Previous Article | Next Article ![]()
Infection and Immunity, April 1999, p. 1569-1578, Vol. 67, No. 4
Unité d'Oncologie Virale, Institut
Pasteur, 75724 Paris Cedex 15, France,1 and
Department of Safety Research on Biologics, National Institute
of Infectious Diseases, Musashimurayama-shi, Tokyo 208-0011, Japan2
Received 23 June 1998/Returned for modification 28 September
1998/Accepted 5 January 1999
Mycoplasma penetrans is a recently identified
mycoplasma, isolated from urine samples collected from human
immunodeficiency virus (HIV)-infected patients. Its presence is
significantly associated with HIV infection. The major antigen
recognized during natural and experimental infections is an abundant
P35 lipoprotein which, upon extraction, segregates in the Triton X-114
detergent phase and is the basis of M. penetrans-specific
serological assays. We report here that the P35 antigen undergoes
spontaneous and reversible phase variation at high frequency, leading
to heterogeneous populations of mycoplasmas, even when derived from a
clonal lineage. This variation was found to be determined at the
transcription level, and although this property is not unique among the
members of the class Mollicutes, the mechanism by which it
occurs in M. penetrans differs from those previously
described for other Mycoplasma species. Indeed, the P35
phase variation was due neither to a p35 gene rearrangement
nor to point mutations within the gene itself or its promoter. The P35
phase variation in the different variants obtained was concomitant with
modifications in the pattern of other expressed lipoproteins, probably
due to regulated expression of selected members of a gene family which
was found to potentially encode similar lipoproteins. M. penetrans variants could be selected on the basis of their lack
of colony immunoreactivity with a polyclonal antiserum against a Triton
X-114 extract, strongly suggesting that the mechanisms involved in
altering surface antigen expression might allow evasion of the humoral
immune response of the infected host.
The complete sequences of the
genomes of Mycoplasma genitalium (15) and
M. pneumoniae (19) are now available and confirm that mollicutes (trivial name, mycoplasmas) are the self-replicating organisms with the smallest genomes ( Mycoplasma penetrans is a newly identified species, isolated
from humans, with a unique morphology characterized by an elongated flask shape. This isolate penetrates eucaryotic cells (hence its name),
possesses cytopathic effects in vitro (16, 27), and kills a
large proportion of chicken embryos experimentally infected via the
yolk sac (18). M. penetrans was initially
isolated from the urine of human immunodeficiency virus (HIV)-infected
persons (28, 29), and seroepidemiological studies
demonstrate that M. penetrans is associated with HIV
infection, at least among the male homosexual population in France and
the United States (17, 52, 53). These results, combined with
the ability of some mycoplasmas to act in synergy with HIV to kill
cells in vitro (24, 30), led us to propose M. penetrans as a possible HIV cofactor in viral transmission and/or
disease progression (3, 4, 6). Until recently, M. penetrans had been isolated only from HIV-infected patients, and
association with any pathology has not been demonstrated. However, the
isolation of this mycoplasma from an HIV-seronegative person suffering
from a primary antiphospholipid syndrome suggests that M. penetrans may be pathogenic, at least under certain circumstances
(55a). Since isolation of M. penetrans from
clinical samples is extremely painstaking (28, 29), the detection of infection by this mycoplasma relies almost exclusively on
serological assays. These assays are based on an antigenic preparation
consisting of a Triton X-114 (TX-114) extract of the mycoplasma
(52). This extract contains two major polypeptides with
apparent molecular masses of 38 kDa (P38) and 35 kDa (P35). We
previously showed that P35 is the most abundant protein in the M. penetrans membrane and that both P35 and P38 are acylated (13). The gene encoding P35 was isolated and found to map
upstream from a second open reading frame encoding a putative
lipoprotein of 30.9 kDa showing significant similarity with P35
(13). The P35 polypeptide is the earliest and the major
antigen recognized in infected patients and in experimentally infected
animals (17, 35, 52).
Here we report the ability of M. penetrans to modulate its
major surface antigen, P35, by phase variation. Although this property is not unique among the members of the class Mollicutes, the
mechanism by which this variation occurs in M. penetrans
seems to differ from those previously described in other
Mycoplasma species.
Mycoplasma strain and culture conditions.
M. penetrans
GTU-54-6A1, initially isolated by S.-C. Lo (Armed Forces Institute of
Pathology, Bethesda, Md.), was kindly provided by J. Tully (National
Institute of Allergy and Infectious Diseases, Frederick, Md.) and was
cultured in liquid broth or on 1% Noble agar (Difco, Detroit, Mich.)
in SP-4 medium containing 10% fetal calf serum (50).
Antibodies.
Murine P35-specific monoclonal antibody (MAb) 7 (immunoglobulin G1 [IgG1] isotype) was established by T. Sasaki. The
specificity of MAb 7 for P35 was established in another study
(35). A rabbit hyperimmune serum (polyclonal antibody
[PAb] 2) was raised against a whole M. penetrans TX-114
extract and reacts predominantly with the P30, P35, and P38
polypeptides (35). For use in colony immunoblotting, the
serum was diluted in phosphate-buffered saline (PBS)-0.1% bovine
serum albumin (BSA); for use in Western immunoblotting, it was diluted
in the same buffer containing 0.1% Tween 20.
Transmission electron microscopy.
To locate the P35
polypeptide at the mycoplasma cell surface, we used an immunogold
labeling technique whereby whole cells were labeled with anti-P35 MAb 7 at 0.03 mg/ml, essentially as described by Le Gall et al.
(22). Briefly, the M. penetrans cells were washed
once in PBS and resuspended in PBS. Nickel grids previously coated with
a Formvar carbon film were laid on the mycoplasma suspension for 3 min.
The cells were fixed for 20 min at room temperature with PBS-2%
paraformaldehyde-0.1% glutaraldehyde. The grids were laid onto
PBS-10 mM NH4Cl for 10 min, then on PBS-1% BSA for 10 min, and then on a PBS-0.5% BSA-0.1% gelatin solution containing 10 µg of MAb 7 per ml for 1 h at room temperature. After five
washes in PBS-0.5% BSA-0.1% gelatin, the grids were incubated on a
1:25 dilution of the gold-conjugated secondary antibodies (anti-mouse
IgG and IgM antibodies conjugated to 10-nm-diameter gold particles from
Amersham International plc., Amersham, United Kingdom) in PBS-0.5%
BSA-0.1% gelatin. The grids were washed, negatively stained with 1%
phosphotungstic acid, and examined with a JEOL EX 1200 electron
microscope operating at an accelerating voltage of 80 kV.
Mycoplasma protein analysis.
TX-114 phase partitioning of
cellular antigens from M. penetrans variants was performed
as previously described (13). Cell lysates or
TX-114-extracted proteins were separated by sodium dodecyl
sulfate-polyacrylamide gel electrophoresis (SDS-PAGE) as described by
Laemmli (21). The separated proteins were stained with
Coomassie blue or electrotransferred to nitrocellulose. Western blotting was done as previously described (13), using MAb 7 (diluted 1:1,000) or PAb 2 (diluted 1:500) as the primary antibody and
alkaline phosphatase-conjugated secondary antibodies.
Colony immunoblotting and designation of M. penetrans
clonal lineages.
P35 was detected in M. penetrans
clonal lineages by colony immunoblotting as described by Rosengarten et
al. (42) with the various sera described above. Briefly,
nitrocellulose filters were placed, under sterile conditions, on top of
colonies for 5 min, gently removed, and incubated overnight at 4°C
with the primary antibody (MAb or PAb) diluted in PBS-3% BSA. After
being washed with PBS, the membranes were incubated for 1 h at
room temperature with alkaline phosphatase-conjugated secondary
antibodies (1/3,000 dilution in PBS-1% BSA). The membranes were again
washed in PBS, and 5-bromo-4-chloro-3-indolylphosphate was used with nitroblue tetrazolium for the colorimetric detection of alkaline phosphatase activity.
0019-9567/99/$04.00+0
Copyright © 1999, American Society for Microbiology. All rights reserved.
Phase Variations of the Mycoplasma
penetrans Main Surface Lipoprotein Increase Antigenic
Diversity

![]()
ABSTRACT
Top
Abstract
Introduction
Materials and Methods
Results
Discussion
References
![]()
INTRODUCTION
Top
Abstract
Introduction
Materials and Methods
Results
Discussion
References
580 kbp [5]).
They lack the genes for numerous common biosynthetic pathways
(38-40), reflecting the parasitic lifestyle of these
microorganisms. This parasitism and the limited biosynthetic capacity
of the mycoplasmas demand efficient membrane transporters for the
acquisition of precursors for metabolism. Since mycoplasmas have no
outer membrane or cell wall, such transporters are necessarily located
in their single plasma membrane, and due to the many growth
requirements of these microorganisms, they must be able to transport
many different precursors. In addition to having this critical role in
cell physiology, the mycoplasma membrane components are also directly
exposed to the host immune system. Mycoplasma infections are chronic,
and the microorganisms must therefore have strategies for withstanding the damage caused by this immune vigilance. A number of studies have
shown that several species of mycoplasmas are able to modify their
surface antigens at a high frequency. This plasticity may contribute to
evasion from the host humoral immune response (for reviews, see
references 10 and 55). Most of
these variable surface antigens are lipoproteins, and lipoproteins are
known to be immune activators, mainly through their acylated N-terminal structures (7, 34, 41). A prominent feature of many, if not
all, mycoplasmas is the large number of lipoproteins in their membrane
(54), which is consistent with the numerous putative lipoprotein genes identified in the genome sequences (20).
Other than the few lipoproteins which have been suggested to be part of
ABC transporters (11, 15, 19, 48), the physiological role of
these lipoproteins remains unknown. The mycoplasmas thus must cope with
the problem of having most of their cell surface covered with
lipoproteins which, being highly immunogenic, are prone to antibody
recognition. Being preferential targets for immune systems, mycoplasma
lipoproteins are considered to be potentially important for the
development of serological assays and vaccine preparations.
![]()
MATERIALS AND METHODS
Top
Abstract
Introduction
Materials and Methods
Results
Discussion
References
variants, selected on the basis of results of
colony immunoblotting with MAb 7 or the PAb, were designated M
(monoclonal) or P (polyclonal); the number following this letter
indicates a particular clone. The revertants (P35+)
obtained from P35
clonal lineages were designated R
(revertant). For example, the first revertant obtained from the lineage
M6 was designated RM61.
Genomic DNA isolation, Southern blotting, PCR, and DNA sequencing. M. penetrans genomic DNA was purified by conventional procedures (33) and digested with restriction enzymes as recommended by the suppliers (Boehringer Mannheim France SA, Meylan, France; New England Biolabs, Beverly, Mass.). Following agarose gel electrophoresis, Southern blot hybridization was performed on Hybond-N+ membranes (Amersham International). Membranes were prehybridized in a buffer containing 6× SSC (1× SSC is 0.15 M NaCl plus 15 mM sodium citrate), 5× Denhardt's solution, 0.1% SDS, and 100 µg of salmon sperm DNA per ml. The DNA probes were labeled by nick translation and were added to the hybridization solution. The membrane was incubated at 65°C for 16 h with the probes and then washed twice for 20 min at room temperature with 6× SSC-0.1% SDS and once for 30 min at 65°C with 0.2× SSC-0.1% SDS. Blots were exposed to BioMax films (Eastman Kodak, Rochester, N.Y.).
To evaluate the sequence diversity of the p35 gene and its promoter in the different variants, the corresponding regions were first PCR amplified from isolated genomic DNA. Two sets of primers were used for PCR amplification: P35/1 (5'-CAAAGAATTATTTCTAAAAAATAGAAACTAAATGCAAAT-3', beginning at nucleotide [nt] 3 in IMP11) plus P35/17 (5'-CCGGAGCTTTTGGAATTG-3', beginning at nt 1679 in IMP11), and P38/4 (5'-AAATTGCTGCTGC-3', beginning at nt 905 in IMP14) plus P35/18 (5'-GGTAACAAGAATTAACTC-3', beginning at nt 140 in IMP11). Plasmid pMP11 was previously obtained by ligating a 2.9-kbp HpaI DNA fragment from the M. penetrans genome into the single SmaI site of pUC18 (13). The insert in pMP11 encompassing the p35 gene was designated IMP11 and was entirely sequenced (GenBank accession no.: L38250 [13]). To minimize misincorporation of nucleotides, Pfu DNA polymerase (Stratagene, La Jolla, Calif.) was used for PCR. The thermal cycling included DNA denaturation at 94°C for 30 s, followed by 35 cycles of 94°C for 30 s, 55°C for 1 min, and 72°C for 10 min, with a final extension of the products at 72°C for 10 min. After purification by ultrafiltration using Microcon 100 microconcentrators (Amicon, Beverly, Mass.), the amplicons were sequenced, without subcloning, by fluorescent dideoxynucleotide-based chemistry (Dye Terminator Cycle Sequencing kit; Applied Biosystems, Foster City, Calif.) and electrophoresis with an automated DNA sequencer (model 373A; Applied Biosystems). Individual sequence segments were assembled by using AssemblyLine software (Eastman Kodak). The entire sequences of both strands of DNA were determined at least once. To evaluate the size of the p35 gene and its promoter in the different variants, two sets of PCR primers were used: P35/6 (5'-TCTACTTATTAATTTTCGTAGC-3', beginning at nt 160 in IMP11) plus P35/7 (5' GCAACTTTAGCTAAAAAGTTG 3', beginning at nt 1318 in IMP11), and P35/1 (5'-CAAAGAATTATTTCTAAAAAATAGAAACTAAATGCAAAT-3', beginning at nt 3 in IMP11) plus P35/2 (5'-GGCACAGACAGAGAAACAACT-3', beginning at nt 484 in IMP11). The PCR conditions were as described above.PCR amplification, cloning, and sequencing of p35-like genes from the M. penetrans genome. p35-like genes were amplified from the M. penetrans genome by using as the forward primer P38/1 (5'-AATTATTGAAAGCTCTTGC-3', beginning at nt 266 in IMP11), which corresponds to the region of the identical sequences in p35 and p30 genes and which encodes part of the P30 and P35 signal sequences (13). The reverse primer was P38/2 (5'-CGAAAATTAATAAGTAGAGGTAACAAGAATTAACTCTA-3', beginning at nt 140 in IMP11), and the PCR conditions were as described above. The amplicons obtained were ligated into pCRII by T/A overhang (Invitrogen, San Diego, Calif.). The nucleotide sequences of the resulting constructs were determined as described above. Nucleotide and polypeptide sequences were aligned by using Clustal W software (49). Databases were searched for polypeptides similar to mpl (M. penetrans lipoprotein)-encoded polypeptides by using Fasta software (version 3.06) included in the Wisconsin Package (version 9.1; Genetics Computer Group, Madison, Wis.).
RNA isolation, primer extension assay, and RNA slot blot analysis. Total cellular RNA was isolated from mid-logarithmic-phase cultures of M. penetrans by the procedure of Chomczynski and Sacchi (8), using the Trizol reagent (Gibco BRL, Frederick, Md.). The total RNAs were resuspended in distilled water containing 0.05 U of RNase inhibitor (RNAguard; Pharmacia, Uppsala, Sweden) per µg of RNA. The concentration of each preparation was determined at 260 nm.
Standard procedures were used for the primer extension assays (45) with 3 µg of purified total RNA and the primer P35/4 (5'-GGGAATGGTGGAACAGATGG-3', beginning at nt 376 in IMP11). A dideoxy sequencing reaction with pMP11 was initiated with the primer P35/4 and modified T7 DNA polymerase (Sequenase; U.S. Biochemical Corp., Cleveland, Ohio), and the reaction product was loaded on the same sequencing gel as the primer extension reaction. For the RNA slot blot analysis, total cellular RNAs from M. penetrans variants were treated with RNase-free DNase (10 U/100 µg of RNA) for 1 h at 37°C. Equal amounts of RNA (1 µg) were diluted in a RNase-free solution containing formamide (50%), formaldehyde (17%), and MOPS (3-N-morpholinepropanesulfonic acid) buffer, heated at 60°C for 15 min, and collected in duplicate on a GeneScreen Plus membrane (NEN, Boston, Mass.) by vacuum (Minifold II; Schleicher & Schuell, Dassel, Germany). Oligonucleotides probes were labeled with [
-32P]dATP by using T4
polynucleotide kinase. The probes for the detection of p35,
p30, and IMP12-1 expression were OP35
(5'-CCCTTAATTGCAGCAGAATCACC-3'), OP30
(5'-CACCTCCAGTAAACCCTAA-3'), and OMP12-1
(5'-GCACTTCAACTCTTATTTGGATC-3'). The probe ATP/10
(5'-GTTCTTTCACCAACWCCAGCA-3') was designed from a
phylogenetically conserved region of the atpD gene and used as a control. The atpD gene encodes the ATP synthase F1
subunit, and the ATP/10 primer was determined by alignment of the
atpD genes from M. pneumoniae, M. genitalium, and M. capricolum from a phylogenetically
conserved region of the gene encoding the
subunit of the ATP
synthase F1. The specificities of the oligonucleotide probes OP35,
OP30, OMP12-1 and ATP/10 were verified by Southern blot experiments
(data not shown). The patterns obtained were consistent with the known
restriction maps (OP35, OP30, and OMP12-1) or with the presence of a
single gene in the genome (ATP/10).
Blots were hybridized at 37°C for 16 h in a buffer obtained by
dissolving a hybridization buffer tablet (Amersham International) in 10 ml of distilled water as recommended by the manufacturer. After
incubation, the membrane was washed at room temperature for 10 min with
2× SSPE (1× SSPE is 0.15 M NaCl, 10 mM
NaH2PO4H2O, and 1 mM EDTA [pH
7.4]), 10 min with 2× SSPE-2% SDS, and 10 min with 0.1× SSPE.
Blots were exposed to BioMax films (Eastman Kodak).
Nucleotide sequence accession numbers. The GenBank/EMBL accession numbers for DNA sequences of IMP12, IMP13, and IMP14 are AJ006697, AJ006698, and AJ006699, respectively.
| |
RESULTS |
|---|
|
|
|---|
The M. penetrans P35 antigen undergoes high-frequency
phase variations.
By immunoelectron microscopy, P35 is exclusively
detected on the mycoplasma cell surface, including on the tip structure
(Fig. 1A), which is believed to mediate
cytoadherence (16, 27). However, analysis of several
electron microscope fields indicated that a small proportion (about
1.5%) of the cells were not labeled with MAb 7 (Fig. 1A). Thus, in a
given lineage, not all of the mycoplasma cells appear to express
P35-specific immunoreactivity on the surface. This phenomenon was
further evaluated by colony immunoblotting (Fig. 1B to D); using
reactivity to MAb 7 as a marker for P35 expression, a small percentage
of the colonies were found to be P35
(Fig. 1B). A clonal
lineage, selected for its P35+ phenotype, was found to
switch to the P35
phenotype with a calculated frequency
of about 2 × 10
3 per cell per generation. Numerous
M. penetrans colonies exhibited a mixed phenotype, with only
some sectors recognized by MAb 7 (Fig. 1C), consistent with a similarly
high switching frequency of expression during colony growth. The
heterogeneity of colonies for surface antigen expression was also
evaluated by using antibodies exhibiting a broader specificity.
M. penetrans colonies were immunolabeled with a rabbit
antiserum raised against the whole M. penetrans TX-114
antigen extract (PAb 2). Some of the colonies were still found not to
immunoreact (Fig. 1D). The frequencies of P35
colonies
and of colonies showing a mixed phenotype were about 4 × 10
3 and 1.5 × 10
2 per cell per
generation, respectively.
|
phenotype) were isolated and subcultured. Most of
the colonies from these variants were P35
, but a few
bound MAb 7 (Fig. 1E), indicating a reversion to the original
P35+ phenotype and demonstrating the reversibility of the
P35+
P35
phenotype switching.
Various clonal variants were chosen for further analysis:
P35
variants selected with either MAb 7 (M4 and M6) or
PAb 2 (P1, P2, and P4) and the corresponding P35+
revertants (RM41 derived from M4; RM61 and RM62 derived from M6). The
phenotypic stability of each clonal lineage (P35+ or
P35
) was tested. After three in vitro passages, the
relative proportions of the P35
and P35+
colonies were unchanged, indicating that under these in vitro conditions, the phenotype was stable (data not shown).
Analysis of the protein content of the different M. penetrans clonal variants.
To evaluate if the variable P35
expression at the mycoplasma cell surface was due to a true P35 phase
variation (on
off), or to switching between masked and unmasked P35,
TX-114 extracts from selected clonal variants (M4, M6, P1, P2, and P4)
were analyzed by SDS-PAGE (Fig. 2A). We
confirmed our previous finding (13) that P35 is the main
antigen in the M. penetrans TX-114 extract (Fig. 2). The
protein profiles from the selected clonal variants differed from that
of the type strain. No P35 was detected in the M4 extract. The M6 and
P1 extract profiles, although differing from that of M4, were similar
to each other: the major band was an antigen with an apparent molecular
mass of 38 kDa, and there was only a faint band at the P35 position.
Finally, two other profiles were obtained with the two other clonal
variants (P2 and P4). Although P2 and P4 were obtained from colonies
which did not react with PAb 2, examination of the protein profile
(Fig. 2A) and Western blot analysis (data not shown) indicated that P35
was still produced in these variants.
|
revertants in this clonal lineage (Fig. 2B), the
corresponding RM4 revertant exhibited an intense P35 band. A similar
result was obtained with a whole-cell lysate used in place of the
TX-114 extract for this variant (data not shown). For the other variant (M6), there was a MAb-reacting polypeptide, although the intensity of
the signal was lower than those obtained with either the type strain or
its revertants RM61 and RM62. The higher immunoreactivity of P35 in M6
extracts than in M4 extracts (Fig. 2B) may be correlated with the
difference in the frequency of reversion in a culture. Indeed,
immunoelectron microscopy observation of the MAb 7 reactivity of cells
from M4 and M6 cultures indicated proportions of revertants of 1 and
12%, respectively (data not shown). Western blotting with PAb 2 confirmed the lack of P35 in M4 and indicated that other antigens in
the TX-114 extract were nevertheless recognized by antibodies in this
antiserum (Fig. 2B). These results indicate that P35 expression
undergoes phase variation.
P35 phase variation is not associated with chromosomal
rearrangement.
To determine whether large-scale DNA rearrangements
were associated with P35 phase variation, restriction digests of the
genomic DNA preparations from P35+ and P35
clonal populations were compared (Fig.
3). Three endonucleases were chosen for
their different restriction sites in the HpaI 2.9-kbp
fragment, encompassing the p35 gene: BclI has a
single site within the p35 gene, MspI releases a
DNA fragment overlapping most of this gene, and HpaI was
used to clone the fragment. Genomic Southern blotting was performed
either with the entire pMP11 or with the isolated p35 gene
without its 5'-signal sequence-encoding fragment as the probe (Fig.
3B). There were no detectable differences in the restriction patterns
obtained with the genomic DNAs from the type strain and the variant M4.
Thus, large-scale DNA rearrangements (transposition, inversion, or
duplication) of the p35 gene do not appear to be associated
with P35 phase variation. In addition, the obtained profiles strongly
suggested that there is only a single copy of the p35 gene
in the M. penetrans genome.
|
P35 phase variation is not associated with mutations within the
p35 promoter or within the p35 gene
itself.
Although the p35 gene was previously identified
(13), the transcription initiation site remained to be
determined. It was identified by a primer extension assay (Fig.
4A), 132 bp upstream from the proposed
translation initiation site. Potential
10 and
35 boxes were deduced
(Fig. 4B). Interestingly, two direct repeat sequences were found within
this promoter region.
|
The p35 gene belongs to a family of related lipoprotein genes. The organization of the p30 and p35 genes within IMP11 suggested that they might belong to a family of related genes encoding lipoproteins (13). In particular, there was a striking identity of the 5' ends of these two genes, which we used to develop a strategy to amplify a putative lipoprotein gene located upstream from IMP11 on the M. penetrans genome. A forward primer (P38/1) was derived from the conserved region of the p30 and p35 genes, and the reverse primer (P38/2) corresponded to a sequence located upstream from the p35 gene promoter. Using this strategy, we obtained several amplicons, and three were sequenced. All carried potential lipoprotein genes. The sequence from one of the selected plasmids (pMP14), as hypothesized, overlapped the 5' end of IMP11 and was found to encompass part of the gene encoding a putative lipoprotein with a deduced molecular mass of 36 kDa for its mature product (pepIMP14 [Fig. 5]). Putative lipoprotein genes were also found on two other plasmids obtained (pMP12 and pMP13). The genomic positions of the regions inserted in pMP12 and pMP13 are not known. Sequence analysis indicated that they were both PCR amplified from the single P38/1 primer. In agreement with this finding, two divergent and partially overlapping open reading frames, encoding putative lipoproteins, were found to reside on the pMP12 insert (Fig. 5). These related (some being putative) genes, designated mpl genes, share perfect identity in the region corresponding to a lipoprotein signal sequence. The different polypeptides deduced from the mpl genes share a certain degree of similarity. Multiple alignments clearly indicate almost perfect identity of their N termini, including their signal sequences (Fig. 5). With the notable exception of pep1IMP12 and pepIMP13, which share a high degree of identity, more diversity in the primary structures of these polypeptides was found in regions closer to their C termini. The sizes of the deduced mature polypeptides are between 10.6 kDa (pep2IMP12) and 36.8 kDa (pepIMP14); it should also be noted that the size of pepIMP13 is not known because its gene on IMP13 is truncated. We also cannot exclude the possibility that other genes in the M. penetrans genome encode related Mpls. Finally, the search for similarity with the mpl-encoded polypeptides in databases did not reveal any high score of identity.
|
P35 phase variation is conditioned by transcription of the
p35 gene.
To determine whether the P35 phase variation
was associated with corresponding modifications in the production (or
stability) of its mRNA, RNA blotting experiments were performed. To
compare lipoprotein gene expression, 1 µg of total RNA from each
M. penetrans variants was blotted on the membrane. In
addition, to control for total mRNA amounts, an mRNA for a gene
conserved among mollicutes was also specifically detected. The selected
gene, atpD, which encodes the
subunit of the ATP
synthase F1, was chosen because its expression was presumed to be the
same in the different M. penetrans variants. The intensities
of the hybridization signal with the atpD-specific probe
were similar for the variants, except for RM61 and P4, for which the
amount of detected atpD transcript was lower (Fig.
6). Taking this variation into account,
we found that the p35 gene was expressed to a high level in
strain GTU and to a lower level in the RM4, RM61, RM62, P2, and P4
variants. p35 gene expression was lowest in the M4, M6, and
P1 variants, in accordance with the low amount of P35 detected in these
variants by Western blotting. Thus, P35 phase variation is determined
by variations of the level of p35 transcription.
|
| |
DISCUSSION |
|---|
|
|
|---|
This study demonstrated that P35, the M. penetrans major surface antigen, undergoes high-frequency phase variation at a rate similar to that described for other mycoplasma variable lipoproteins (for a review, see reference 10). Sequence analysis of the gene encoding P35 and flanking sequences reveals that this gene is located upstream from a second open reading frame (ORF2) encoding a putative lipoprotein of 30.9 kDa (P30) with significant similarity with P35 (13). In addition, we have identified other related genes, designated mpl genes, which potentially encode lipoproteins. A remarkable feature of the deduced lipoproteins is that they all have identical signal sequences. Although the mature moieties of these polypeptides differ, they are nevertheless homologous. At least three of these genes (the gene encoding pepIMP14, p35, and p30) are clustered in the M. penetrans genome. A similar organization of genes encoding variable lipoproteins has been previously described for M. bovis (1, 31), M. hyorhinis (43, 56), M. fermentans (47, 48), M. gallisepticum (32), and M. pulmonis (2, 46). Analysis of the protein patterns obtained with the TX-114 extract from the different M. penetrans variants clearly indicated that the P35 phase variation was associated with modifications of the expression of the other lipoproteins; this was also partially confirmed by the results of RNA slot blotting. However, the amount of p30 mRNA in the different variants could not be correlated with that of p35 transcript, suggesting that the expression of these two genes is not coordinated. The heterogeneity in the protein patterns among the M. penetrans variants was remarkable and highlighted the multiple possible combinations in the repertoire of lipoproteins expressed at a given time.
The role of P35 in M. penetrans physiology is not known. It is striking that such an abundant protein is nonessential: under the electron microscope, the different variants exhibited similar morphologies and the capsule layer identified recently by us was not affected by the absence of P35 expression (data not shown). In addition, the rates of in vitro growth of the variants were similar. Since two-component sensory elements have not been found in the genomes of M. pneumoniae and M. genitalium (20), it is possible that some of the mycoplasma lipoproteins act as sensory elements. A similar hypothesis has been formulated for the lipoprotein OspA from the phylogenetically unrelated Borrelia burgdorferi, whose genome shows some similarities with those of M. pneumoniae and M. genitalium (14). Two of the common features are a large repertoire of lipoprotein genes and only two response-regulator two-component systems. OspA, one of the most abundant B. burgdorferi lipoproteins, is a host-protective antigen in Lyme disease and is subjected to differential expression for which the genetic basis is unknown (for a review, see reference 37). On the basis of structural studies, it was suggested that OspA may be a sensory element in the membrane, the ligand of which is still to be identified (26).
The identification of colonies which did not immunoreact with PAb 2 was striking because it suggested that either the complete set of expressed surface proteins can change or newly expressed surface polypeptide(s) provided a mask for those proteins recognized by PAb 2. Analysis of the TX-114 extracts from the variants P2 and P4 favored the second possibility because P35 continued to be present in these variants. This result is of particular importance, as it may reveal the putative role of these antigenic variations in the escape from the immune response. A heterogeneous reaction pattern of mycoplasma colonies to a polyclonal antiserum was previously described for another species, M. bovis (44), and the masking/unmasking of a lipoprotein epitope was found in assays using a MAb (44). In addition, there is a growing body of evidence that mycoplasma surface antigenic variation may provide a protective mechanism against the damage caused by the immune response. First, it was shown that the repertoire of variable antigens is changed after an experimentally induced infection (25). Second, it has been shown in vitro that, using as a selection pressure MAbs or antibodies from immunized or experimentally infected animals directed against surface antigens, it is possible to drive the antigenic variation in M. bovis (23). Third, M. hyorhinis variants expressing Vlp (variable lipoprotein) extended in length were resistant to complement-independent growth inhibition by host antibodies, whereas variants expressing shorter Vlp are more susceptible (9). Our data confirm the phase variations of immunodominant lipoproteins in mycoplasmas. This phenomenon associated with a large repertoire of possibly expressed antigens may allow them to evade the humoral immune response. It is also likely, although not documented in the literature, that phase variations also allow mycoplasmas to avoid damage from this host's immune defense.
In contrast to other variable mycoplasma lipoproteins, we observed phase variation but no size variation of P35. Size variation has been associated with the presence of repetitive elements in the C terminus of the gene encoding the variable protein. The p35 gene has no such repeated elements. Size variation has been described, however, for surface antigens in Ureaplasma urealyticum, M. hyorhinis, M. pulmonis, and M. bovis (for a review, see reference 12).
The genetic mechanisms underlying the mycoplasma lipoprotein phase
variations have been elucidated in a few cases: DNA rearrangements such
as that described for the M. pulmonis Vsa antigens (2, 46), point mutations either within the promoter region
(56) or within the gene itself (48, 57), and
masking/unmasking of epitopes (44). In M. hyorhinis, the Vlp antigen phase variations are due to random size
modifications of the poly(A) box within the vlp gene
promoter (56). We have identified the promoter of the
p35 gene and found that it presents some interesting
features. The distance between the sites for initiation of
transcription and translation is 132 bp, which is similar to that
described for the promoter of M. hyorhinis Vlps
(56). Although the sequence between the
35 box and the
translation start codon has an A+T content of 84%, there is no poly(A)
tract as was found between the
35 and
10 boxes of M. hyorhinis Vlp genes (56). The size variation of this
repetitive tract was shown to be associated with phase variation of
these lipoproteins (56). However, such an AT-rich region
upstream from the transcription initiation site suggests DNA bending
(51) due to the binding of regulatory proteins (36). This possibility is also supported by the presence of two dyad symmetries in the vicinity of the promoter. Since the P35
phase variation was not associated with DNA rearrangement or with
mutation within the p35 gene or its promoter, we suggest that the regulated expression of p35 could be due to an as
yet unidentified regulatory protein(s).
The demonstration of P35 phase variation has implications for the development and use of M. penetrans serological assays. Indeed, current enzyme-linked immunosorbent assays are based on a P35-containing TX-114 extract (17, 52). However, it is possible that P35 expression is necessary for the early stages of mycoplasma infection, and in this case we would expect to detect P35-specific antibodies in every M. penetrans-infected host. This possibility is supported by experimental infections. Alternatively, P35 may not be essential, in which case testing for anti P35 antibodies would be unsatisfactory. Our current estimates of the incidence of M. penetrans cases of infection, which is difficult to document because of the fastidious growth of the organism from clinical sites, may therefore be underestimated.
| |
ACKNOWLEDGMENTS |
|---|
O.N. and I.C. equally contributed to this work.
We thank Emmanuelle Perret and Christine Schmitt for technical assistance with electron microscopy.
This work was supported by the Agence Nationale de Recherche contre le SIDA and the Institut Pasteur. O.N. and I.C. were recipients of a fellowship from the Pasteur-Weizman Foundation and from the Ministère de l'Education Nationale, de la Recherche et de la Technologie, respectively.
| |
ADDENDUM IN PROOF |
|---|
During the time that the present paper was being reviewed, an outstanding review on different aspects of mycoplasma biology, including antigen variations, was published (S. Razin, D. Yogev, and Y. Naot, Microbiol. Mol. Biol. Rev. 62:1094-1156, 1998). In addition, in another recently published paper (G. Pyrowolakis, D. Hofmann, and R., Herrmann, J. Biol. Chem. 273:24792-24796, 1998), a mycoplasma lipoprotein was found to have a key role in the cell metabolism as the subunit b of the F0F1-type ATPase.
| |
FOOTNOTES |
|---|
* Corresponding author. Mailing address: Unité d'Oncologie Virale, Institut Pasteur, 28, rue du Dr. Roux, 75724 Paris Cedex 15, France. Phone: (33-1)-40-61-31-31. Fax: (33-1)-40-61-34-65. E-mail: ablancha{at}pasteur.fr.
Present address: Imperial College School of Medicine at St.
Mary's, Department of Medical Microbiology, London, W2 1PG, United Kingdom.
Editor: R. N. Moore
| |
REFERENCES |
|---|
|
|
|---|
| 1. |
Behrens, A.,
M. Heller,
H. Kirchhoff,
D. Yogev, and R. Rosengarten.
1994.
A family of phase- and size-variant membrane surface lipoprotein antigens (Vsps) of Mycoplasma bovis.
Infect. Immun.
62:5075-5084 |
| 2. | Bhugra, B., L. L. Voelker, N. Zou, H. Yu, and K. Dybvig. 1995. Mechanism of antigenic variation in Mycoplasma pulmonis: interwoven, site-specific DNA inversions. Mol. Microbiol. 18:703-714[Medline]. |
| 3. | Blanchard, A., and L. Montagnier. 1994. AIDS-associated mycoplasmas. Annu. Rev. Microbiol. 48:687-712[Medline]. |
| 4. | Blanchard, A., L. Montagnier, and M. L. Gougeon. 1997. Influence of microbial infections on the progression of HIV disease. Trends Microbiol. 5:326-331[Medline]. |
| 5. | Bove, J. M. 1993. Molecular features of mollicutes. Clin. Infect. Dis. 17:S10-S31. |
| 6. | Brenner, C., O. Neyrolles, and A. Blanchard. 1996. Mycoplasmas and HIV infection: from epidemiology to their interaction with immune cells. Front. Biosci. 1:42-54. |
| 7. | Brenner, C., H. Wroblewski, M. Le Henaff, L. Montagnier, and A. Blanchard. 1997. Spiralin, a mycoplasmal membrane lipoprotein, induces T-cell-independent B-cell blastogenesis and secretion of proinflammatory cytokines. Infect. Immun. 65:4322-4329[Abstract]. |
| 8. | Chomczynski, P., and N. Sacchi. 1987. Single-step method of RNA isolation by acid guanidinium thiocyanate-phenol-chloroform extraction. Anal. Biochem. 162:156-159[Medline]. |
| 9. | Citti, C., M. F. Kim, and K. S. Wise. 1997. Elongated versions of Vlp surface lipoproteins protect Mycoplasma hyorhinis escape variants from growth-inhibiting host antibodies. Infect. Immun. 65:1773-1785[Abstract]. |
| 10. | Citti, C., and R. Rosengarten. 1997. Mycoplasma genetic variation and its implication for pathogenesis. Wien. Klin. Wochenschr. 109:562-568[Medline]. |
| 11. | Dudler, R., C. Schmidhauser, R. W. Parish, R. E. Wettenhall, and T. Schmidt. 1988. A mycoplasma high-affinity transport system and the in vitro invasiveness of mouse sarcoma cells. EMBO J. 7:3963-3970[Medline]. |
| 12. | Dybvig, K., and L. L. Voelker. 1996. Molecular biology of mycoplasmas. Annu. Rev. Microbiol. 50:25-57[Medline]. |
| 13. | Ferris, S., H. L. Watson, O. Neyrolles, L. Montagnier, and A. Blanchard. 1995. Characterization of a major Mycoplasma penetrans lipoprotein and of its gene. FEMS Microbiol. Lett. 130:313-319[Medline]. |
| 14. | Fraser, C. M., S. Casjens, W. M. Huang, G. G. Sutton, R. Clayton, R. Lathigra, O. White, K. A. Ketchum, R. Dodson, E. K. Hickey, M. Gwinn, B. Dougherty, J. F. Tomb, R. D. Fleischmann, D. Richardson, J. Peterson, A. R. Kerlavage, J. Quackenbush, S. Salzberg, M. Hanson, R. Vanvugt, N. Palmer, M. D. Adams, J. Gocayne, J. Weidman, et al. 1997. Genomic sequence of a Lyme disease spirochaete, Borrelia burgdorferi. Nature 390:580-586[Medline]. |
| 15. |
Fraser, C. M.,
J. D. Gocayne,
O. White,
M. D. Adams,
R. A. Clayton,
R. D. Fleischmann,
C. J. Bult,
A. R. Kerlavage,
G. Sutton,
J. M. Kelley, et al.
1995.
The minimal gene complement of Mycoplasma genitalium.
Science
270:397-403 |
| 16. | Giron, J. A., M. Lange, and J. B. Baseman. 1996. Adherence, fibronectin binding, and induction of cytoskeleton reorganization in cultured human cells by Mycoplasma penetrans. Infect. Immun. 64:3419-3424[Medline]. |
| 17. | Grau, O., B. Slizewicz, P. Tuppin, V. Launay, E. Bourgeois, N. Sagot, M. Moynier, A. Lafeuillade, H. Bachelez, J. P. Clauvel, et al. 1995. Association of Mycoplasma penetrans with human immunodeficiency virus infection. J. Infect. Dis. 172:672-681[Medline]. |
| 18. | Hayes, M. M., B. J. Li, D. J. Wear, and S. C. Lo. 1996. Pathogenicity of Mycoplasma fermentans and Mycoplasma penetrans in experimentally infected chicken embryos. Infect. Immun. 64:3419-3424. |
| 19. |
Himmelreich, R.,
H. Hilbert,
H. Plagens,
E. Pirkl,
B. C. Li, and R. Herrmann.
1996.
Complete sequence analysis of the genome of the bacterium Mycoplasma pneumoniae.
Nucleic Acids Res.
24:4420-4449 |
| 20. |
Himmelreich, R.,
H. Plagens,
H. Hilbert,
B. Reiner, and R. Herrmann.
1997.
Comparative analysis of the genomes of the bacteria Mycoplasma pneumoniae and Mycoplasma genitalium.
Nucleic Acids Res.
25:701-712 |
| 21. | Laemmli, U. K. 1970. Cleavage of structural proteins during the assembly of the head of bacteriophage T4. Nature 227:680-685[Medline]. |
| 22. | Le Gall, S., M. C. Prevost, J. M. Heard, and O. Schwartz. 1997. Human immunodeficiency virus type I Nef independently affects virion incorporation of major histocompatibility complex class I molecules and virus infectivity. Virology 229:295-301[Medline]. |
| 23. | Le Grand, D., M. Solsona, R. Rosengarten, and F. Poumarat. 1996. Adaptive surface antigen variation in Mycoplasma bovis to the host immune response. FEMS Microbiol. Lett. 144:267-275[Medline]. |
| 24. |
Lemaitre, M.,
Y. Henin,
F. Destouesse,
C. Ferrieux,
L. Montagnier, and A. Blanchard.
1992.
Role of mycoplasma infection in the cytopathic effect induced by human immunodeficiency virus type 1 in infected cell lines.
Infect. Immun.
60:742-748 |
| 25. | Levisohn, S., R. Rosengarten, and D. Yogev. 1995. In vivo variation of Mycoplasma gallisepticum antigen expression in experimentally infected chickens. Vet. Microbiol. 45:219-231[Medline]. |
| 26. |
Li, H.,
J. J. Dunn,
B. J. Luft, and C. L. Lawson.
1997.
Crystal structure of Lyme disease antigen outer surface protein A complexed with an Fab.
Proc. Natl. Acad. Sci. USA
94:3584-3589 |
| 27. | Lo, S. C., M. M. Hayes, H. Kotani, P. F. Pierce, D. J. Wear, P. B. Newton, J. G. Tully, and J. W. Shih. 1993. Adhesion onto and invasion into mammalian cells by Mycoplasma penetrans: a newly isolated mycoplasma from patients with AIDS. Mod. Pathol. 6:276-280[Medline]. |
| 28. |
Lo, S. C.,
M. M. Hayes,
J. G. Tully,
R. Y. Wang,
H. Kotani,
P. F. Pierce,
D. L. Rose, and J. W. Shih.
1992.
Mycoplasma penetrans sp. nov., from the urogenital tract of patients with AIDS.
Int. J. Syst. Bacteriol.
42:357-364 |
| 29. | Lo, S. C., M. M. Hayes, R. Y. Wang, P. F. Pierce, H. Kotani, and J. W. Shih. 1991. Newly discovered mycoplasma isolated from patients infected with HIV. Lancet 338:1415-1418[Medline]. |
| 30. |
Lo, S. C.,
S. Tsai,
J. R. Benish,
J. W. Shih,
D. J. Wear, and D. M. Wong.
1991.
Enhancement of HIV-1 cytocidal effects in CD4+ lymphocytes by the AIDS-associated mycoplasma.
Science
251:1074-1076 |
| 31. |
Lysnyansky, I.,
R. Rosengarten, and D. Yogev.
1996.
Phenotypic switching of variable surface lipoproteins in Mycoplasma bovis involves high-frequency chromosomal rearrangements.
J. Bacteriol.
178:5395-5401 |
| 32. | Markham, P. F., M. D. Glew, J. E. Sykes, T. R. Bowden, T. D. Pollocks, G. F. Browning, K. G. Whithear, and I. D. Walker. 1994. The organisation of the multigene family which encodes the major cell surface protein, pMGA, of Mycoplasma gallisepticum. FEBS Lett. 352:347-352[Medline]. |
| 33. | Marmur, J. 1961. A procedure for the isolation of deoxyribonucleic acid from microorganisms. J. Mol. Biol. 3:208-218. |
| 34. |
Muhlradt, P. F.,
M. Kiess,
H. Meyer,
R. Sussmuth, and G. Jung.
1997.
Isolation, structure elucidation, and synthesis of a macrophage stimulatory lipopeptide from Mycoplasma fermentans acting at picomolar concentration.
J. Exp. Med.
185:1951-1958 |
| 35. |
Neyrolles, O.,
J.-P. Eliane,
S. Ferris,
R. Ayr Florio da Cunha,
M.-C. Prevost,
E. Bahraoui, and A. Blanchard.
1999.
Antigenic characterization and cytolocalization of P35, the major Mycoplasma penetrans antigen.
Microbiology
145:343-355 |
| 36. | Perez-Martin, J., and V. de Lorenzo. 1997. Clues and consequences of DNA bending in transcription. Annu. Rev. Microbiol. 51:593-628[Medline]. |
| 37. | Philipp, M. T. 1998. Studies on OspA: a source of new paradigms in Lyme disease research. Trends Microbiol. 6:44-47[Medline]. |
| 38. | Pollack, J. D. 1997. Mycoplasma genes: a case for reflective annotation. Trends Microbiol. 5:413-419[Medline]. |
| 39. |
Pollack, J. D.,
M. V. Williams,
J. Banzon,
M. A. Jones,
L. Harvey, and J. G. Tully.
1996.
Comparative metabolism of Mesoplasma, Entomoplasma, Mycoplasma, and Acholeplasma.
Int. J. Syst. Bacteriol.
46:885-890 |
| 40. | Pollack, J. D., M. V. Williams, and R. N. McElhaney. 1997. The comparative metabolism of the mollicutes (Mycoplasmas): the utility for taxonomic classification and the relationship of putative gene annotation and phylogeny to enzymatic function in the smallest free-living cells. Crit. Rev. Microbiol. 23:269-354[Medline]. |
| 41. | Rawadi, G., and S. Roman-Roman. 1996. Mycoplasma membrane lipoproteins induced proinflammatory cytokines by a mechanism distinct from that of lipopolysaccharide. Infect. Immun. 64:637-643[Abstract]. |
| 42. |
Rosengarten, R.,
A. Behrens,
A. Stetefeld,
M. Heller,
M. Ahrens,
K. Sachse,
D. Yogev, and H. Kirchhoff.
1994.
Antigen heterogeneity among isolates of Mycoplasma bovis is generated by high-frequency variation of diverse membrane surface proteins.
Infect. Immun.
62:5066-5074 |
| 43. |
Rosengarten, R.,
P. M. Theiss,
D. Yogev, and K. S. Wise.
1993.
Antigenic variation in Mycoplasma hyorhinis: increased repertoire of variable lipoproteins expanding surface diversity and structural complexity.
Infect. Immun.
61:2224-2228 |
| 44. | Rosengarten, R., and D. Yogev. 1996. Variant colony surface antigenic phenotypes within mycoplasma strain populations: implications for species identification and strain standardization. J. Clin. Microbiol. 34:149-158[Abstract]. |
| 45. | Sambrook, J., E. F. Fritsch, and T. Maniatis. 1989. Molecular cloning: a laboratory manual, 2nd ed. Cold Spring Harbor Laboratory, Cold Spring Harbor, N.Y. |
| 46. | Simmons, W. L., C. Zuhua, J. I. Glass, J. W. Simecka, G. H. Cassell, and H. L. Watson. 1996. Sequence analysis of the chromosomal region around and within the V-1-encoding gene of Mycoplasma pulmonis: evidence for DNA inversion as a mechanism for V-1 variation. Infect. Immun. 64:472-479[Abstract]. |
| 47. | Theiss, P., A. Karpas, and K. S. Wise. 1996. Antigenic topology of the P29 surface lipoprotein of Mycoplasma fermentans: differential display of epitopes results in high-frequency phase variation. Infect. Immun. 64:1800-1809[Abstract]. |
| 48. |
Theiss, P., and K. S. Wise.
1997.
Localized frameshift mutation generates selective, high-frequency phase variation of a surface lipoprotein encoded by a mycoplasma ABC transporter operon.
J. Bacteriol.
179:4013-4022 |
| 49. |
Thompson, J. D.,
D. G. Higgins, and T. J. Gibson.
1994.
CLUSTAL W improving the sensitivity of progressive multiple sequence alignment through sequence weighting, position-specific gap penalties and weight matrix choice.
Nucleic Acids Res.
22:4673-4680 |
| 50. |
Tully, J. G.,
R. F. Whitcomb,
H. F. Clark, and D. L. Williamson.
1977.
Pathogenic mycoplasmas: cultivation and vertebrate pathogenicity of a new spiroplasma.
Science
195:892-894 |
| 51. |
VanWye, J. D.,
E. C. Bronson, and J. N. Anderson.
1991.
Species-specific patterns of DNA bending and sequence.
Nucleic Acids Res.
19:5253-5261 |
| 52. | Wang, R. Y., J. W. Shih, T. Grandinetti, P. F. Pierce, M. M. Hayes, D. J. Wear, H. J. Alter, and S. C. Lo. 1992. High frequency of antibodies to Mycoplasma penetrans in HIV-infected patients. Lancet 340:1312-1316[Medline]. |
| 53. | Wang, R. Y., J. W. Shih, S. H. Weiss, T. Grandinetti, P. F. Pierce, M. Lange, H. J. Alter, D. J. Wear, C. L. Davies, R. K. Mayur, et al. 1993. Mycoplasma penetrans infection in male homosexuals with AIDS: high seroprevalence and association with Kaposi's sarcoma. Clin. Infect. Dis. 17:724-729[Medline]. |
| 54. | Wieslander, A., M. J. Boyer, and H. Wróblewski. 1992. Membrane protein structure, p. 93-112. In J. Maniloff, R. N. McElhaney, L. R. Finch, and J. B. Baseman (ed.), Mycoplasmas: molecular biology and pathogenesis. American Society for Microbiology, Washington, D.C. |
| 55. | Wise, K. S. 1993. Adaptive surface variation in mycoplasmas. Trends Microbiol. 1:59-63[Medline]. |
| 55a. | Yanez, A., L. Cedillo, J. Rojas M.-C. Prévost, O. Neyrolles, E. Alonso, H. L. Watson, A. Blanchard, and G. H. Cassell. Mycoplasma penetrans bacteremia associated with primary antiphospholipid syndrome. Emerg. Infect. Dis., in press. |
| 56. | Yogev, D., R. Rosengarten, R. Watson-McKown, and K. S. Wise. 1991. Molecular basis of Mycoplasma surface antigenic variation: a novel set of divergent genes undergo spontaneous mutation of periodic coding regions and 5' regulatory sequences. EMBO J. 10:4069-4079[Medline]. |
| 57. | Zhang, Q., and K. S. Wise. 1997. Localized reversible frameshift mutation in an adhesin gene confers a phase-variable adherence phenotype in mycoplasma. Mol. Microbiol. 25:859-869[Medline]. |
This article has been cited by other articles:
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Copyright © 2009 by the American Society for Microbiology. For an alternate route to Journals.ASM.org, visit: http://intl-journals.asm.org | More Info»