.
69: 885-896
[Abstract]
[Full Text]
-
Gertz, S., Engelmann, S., Schmid, R., Ziebandt, A.-K., Tischer, K., Scharf, C., Hacker, J., Hecker, M.
(2000). Characterization of the sigma B Regulon in Staphylococcus aureus. J. Bacteriol.
182: 6983-6991
[Abstract]
[Full Text]
-
Rachid, S., Ohlsen, K., Wallner, U., Hacker, J., Hecker, M., Ziebuhr, W.
(2000). Alternative Transcription Factor sigma B Is Involved in Regulation of Biofilm Expression in a Staphylococcus aureus Mucosal Isolate. J. Bacteriol.
182: 6824-6826
[Abstract]
[Full Text]
-
Fouet, A., Namy, O., Lambert, G.
(2000). Characterization of the Operon Encoding the Alternative sigma B Factor from Bacillus anthracis and Its Role in Virulence. J. Bacteriol.
182: 5036-5045
[Abstract]
[Full Text]
-
Bronner, S., Stoessel, P., Gravet, A., Monteil, H., Prévost, G.
(2000). Variable Expressions of Staphylococcus aureus Bicomponent Leucotoxins Semiquantified by Competitive Reverse Transcription-PCR. Appl. Environ. Microbiol.
66: 3931-3938
[Abstract]
[Full Text]