Previous Article | Next Article ![]()
Infection and Immunity, March 1999, p. 1415-1423, Vol. 67, No. 3
Department of Microbiology and Institute for
Cellular and Molecular Biology, University of Texas at Austin,
Austin, Texas 78712-1095
Received 7 October 1998/Returned for modification 16 November
1998/Accepted 21 December 1998
Upon exposure to UV radiation, Shigella flexneri SA100
displayed survival and mutation frequencies comparable to those of Escherichia coli AB1157, which contains a functional UmuDC
error-prone DNA repair system. Survival of SA100 after UV
irradiation was associated with the presence of the 220-kb virulence
plasmid, pVP. This plasmid encodes homologues of ImpA and ImpB, which
comprise an error-prone DNA repair system encoded on plasmid TP110 that was initially identified in Salmonella typhimurium, and
ImpC, encoded upstream of ImpA and ImpB. Although the impB
gene was present in representatives of all four species of
Shigella, not all isolates tested contained the gene.
Shigella isolates that lacked impB were more
sensitive to UV radiation than isolates that contained
impB. The nucleotide sequence of a 2.4-kb DNA fragment containing the imp operon from S. flexneri SA100 pVP was 96% identical to the imp
operon from the plasmid TP110. An SA100 derivative with a
mutation in the impB gene had reduced survival following UV
irradiation and less UV-induced mutagenesis relative to the parental
strain. We also found that S. flexneri contained a
chromosomally encoded umuDC operon; however, the
umuDC promoter was not induced by exposure to UV radiation.
This suggests that the imp operon but not the
umuDC operon contributes to survival and induced
mutagenesis in S. flexneri following exposure to UV radiation.
Shigella flexneri, a
facultative intracellular bacterium, causes bacterial dysentery in
humans (13, 28, 39). This pathogen faces numerous
potentially stressful environments during its life cycle. These
environments are encountered as Shigella is exposed to the
external environment, as it transits through the human gastrointestinal
tract, and during its growth within colonic epithelial cells. However,
little is known about the response of Shigella to these
potentially stressful environments.
One stress response that has been studied in detail in bacteria is the
SOS response to DNA damage. Upon exposure to UV radiation or chemicals
that damage DNA, Escherichia coli and other bacteria express
a specific set of genes that are normally repressed by the LexA
repressor binding to an SOS box in each promoter (11, 54).
The initial signal of DNA damage, which is thought to be single-stranded DNA, activates RecA to RecA* (11). RecA*
mediates the self-cleavage of the LexA repressor, leading to
derepression of more than 20 genes, including recA,
lexA, excision DNA repair genes, and the error-prone
DNA repair genes umuD and umuC (11). RecA* also mediates the self-cleavage of UmuD into UmuD', which is the
form that mediates error-prone DNA repair (5, 32, 46).
The E. coli umuDC promoter, which contains a highly
conserved SOS box, has a strong affinity for LexA. Thus, UV
induction of the umuDC operon occurs only after most
of the LexA repressor has been cleaved. Induction of umuDC
expression results in an increased frequency of mutagenesis (10,
47). Current genetic and biochemical evidence supports the model
in which a mutasome, composed of UmuD'-UmuC, RecA*, and DNA
polymerase III, allows the bypassing of potentially lethal lesions in
the DNA during DNA replication (37). The interaction of the
UmuD'-UmuC complex with DNA polymerase III is thought to result in
relaxed fidelity, leading to the generation of
mutations. Thus, the process of UV-induced mutagenesis is also
known as error-prone DNA repair. Strains containing umuDC mutations are more sensitive to UV exposure than their
isogenic parents, suggesting that error-prone DNA repair is important
for survival following UV irradiation (3, 19).
The umuD and umuC genes constitute an
operon located on the E. coli and
Salmonella typhimurium chromosomes (20, 36, 49, 52). umuDC homologues also have been identified on
several naturally occurring plasmids, and their gene products mediate
error-prone DNA repair (56). These homologues include
impAB, located on the large conjugative plasmid TP110, which
was initially identified in Salmonella typhimurium (9,
26). Other plasmids from several different incompatibility
groups also contain sequences with homology to the imp
operon (27). The TP110 imp
operon complements mutations in the E. coli
umuDC operon, demonstrating that these operons are functionally similar (43).
Preliminary analysis of the response of Shigella growing in
the intracellular environment led to the identification of an S. flexneri DNA fragment homologous to the 3' end of
the impB gene encoded on the plasmid TP110 (15).
In this article, we describe the identification and characterization of
the virulence plasmid-encoded impCAB genes and the
chromosomally encoded umuDC genes in S. flexneri. Our data suggest that the imp operon
but not the umuDC operon contributes to survival
and induced mutagenesis in S. flexneri following UV irradiation.
Bacterial strains, plasmids, and growth conditions.
Bacterial strains and plasmids used in this work are listed in Table
1. All strains were maintained at
0019-9567/99/$04.00+0
Copyright © 1999, American Society for Microbiology. All rights reserved.
The Virulence Plasmid-Encoded impCAB Operon Enhances
Survival and Induced Mutagenesis in Shigella flexneri
after Exposure to UV Radiation
and
![]()
ABSTRACT
Top
Abstract
Introduction
Materials and Methods
Results
Discussion
References
![]()
INTRODUCTION
Top
Abstract
Introduction
Materials and Methods
Results
Discussion
References
![]()
MATERIALS AND METHODS
Top
Abstract
Introduction
Materials and Methods
Results
Discussion
References
80°C in tryptic soy broth (TSB) plus 20% glycerol. E. coli strains were routinely grown in Luria broth (L broth) or on
Luria agar (L agar) plus antibiotics at 37°C, and Shigella
spp. strains were grown in L broth or on TSB agar plus 0.1% Congo red
dye and antibiotics at 37°C. Strains containing gfp
fusions were grown in low-salt L broth, which contains 5 g of
NaCl/liter instead of 10 g/liter. Antibiotics were used at the
following concentrations: 250 µg of carbenicillin/ml, 30 µg of
chloramphenicol/ml, and 200 µg of streptomycin/ml.
TABLE 1.
Strains and plasmids
Recombinant DNA methods. Plasmids smaller than 20 kb were isolated with the QIAprep Spin Miniprep kit (Qiagen, Santa Clarita, Calif.). The method of Kado and Liu (18) was used to isolate the 220-kb virulence plasmid from S. flexneri. Isolation of DNA fragments from agarose gels was performed with the QIAquick Gel Extraction kit (Qiagen) or the GeneClean kit (Bio 101, Vista, Calif.).
For matings, overnight cultures of the donor and recipient strains were washed once in phosphate-buffered saline (PBS) and resuspended at a concentration of approximately 1010 bacteria per ml. Twenty microliters of each culture was mixed, and the mixture was spotted onto Luria agar. After a 6-h incubation at 37°C, the cells from the plate were resuspended in 1 ml of PBS and plated on L agar or TSB agar plus 0.1% Congo red dye containing the appropriate antibiotics.UV irradiation survival assays. Bacteria were grown at 37°C with aeration in L broth containing the appropriate antibiotics to an optical density of 650 nm (OD650) of 0.5 to 0.9, pelleted by centrifugation, and resuspended in PBS at a concentration of 108 bacteria per ml. Aliquots of the concentrated bacteria (0.4 ml) in 16-mm petri dishes were irradiated with UV light at doses indicated in the figures (0 to 40 J/m2), and the number of cells that survived UV irradiation was quantitated by plate counts on L agar. Statistical analyses of the data were performed using the ANOVA statistics package in Microsoft Excel 97 (Microsoft Corporation, Redmond, Wash.).
Mutagenesis assays. Bacteria grown to an OD650 of 0.5 to 0.9 were pelleted, resuspended in PBS to a concentration of 109 bacteria per ml, and irradiated with UV light at a fluence of 10 J/m2. The number of cells that survived UV irradiation was quantitated by plate counts on L agar, and the number of cells that acquired a UV-induced mutation conferring rifampin resistance was determined essentially as described by Sedgwick and Goodwin (41). Statistical analyses of the data were performed using the ANOVA statistics package in Microsoft Excel 97 (Microsoft Corporation).
PCR procedures. All PCRs were carried out using Pfu polymerase (Stratagene Cloning Systems, La Jolla, Calif.) in the reaction buffer supplied by the manufacturer supplemented with 250 µM each dNTP and 1 µM primers. Bacterial cultures (1 to 2 µl) grown overnight, washed once in PBS, and diluted 10-fold were used as the template per 100-µl reaction. The reactions were initially incubated at 95°C for 5 min, and the PCR was then done according to the specific conditions for each reaction. Thirty cycles were carried out for all reactions. Each cycle consisted of a 1-min denaturation step at 95°C, a 1-min annealing step at 3 to 5°C below the melting temperature for the primers, and an extension step of 2 min per kb to be amplified at 72°C. The primers were impB1 (5'CACTCGATGAACTGAACC3'), impB2 (5'TTTCCCGTTTCATTTGCC3'), impB3 (5'CACAGCAGGCATACAGCC3'), upstream primer (5'AATTCTCCTCTCACATGCGG3'), downstream primer (5'GGTGCTTTGCAATCTGCTG3'), umuDCP1 (5'GATCTAATGCTCCATCTGCG3'), umuDCP2 (5'CGCGGAGATCCGCAGGC3'), and umuDC3 (5'GCCGCTATATTTATTTGACCC3'). For inverse PCR, plasmid DNA from SA100 was digested with HincII and EcoRV and ligated with T4 DNA ligase. The inverse PCR was carried out by using 2 µl of the ligation reaction and primers impB2 (5'TTTCCCGTTTCATTTGCC3') and impB5 (5'TGCTCTCGCCTTCGTATA3') at an annealing temperature of 50°C.
Sequence analysis of the imp operon. For determining the nucleotide sequence of the imp operon from S. flexneri SA100 pVP, a 2.4-kb PCR product containing the operon and generated as described above was used as the template. For determining the nucleotide sequence of the 3' end of the imp operon from S. flexneri 8-2031, a subclone of a cosmid that contained impB from 8-2031 (7) was used as the template for sequencing. Nucleotide sequences were determined by the Molecular Biology Sequencing Facility at the University of Texas at Austin. The DNA that was generated in the sequencing reactions was labeled with the dRhodamine Dideoxy-terminator Cycle Sequencing kit (Perkin-Elmer Co., Applied Biosystems Division, Foster City, Calif.) and analyzed with an ABI Prism 377 DNA sequencer (Perkin-Elmer Co., Applied Biosystems Division).
Construction of an impB mutation in S. flexneri by allelic exchange.
The allelic exchange vector
pHM5 was constructed as follows. pGP704, which replicates in
pir lysogens but not in SM100 (29), was
linearized with SmaI and ligated to a 1.9-kb
EcoRV fragment containing the sacB gene, which
encodes sucrose sensitivity, from pMTL-sac#4 (57). A 2-kb
PCR product containing part of the imp operon and
amplified with the primers impB3 and impB2 (see the description of the
PCR procedures above) was cloned into the vector pWKS30 (55)
linearized with EcoRV to generate pLR25. A 1.6-kb fragment
containing a chloramphenicol resistance gene (cam) was isolated from pMA9, a derivative of pNK2884 (21), by
digestion with HindIII followed by treatment with the
Klenow fragment of DNA polymerase I. This cam cassette was
inserted into the EcoRV site in the impB gene on
pLR25 to generate pLR25::Cm. The imp operon with the cam resistance cassette was
excised from pLR25::Cm as a XhoI-SmaI
fragment and ligated into pHM5 digested with SalI and
EcoRV to generate pLR27. pLR27 was mated from E. coli SM10
pir to S. flexneri SM100,
and single crossovers in the impB gene were selected by
plating on TSB agar plus 0.1% Congo red containing chloramphenicol and
streptomycin. Double crossover recombinants were then selected on L
agar containing 5% sucrose, chloramphenicol, and streptomycin and
screened for carbenicillin sensitivity. PCR analysis, using primers
that flank the cam insertion in impB, confirmed
that the wild-type impB allele was replaced with the cam-disrupted impB allele in the
chloramphenicol-resistant, sucrose-resistant, carbenicillin-sensitive
recombinants. One recombinant, designated SM162, was used for further study.
Tissue culture cell invasion and plaque assays. Henle cell monolayers were used in all experiments and were routinely maintained in Earle's minimal essential medium plus 2 mM glutamine plus 10% fetal calf serum (Life Technologies, Grand Island, N.Y.) in a 5% CO2 atmosphere at 37°C. Plaque assays were done as described previously (34) with the following modifications. Confluent Henle cell monolayers in 35-mm plates were infected with 103 and 104 bacteria. After a 60-min incubation, the cells were washed four times with PBS and overlaid with fresh medium containing 0.45% (wt/vol) glucose, 0.5% agarose, and 20 µg of gentamicin/ml. Plaques were scored after 72 h.
Detection of GFP expression controlled by the
umuDC promoter.
The promoterless gfp
vector pGTXN3 was constructed as follows. The promoterless
cat vector pKK232-8 (Pharmacia, Piscataway, N.J.) was
digested with NcoI and HindIII to generate a
4.5-kb DNA fragment which is missing the 5' 576 bp of the
cat gene. The 4.5-kb fragment was treated with the Klenow
fragment of DNA polymerase I, isolated by electrophoresis, and
religated with T4 DNA ligase to generate pKK232-8
. This plasmid was
digested with SalI, treated with the Klenow
fragment of DNA polymerase I, and digested with BamHI. The
promoterless gfp gene was isolated from pGFP3 (6) by digestion with HindIII and treated with the Klenow
fragment of DNA polymerase I, followed by digestion with
BamHI. The resulting 0.75-kb fragment was purified by
electrophoresis and ligated to pKK232-8
isolated as described above.
The resulting plasmid was designated pGTXN3.
cut with
EcoRI and BamHI to generate pLR7. The SA100
umuDC promoter was isolated from pLR7 by digestion with
EcoRV and BamHI and cloned into pGTXN3 digested
with XbaI, treated with the Klenow fragment of DNA
polymerase, and digested with BamHI to generate pLR13.
umuDC promoter activity was assessed by quantitating the
amount of the green fluorescent reporter protein with a Molecular Dynamics Fluorimager. Bacteria were grown in low-salt L broth containing the appropriate antibiotics to an OD650 of
approximately 1.0, pelleted by centrifugation, and resuspended to a
concentration of 109 bacteria per ml in PBS. One-half
of each culture was exposed to 50 J/m2 of UV
radiation. Each sample was then pelleted by centrifugation and
resuspended to a concentration of 109 bacteria per ml in L
broth. After a 2-h incubation at 37°C, the samples were concentrated
to 1011 bacteria per ml by centrifugation. The levels of
green fluorescent protein (GFP) were measured at 530 ± 15 nm. The
background fluorescence of the cells containing the vector was
subtracted from each sample. Specific activity of GFP for each sample
was expressed in fluorescence units, which were calculated by dividing
the relative fluorescence by the OD650 and volume of the sample.
Nucleotide sequence accession number. The sequence data of a 2.4-kb DNA fragment containing the imp operon have been submitted to the GenBank database under the accession no. AF079316.
| |
RESULTS |
|---|
|
|
|---|
Sensitivity of S. flexneri isolates to UV radiation. The ability of S. flexneri isolates to survive UV irradiation was assessed by measuring the fraction of cells that survived exposure to increasing doses of UV radiation. We used E. coli AB1157, a strain previously shown to be relatively UV resistant, as a reference (42). S. flexneri SA100 and 2457 were as UV resistant as AB1157 (Fig. 1). However, SA102, a derivative of SA100 lacking the 220-kb virulence plasmid pVP, was significantly more UV sensitive than SA100 (P < 0.05). At doses of UV radiation of 20 and 40 J/m2, the numbers of SA102 cells that survived exposure to UV radiation were 22- and 100-fold less than SA100, respectively (Fig. 1). S. flexneri M90T and 229272, both of which contain a virulence plasmid, were also significantly more UV sensitive than SA100 (P < 0.05). The numbers of M90T and 229272 cells that survived exposures to UV radiation of 20 and 40 J/m2 were 25- and 600-fold less, respectively, than the number of surviving SA100 cells (Fig. 1).
|
impB is located on the virulence plasmid of S. flexneri SA100. The different sensitivities to UV radiation of SA100 and SA102 suggested that survival following exposure to UV radiation was enhanced by the presence of pVP in SA100 (Fig. 1). Because a fragment of S. flexneri DNA homologous to the error-prone DNA repair gene impB had been identified in S. flexneri in our preliminary studies (15), it seemed likely that a pVP-encoded ImpB homologue contributes to resistance to UV radiation. To determine whether pVP encodes an ImpB homologue, we designed primers based on the plasmid TP110 impB sequence to amplify an 87-bp impB fragment from SA100 and SA102 by using PCR. A PCR product of this size was amplified from SA100 but not from SA102. Since the only known difference between SA100 and SA102 is that SA102 lacks pVP, it appeared that ImpB is encoded on pVP.
To provide further evidence that impB was located on the virulence plasmid in S. flexneri, the virulence plasmid was isolated from a derivative of S. flexneri SA100 (SM100/pVP::Cm) and transferred by electroporation into E. coli DH5
, which does not contain impB. An 87-bp PCR product corresponding to impB was amplified
from these transformants but not from DH5
(data not shown); thus, we
concluded that impB is located on pVP.
The presence of impB correlates with increased
resistance to UV radiation.
We examined isolates of other
Shigella spp. for the presence of impB and for
their ability to survive UV irradiation. Although impB was
present in representatives of all four species of Shigella, not all isolates tested contained the gene (Table
2). Within each species, isolates that
contained impB were significantly more resistant to UV
radiation than strains that lacked impB (P < 0.05) (Table 2). Eight isolates of enteroinvasive E. coli were also tested for the presence of the impB gene
because enteroinvasive E. coli, which causes a disease
that is similar to shigellosis, has a virulence plasmid that is related
to the Shigella virulence plasmids (40). None of
the eight isolates tested contained the impB gene (Table 2
and data not shown). We examined the ability of two enteroinvasive
E. coli isolates to survive UV irradiation and found
that they were significantly more sensitive to UV radiation than SA100
(P < 0.05) (Table 2).
|
Sequencing the imp operon from SA100 pVP. We isolated the entire imp operon from S. flexneri SA100 pVP by PCR. The imp upstream primer was designed using the sequence upstream from the TP110-encoded imp operon. However, the DNA fragment containing the imp operon could not be amplified using the imp upstream primer and a primer with a nucleotide sequence based on the sequence downstream from the TP110 imp operon. Therefore, we used inverse PCR with primers corresponding to the coding sequence of impB to isolate a fragment downstream from the SA100 pVP imp operon. The nucleotide sequence of the inverse PCR product was determined, and a downstream primer was designed using this sequence. The imp upstream and downstream primers were used to amplify a 2.4-kb DNA fragment containing the imp operon, and the nucleotide sequence of this fragment was 96% identical to that of a DNA fragment containing the impCAB operon on the conjugative plasmid TP110.
The nucleotide sequence of the 2.4-kb PCR product from SA100 pVP contained three overlapping open reading frames (ORFs) encoding putative proteins of 9.5, 16.2, and 47.6 kDa, which were designated ImpC, ImpA, and ImpB, respectively, based on their amino acid homologies (see below). The predicted pIs of these proteins were 5.13, 4.98, and 9.52, respectively. Because the overlapping arrangement of the three imp genes suggested that they constituted an operon, the region upstream of impC was examined for promoter-like features (Fig. 2). We identified a putative
70 recognition sequence in which
each of the
35 and
10 hexamers deviates in 1 of 6 nucleotides from
the consensus binding sequence for
70 (14). A
20-bp SOS box, which may function as a binding site for the LexA
repressor, overlapped the putative
10 sequence by 1 nucleotide.
Nucleotides 12 and 19 deviated from the consensus SOS box; however,
these 2 nucleotides are less critical for LexA binding (11).
We were unable to locate a Rho-independent terminator downstream of the
SA100 pVP imp operon. This suggests that
transcriptional termination occurs via a Rho-dependent manner
or that this operon contains an additional downstream gene.
|
R67 in
E. coli (8, 17); Tum, encoded by prophage
186 in E. coli (4); and E. coli DinI (59) (Table 3).
The function of ORFf has not been determined; however, Tum is an
antirepressor that causes induction of prophage 186 by directly
interfering with the ability of the phage repressor to bind DNA
(45). DinI has been shown to inhibit RecA*-mediated self-cleavage of LexA and UmuD (58). Thus, ImpC may have a
similar role in the regulation of ImpA self-cleavage to ImpA'.
|
Characterization of an ImpB mutant. To determine whether any of the genes in the pVP imp operon was required for survival or induced mutagenesis in S. flexneri following UV irradiation, we constructed an impB mutation in which the wild-type allele was replaced with one containing a cam gene insertion. The mutation was constructed in SM100, a streptomycin-resistant derivative of SA100, and the resulting ImpB mutant was designated SM162. The ability of SM162 to survive UV irradiation was examined as described above. SM162 was significantly more sensitive to UV radiation than the parental strain SM100 (P < 0.05) (Fig. 3); however, SM162 was not as sensitive as SA102, which does not contain pVP (P < 0.05) (Fig. 3).
|
|
Examination of the ability of SM162 to invade and spread in cultured epithelial cells. Many of the genes on the S. flexneri virulence plasmid are important for invasion of colonic epithelial cells, for intracellular survival and proliferation, and for spread to adjacent cells (28, 40). To determine whether ImpB was essential for any of these processes, we examined the ability of the ImpB mutant SM162 to form plaques on a Henle cell monolayer. SM162 formed plaques that were similar in size and number to the plaques formed by the parental strain SM100, suggesting that impB was not required for the invasion of Henle cells or for cell-to-cell spread in a plaque assay (data not shown).
Identification of the umuDC operon in S. flexneri SA100 and analysis of its induction by UV radiation. The E. coli error-prone DNA repair system UmuDC is chromosomally encoded (20, 36). Although Shigella spp. are closely related to E. coli, S. flexneri appears to require the virulence plasmid-encoded impB gene for induced mutagenesis. This suggested that S. flexneri does not contain a functional, chromosomally encoded UmuDC system. To investigate this possibility, we designed the primers umuDCP1 and umuDC3 based on the nucleotide sequence of the E. coli umuDC operon to amplify a 2.1-kb fragment containing the umuDC operon from S. flexneri. A PCR product of this size was amplified from SA100 and SA102, which lacks the virulence plasmid. These data demonstrate that S. flexneri contains a umuDC operon and suggests that the operon is chromosomally encoded.
To begin characterization of the contribution of the SA100 umuDC operon to survival and induced mutagenesis following UV irradiation, we measured the level of induction of a umuDC promoter-gfp transcriptional fusion after exposure to UV radiation. pLR13, which contained the S. flexneri SA100 umuDC promoter-gfp transcriptional fusion, was transformed into E. coli AB1157 and S. flexneri SA100. Expression of gfp controlled by the S. flexneri umuDC promoter on pLR13 in either AB1157 or SA100 was not induced by UV irradiation. In contrast, expression of gfp controlled by the E. coli AB1157 umuDC promoter on pLR20 was induced 12-fold by UV irradiation. These data suggest that although S. flexneri SA100 contains the umuDC operon, it is not expressed in response to UV irradiation.Sequence analysis of the S. flexneri umuDC promoter. To verify that the lack of UV-induced expression from the S. flexneri SA100 umuDC promoter was not a result of a PCR-derived mutation in the promoter, we sequenced two independently isolated umuDC promoter clones and a umuDC promoter PCR product. Sequence analysis of these DNA fragments showed that all three sequences were identical, demonstrating that there was not a PCR-derived mutation in the umuDC promoter amplified from SA100.
We compared the nucleotide sequence of the S. flexneri umuDC promoter with those of the E. coli and Salmonella typhimurium umuDC promoters. Over a 113-bp overlap, the S. flexneri umuDC promoter was 98% identical to the E. coli umuDC promoter and 56% identical to the Salmonella typhimurium umuDC promoter. In all three promoters, the SOS box and the
10
70 recognition sequence overlapped (Fig.
5). The first nucleotide of the SOS box
corresponds to the first nucleotide of the
10
70
recognition sequence; however, this nucleotide was a T in E. coli and Salmonella typhimurium and a C in
S. flexneri (Fig. 5). Although the T at position 1 in
the SOS box is not essential for binding of the LexA repressor
(11), it is a highly conserved nucleotide in E. coli
10
70 hexamers (14). Thus, the
presence of a C at this position in the S. flexneri
umuDC promoter may weaken the binding of RNA polymerase and
contribute to the lack of UV-induced expression of the promoter.
|
| |
DISCUSSION |
|---|
|
|
|---|
In the course of analyzing the response of S. flexneri to potentially stressful environments, including the intracellular environment, we discovered that S. flexneri contains a homologue of the impB gene, first identified on the plasmid TP110 in Salmonella typhimurium (9, 26). Our data suggest that, like the TP110-encoded impB gene, the S. flexneri impB gene is located on a large plasmid, the 220-kb virulence plasmid pVP. SA102, a derivative of S. flexneri SA100 that lacks pVP, does not contain the impB gene. Furthermore, the impB gene could be transferred to E. coli on pVP. We have not examined the location of the impB genes in other Shigella strains that contain impB; however, it is likely that impB is virulence plasmid encoded in these isolates since Shigella virulence plasmids have a high degree of similarity (40).
Based on amino acid sequence comparisons, it appears that two of the proteins encoded by the S. flexneri pVP imp operon (ImpA and ImpB) are members of the error-prone DNA repair family of proteins that contribute to survival after UV irradiation. Consistent with the sequence homology, S. flexneri SM162 and SA102, which contain an impB mutation and a deletion of the entire virulence plasmid, respectively, showed a reduced ability to survive UV irradiation. SA102 had a lower frequency of survival after UV irradiation than SM162, suggesting that pVP encodes another gene product that is important either specifically for resistance to UV irradiation or generally for survival under stressful conditions.
There is a precedent for other genes that contribute to resistance to UV irradiation. For instance, the uvr genes are important for surviving UV irradiation, but they are chromosomally encoded in E. coli (2, 3, 48). The plasmid pKM101, which encodes the MucAB error-prone DNA repair system, contains an additional uncharacterized gene which contributes to survival following UV irradiation (24). Salmonella typhimurium strains carrying a deletion derivative of pKM101, in which the mucAB genes were still present but the uncharacterized gene was absent, showed decreased survival following UV irradiation. Langer et al. (24) proposed that either this deletion in pKM101 resulted in overexpression of mucAB, leading to decreased survival following UV irradiation because of excessive levels of mutagenesis, or that the deletion removed a suppressor of a UV sensitization gene. Additionally, even among isolates of Shigella spp., there is a wide range of sensitivities to UV radiation (Table 2). For example, Shigella boydii 224860 is significantly less UV resistant than S. flexneri SA100 (P < 0.05), even though both contain impB, but is significantly more UV resistant than S. boydii O-1392 (P < 0.05), which does not contain impB. In general, among Shigella spp. isolates that contain impB, there is the following correlation between species type and UV resistance: S. flexneri = Shigella sonnei > Shigella dysenteriae > S. boydii. These observations emphasize the complexity of the UV sensitivity phenotype and suggest that although impB clearly contributes to UV resistance, Shigella spp. contain other genes that are also important for surviving UV irradiation.
S. flexneri SM162 and SA102, which contain an impB mutation and a deletion of the entire virulence plasmid, respectively, also showed decreased levels of UV-induced mutagenesis. In contrast to the defect in survival following UV irradiation, which was greater in SA102, the defect in UV-induced mutagenesis was greater in SM162. One explanation for this result is that that expression of ImpA without ImpB in SM162 interferes with other systems that are mutagenic. This would not occur in SA102 because both ImpA and ImpB are absent. Although S. flexneri contains the UmuDC error-prone DNA repair system, the data presented in this article suggest that this system is not UV induced in S. flexneri. Furthermore, the S. flexneri umuDC operon does not appear to complement the defect in UV-induced mutagenesis in an E. coli umuDC mutant (12). However, S. flexneri may possess another mutagenesis system that is weakly induced by UV irradiation and has yet to be identified. Another possibility for the less severe defect in UV-induced mutagenesis in SA102 relative to that in SM162 is that pVP may encode a suppressor of another unidentified mutagenesis system which is activated upon deletion of pVP.
The analysis of the error-prone DNA repair imp
operon presented here focused on the role of the operon
in survival and induced mutagenesis after exposure to UV radiation. The
UV inducibility of error-prone DNA repair operons is well
conserved. To our knowledge the promoters of all error-prone
DNA repair operons examined to date contain binding sites
for the LexA repressor. Exposure to UV radiation induces
LexA-repressed operons. Although we did not test directly
whether expression of the pVP-encoded imp
operon is UV inducible, the fact that a well-conserved LexA
binding site overlaps the putative
10 sequence by 1 nucleotide
in the imp promoter suggests that the imp
operon is UV inducible. Additionally, the fact that UV exposure
was required for ImpB-mediated induced mutagenesis supports this
hypothesis. It is also possible that a signal other than or in addition
to UV radiation may induce expression of the pVP-encoded imp
operon in S. flexneri. Some of these signals
may be encountered in the variety of stressful environments that
Shigella encounters during its journey through the external
environment and human host.
There are several possible molecular mechanisms by which Shigella spp. may have acquired the imp operon. The imp operon may have been acquired by fusion of the virulence plasmid or virulence plasmid progenitor with another plasmid, such as TP110, that contained the imp operon. Alternatively, the imp operon may have been acquired as part of a transposon or other mobile genetic element. There is evidence that error-prone DNA repair operons may have been located on transposable elements. Langer et al. (25) found that inverted repeats flank a 6-kb region that contains the mucAB genes on pKM101, suggesting that these genes were part of a transposon at one time. Additionally, direct repeats similar to the termini of the Tn3 group of transposases flank a 12- to 14-kb region that contains the umuDC genes in a variety of Escherichia spp. (44). Kulaeva et al. (22) found a retroelement encoding a putative reverse transcriptase located upstream of and an insertion sequence located downstream from the mucAB genes on plasmid R471a. Finally, the large conjugative transposon Tn5252 found in many clinical streptococci contains an error-prone DNA repair system (31). The fact that not all isolates of Shigella contain the imp operon suggests that the imp operon may have been acquired by some but not all phylogenetic lines of the virulence plasmid early in the evolution of the plasmid. Alternatively, the imp operon may have been part of the progenitor virulence plasmid and this operon was subsequently lost from the virulence plasmids in some strains.
Although it is clear that the impB gene is not an essential gene in S. flexneri, it is possible that the acquisition of the imp operon by some Shigella species gives those strains a selective advantage. The presence of the imp operon on pVP most likely compensates for the inefficient UV induction of the chromosomal umuDC genes in S. flexneri. In environments in which UV radiation or other DNA-damaging agents are encountered, such as the external environment, strains containing the imp operon may survive better than strains that do not have the imp operon. If the imp operon provides a selective advantage for maintaining the virulence plasmid in the external environment, strains containing the imp operon may be more likely to have the plasmid when Shigella reencounters a human host, where the organism needs other virulence plasmid-encoded genes for survival. Additionally, it is possible that the imp operon may be protective in other stressful environments, some of which may be encountered when Shigella is inside the human host.
| |
ACKNOWLEDGMENTS |
|---|
We gratefully thank the following individuals for their generous help: Elizabeth Wyckoff, Douglas Henderson, and Stephanie Reeves for their critical reading of the manuscript; Harsha Mistry and Adrienne Garcia for excellent technical help; Stefan Seliger for strain SM100; and James Walker for the use of equipment.
This work was supported by Public Health Service Grant AI09918 awarded to L.J.R.-J. and Public Health Service Grant AI16935 awarded to S.M.P.
| |
FOOTNOTES |
|---|
* Corresponding author. Mailing address: Department of Microbiology and Institute for Cellular and Molecular Biology, University of Texas at Austin, Austin, TX 78712-1095. Phone: (512) 471-9258. Fax: (512) 471-7088. E-mail: payne{at}mail.utexas.edu.
Present address: Chiron Corporation, Emeryville, CA 94608-2916.
Editor: D. L. Burns
| |
REFERENCES |
|---|
|
|
|---|
| 1. | Altschul, S. F., W. Gish, W. Miller, E. W. Myers, and D. J. Lipman. 1990. Basic local alignment search tool. J. Mol. Biol. 215:403-410[Medline]. |
| 2. | Arthur, H. M., and P. B. Eastlake. 1983. Transcriptional control of the uvrD gene of Escherichia coli. Gene 25:309-316[Medline]. |
| 3. |
Bagg, A.,
C. J. Kenyon, and G. C. Walker.
1981.
Inducibility of a gene product required for UV and chemical mutagenesis in Escherichia coli.
Proc. Natl. Acad. Sci. USA
78:5749-5753 |
| 4. | Brumby, A. M., I. Lamont, I. B. Dodd, and J. B. Egan. 1996. Defining the SOS operon of coliphage 186. Virology 219:105-114[Medline]. |
| 5. |
Burckhardt, S. E.,
R. Woodgate,
R. H. Scheuermann, and H. Echols.
1988.
UmuD mutagenesis protein of Escherichia coli: overproduction, purification, and cleavage by RecA.
Proc. Natl. Acad. Sci. USA
85:1811-1815 |
| 6. | Cormack, B. P., R. H. Valdivia, and S. Falkow. 1996. FACS-optimized mutants of the green fluorescent protein (GFP). Gene 173:33-38[Medline]. |
| 7. | Daskaleros, T. Unpublished data. |
| 8. | Dodd, I. B., and J. B. Egan. 1996. The Escherichia coli retrons Ec67 and Ec86 replace DNA between the cos site and a transcriptional terminator of a 186-related prophage. Virology 219:115-124[Medline]. |
| 9. | Dowden, S. B., J. A. Glazebrook, and P. Strike. 1984. UV inducible UV protection and mutation functions on the I group plasmid TP110. Mol. Gen. Genet. 193:316-321[Medline]. |
| 10. | Elledge, S. J., and G. C. Walker. 1983. Proteins required for ultraviolet light and chemical mutagenesis. Identification of the products of the umuC locus of Escherichia coli. J. Mol. Biol. 164:175-192[Medline]. |
| 11. | Friedberg, E. C., G. C. Walker, and W. Siede. 1995. DNA repair and mutagenesis. American Society for Microbiology, Washington, D.C. |
| 12. | Garcia, A., and L. J. Runyen-Janecky. Unpublished data. |
| 13. |
Hale, T. L.
1991.
Genetic basis of virulence in Shigella species.
Microbiol. Rev.
55:206-224 |
| 14. |
Hawley, D. K., and W. R. McClure.
1983.
Compilation and analysis of Escherichia coli promoter DNA sequences.
Nucleic Acids Res.
11:2237-2255 |
| 15. | Hong, M., C. Altier, K. Reed, R. Maurer, and S. M. Payne. 1995. Differential expression of Shigella flexneri genes in vitro and in vivo, abstr. B-126, p. 187. In Abstracts of the 95th General Meeting of the American Society for Microbiology 1995 American Society for Microbiology, Washington, D.C. |
| 16. |
Howard-Flanders, P.,
E. Simson, and L. Theriot.
1964.
A locus that controls filament formation and sensitivity to radiation in Escherichia coli K12.
Genetics
49:237-246 |
| 17. |
Hsu, M.-Y.,
M. Inouye, and S. Inouye.
1990.
Retron for the 67-base multicopy single-stranded DNA from Escherichia coli: a potential transposable element encoding both reverse transcriptase and Dam methylase functions.
Proc. Natl. Acad. Sci. USA
87:9454-9458 |
| 18. |
Kado, C. I., and S.-T. Liu.
1981.
Rapid procedure for detection and isolation of large and small plasmids.
J. Bacteriol.
145:1365-1373 |
| 19. | Kato, T., and Y. Shinoura. 1977. Isolation and characterization of mutants of Escherichia coli deficient in induction of mutations by ultraviolet light. Mol. Gen. Genet. 156:121-131[Medline]. |
| 20. |
Kitagawa, Y.,
E. Akaboshi,
H. Shinagawa,
T. Horii,
H. Ogawa, and T. Kato.
1985.
Structural analysis of the umu operon required for inducible mutagenesis in Escherichia coli.
Proc. Natl. Acad. Sci. USA
82:4336-4340 |
| 21. | Kleckner, N., J. Bender, and S. Gottesman. 1991. Uses of transposons with emphasis on Tn10. Methods Enzymol. 204:139-180[Medline]. |
| 22. | Kulaeva, O. I., E. V. Koonin, J. C. Wootton, A. S. Levine, and R. Woodgate. 1998. Unusual insertion element polymorphisms in the promoter and terminator regions of the mucAB-like genes of R471a and R446b. Mutat. Res. 397:247-262[Medline]. |
| 23. |
Kulaeva, O. I.,
J. C. Wootton,
A. S. Levine, and R. Woodgate.
1995.
Characterization of the umu-complementing operon from R391.
J. Bacteriol.
177:2737-2743 |
| 24. | Langer, P. J., K. L. Perry, and G. C. Walker. 1985. Complementation of a pKM101 derivative that decreases resistance to UV killing but increases susceptibility to mutagenesis. Mutat. Res. 150:147-158[Medline]. |
| 25. |
Langer, P. J.,
W. G. Shanabruch, and G. C. Walker.
1981.
Functional organization of plasmid pKM101.
J. Bacteriol.
145:1310-1316 |
| 26. |
Lodwick, D.,
D. Owen, and P. Strike.
1990.
DNA sequence analysis of the imp UV protection and mutation operon of the plasmid TP110: identification of a third gene.
Nucleic Acids Res.
18:5045-5050 |
| 27. | Lodwick, D., and P. Strike. 1991. Distribution of sequences homologous to the impCAB operon of TP110 among bacterial plasmids of different incompatibility groups. Mol. Gen. Genet. 229:27-30[Medline]. |
| 28. | Menard, R., C. Dehio, and P. J. Sansonetti. 1996. Bacterial entry into epithelial cells: the paradigm of Shigella. Trends Microbiol. 4:220-226[Medline]. |
| 29. |
Miller, V. L., and J. J. Mekalanos.
1988.
A novel suicide vector and its use in construction of insertion mutations: osmoregulation of outer membrane proteins and virulence determinants in Vibrio cholerae requires toxR.
J. Bacteriol.
170:2575-2583 |
| 30. | Mori, H., A. Kondo, A. Ohshima, T. Ogura, and S. Hiraga. 1986. Structure and function of the F plasmid genes essential for partitioning. J. Mol. Biol. 192:1-15[Medline]. |
| 31. | Munoz-Najar, U., J. Sampath, and M. N. Vijayakumar. 1998. Characterization of a region conferring resistance to UV light in the conjugative transposon Tn5252, abstr. H-11, p. 278. In Abstracts of the 98th General Meeting of the American Society for Microbiology 1998 American Society for Microbiology, Washington, D.C. |
| 32. |
Nohmi, T.,
J. R. Battista,
L. A. Dodson, and G. C. Walker.
1988.
RecA-mediated cleavage activates UmuD for mutagenesis: mechanistic relationship between transcriptional derepression and posttranslational activation.
Proc. Natl. Acad. Sci. USA
85:1816-1820 |
| 33. |
Nohmi, T.,
A. Hakura,
Y. Nakai,
M. Watanabe,
S. Y. Murayama, and T. Sofuni.
1991.
Salmonella typhimurium has two homologous but different umuDC operons: cloning of a new umuDC-like operon (samAB) present in a 60-megadalton cryptic plasmid of S. typhimurium.
J. Bacteriol.
173:1051-1063 |
| 34. |
Oaks, E. V.,
M. E. Wingfield, and S. B. Formal.
1985.
Plaque formation by virulent Shigella flexneri.
Infect. Immun.
48:124-129 |
| 35. |
Payne, S. M.,
D. W. Niesel,
S. S. Peixotto, and K. M. Lawlor.
1983.
Expression of hydroxamate and phenolate siderophores by Shigella flexneri.
J. Bacteriol.
155:949-955 |
| 36. |
Perry, K. L.,
S. J. Elledge,
B. B. Mitchell,
L. Marsh, and G. C. Walker.
1985.
umuDC and mucAB operons whose products are required for UV light- and chemical-induced mutagenesis: UmuD, MucA, and LexA proteins share homology.
Proc. Natl. Acad. Sci. USA
82:4331-4335 |
| 37. |
Rajagopalan, M.,
C. Lu,
R. Woodgate,
M. O'Donnell,
M. F. Goodman, and H. Echols.
1992.
Activity of the purified mutagenesis proteins UmuC, UmuD', and RecA in replicative bypass of an abasic DNA lesion by DNA polymerase III.
Proc. Natl. Acad. Sci. USA
89:10777-10781 |
| 38. | Sambrook, J., E. F. Fritsch, and T. Maniatis. 1989. Molecular cloning: a laboratory manual, 2nd ed. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y. |
| 39. | Sansonetti, P. J. 1992. Molecular and cellular biology of Shigella flexneri invasiveness: from cell assay systems to shigellosis. Curr. Top. Microbiol. Immunol. 180:1-19[Medline]. |
| 40. | Sasakawa, C., J. M. Buysse, and H. Watanabe. 1992. The large virulence plasmid of Shigella. Curr. Top. Microbiol. Immunol. 180:21-44[Medline]. |
| 41. |
Sedgwick, S. G., and P. A. Goodwin.
1985.
Differences in mutagenic and recombinational DNA repair in enterobacteria.
Proc. Natl. Acad. Sci. USA
82:4172-4176 |
| 42. |
Sedgwick, S. G.,
C. Ho, and R. Woodgate.
1991.
Mutagenic DNA repair in enterobacteria.
J. Bacteriol.
173:5604-5611 |
| 43. | Sedgwick, S. G., D. Lodwick, N. Doyle, H. Crowne, and P. Strike. 1991. Functional complementation between chromosomal and plasmid mutagenic DNA repair genes in bacteria. Mol. Gen. Genet. 229:428-436[Medline]. |
| 44. |
Sedgwick, S. G.,
M. Robson, and F. Malik.
1988.
Polymorphisms in the umuDC region of Escherichia species.
J. Bacteriol.
170:1610-1616 |
| 45. |
Shearwin, K. E.,
A. M. Brumby, and J. B. Egan.
1998.
The Tum protein of coliphage 186 is an antirepressor.
J. Biol. Chem.
273:5708-5715 |
| 46. |
Shinagawa, H.,
H. Iwasaki,
T. Kato, and A. Nakata.
1988.
RecA protein-dependent cleavage of UmuD protein and SOS mutagenesis.
Proc. Natl. Acad. Sci. USA
85:1806-1810 |
| 47. | Shinagawa, H., T. Kato, T. Ise, K. Makino, and A. Nakata. 1983. Cloning and characterization of the umu operon responsible for inducible mutagenesis in Escherichia coli. Gene 23:167-174[Medline]. |
| 48. | Siegel, E. C. 1983. The Escherichia coli uvrD gene is inducible by DNA damage. Mol. Gen. Genet. 191:397-400[Medline]. |
| 49. |
Smith, C. M.,
W. H. Koch,
S. B. Franklin,
P. L. Foster,
T. A. Cebula, and E. Eisenstadt.
1990.
Sequence analysis and mapping of the Salmonella typhimurium LT2 umuDC operon.
J. Bacteriol.
172:4964-4978 |
| 50. | Sundin, G. W., S. P. Kidambi, M. Ullrich, and C. L. Bender. 1996. Resistance to ultraviolet light in Pseudomonas syringae: sequence and functional analysis of the plasmid-encoded rulAB genes. Gene 177:77-81[Medline]. |
| 51. |
Taylor, R. K.,
C. Manoil, and J. J. Mekalanos.
1989.
Broad-host-range vectors for delivery of TnphoA: use in genetic analysis of secreted virulence determinants of Vibrio cholerae.
J. Bacteriol.
171:1870-1878 |
| 52. |
Thomas, S. M.,
H. M. Crowne,
S. C. Pidsley, and S. G. Sedgwick.
1990.
Structural characterization of the Salmonella typhimurium LT2 umu operon.
J. Bacteriol.
172:4979-4987 |
| 53. |
Thompson, J. D.,
D. G. Higgins, and T. J. Gibson.
1994.
CLUSTAL W: improving the sensitivity of progressive multiple sequence alignment through sequence weighting, position-specific gap penalties and weight matrix choice.
Nucleic Acids Res.
22:4673-4680 |
| 54. |
Walker, G. C.
1984.
Mutagenesis and inducible responses to deoxyribonucleic acid damage in Escherichia coli.
Microbiol. Rev.
48:60-93 |
| 55. | Wang, R. F., and S. R. Kushner. 1991. Construction of versatile low-copy-number vectors for cloning, sequencing and gene expression in Escherichia coli. Gene 100:195-199[Medline]. |
| 56. | Woodgate, R., and S. G. Sedgwick. 1992. Mutagenesis induced by bacterial UmuDC proteins and their plasmid homologues. Mol. Microbiol. 6:2213-2218[Medline]. |
| 57. | Wyckoff, E. Unpublished data. |
| 58. | Yasuda, T., K. Morimatsu, T. Horii, T. Nagata, and H. Ohmori. 1998. Inhibition of Escherichia coli RecA coprotease activities by DinI. EMBO J. 17:3207-3216[Medline]. |
| 59. |
Yasuda, T.,
T. Nagata, and H. Ohmori.
1996.
Multicopy suppressors of the cold-sensitive phenotype of the pcsA68 (dinD68) mutation in Escherichia coli.
J. Bacteriol.
178:3854-3859 |
This article has been cited by other articles:
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Copyright © 2009 by the American Society for Microbiology. For an alternate route to Journals.ASM.org, visit: http://intl-journals.asm.org | More Info»