Previous Article | Next Article 
Infection and Immunity, April 1999, p. 1967-1973, Vol. 67, No. 4
0019-9567/99/$04.00+0
Copyright © 1999, American Society for Microbiology. All rights reserved.
Genetic Control of Experimental Lyme Arthritis
in the Absence of Specific Immunity
Charles R.
Brown, and
Steven L.
Reiner*
Department of Medicine and Gwen Knapp Center
for Lupus and Immunology Research, Committee on Immunology,
University of Chicago, Chicago, Illinois 60637
Received 6 October 1998/Returned for modification 20 November
1998/Accepted 21 January 1999
 |
ABSTRACT |
Host genetics play an important role in determining resistance or
susceptibility to experimental Lyme arthritis. While specific immunity
appears to regulate disease resolution, innate immunity appears to
regulate disease severity. Intradermal infection with Borrelia
burgdorferi yields severe arthritis in C3H/He (C3H) mice but only
minimal arthritis in BALB/c mice. Intradermal infection of
immunodeficient C3H SCID mice also results in severe arthritis, but
arthritis of only moderate severity in BALB/c SCID mice. In the present
study, we examined immunodeficient recombinase-activating gene-knockout
(RAG-1
/
) (RAG
) mice from
resistant C57BL/6 (B6) and DBA/2 (DBA) mouse strains. B. burgdorferi-infected B6 RAG
and DBA
RAG
mice had little or no ankle swelling, a low
occurrence of inflammatory infiltrates in tibiotarsal joints, and low
arthritis severity scores in comparison to RAG+ and
RAG
BALB/c or C3H mice. Few differences in spirochete DNA
levels in ankles of resistant and susceptible RAG
mice
were seen. These data suggest that resistance to arthritis development
following B. burgdorferi infection is not necessarily dependent on an acquired immune response and can occur despite the
presence of high spirochete burden. Thus, genes expressed outside the
specific immune response can be central regulators of experimental arthritis.
 |
INTRODUCTION |
Experimental Lyme borreliosis in
mice partially recapitulates the disease spectrum seen in humans after
infection with Borrelia burgdorferi (4). After
inoculation of mice with B. burgdorferi, spirochetes
disseminate and can be recovered from many tissues, including the
urinary bladder, skin, and heart (5). The arthritis which
develops acutely is characterized by inflammatory infiltrates (predominantly neutrophils and monocytes), tendonitis, synovitis, and
synovial hypertrophy (7). Both spirochete and host factors control the degree of pathology which develops in infected animals. C3H/He (C3H) mice develop a transient arthritis which peaks within 21 days and then resolves (4). Arthritis development in BALB/c mice is variable and correlates with the numbers of spirochetes present
within the joint (28). BALB/c mice are resistant to arthritis development when infected with 200 B. burgdorferi
but develop arthritis of greater severity as the infectious dose is increased (18). In contrast, C57BL/6 (B6) mice remain
resistant to arthritis development even in the presence of high
infectious doses (18). Thus, host genetics are critical in
determining the extent of the pathology which develops during
experimental Lyme borreliosis.
Resistance to the development of experimental Lyme arthritis or its
resolution appears to involve components of the adaptive immune
response. Passive transfer of immune sera or the transfer of B and T
cells (but not T cells alone) causes regression of arthritis in SCID
mice, suggesting the importance of antibodies in disease resolution
(9, 10). Similarly, the transfer of presensitized spleen
cells but not T cells alone can protect SCID mice from challenge; the
transfer of B cells confers only partial protection (24). T
cells may also influence the response to Borrelia through
the production of inflammatory cytokines. Th1 responses promote an
inflammatory response that may exacerbate arthritis development because
the administration of anti-interleukin 12 (IL-12) or anti-gamma
interferon antibodies reduces arthritis severity in susceptible animals
(2, 16, 19). Th2 responses may protect against arthritis
development since treatment of resistant mice with anti-IL-4 increases
arthritis severity (16, 19) and treatment of susceptible
mice with rIL-4 or passive transfer of a CD4+ Th2 clone
reduces development of arthritis (17, 20). In contrast, an
adaptive immune response is not required for susceptibility to
development of experimental Lyme arthritis (6, 22, 23). SCID
mice from a genetically resistant BALB/c background are unable to
control infection and develop a progressive, unremitting arthritis. Innate immunity in immunodeficient animals, however, does appear to
provide some control over disease severity. Arthritis severity in C3H
SCID mice was more severe than that which developed in BALB/c SCID mice
(6). Antibody depletion of IL-12 causes an increase in
arthritis severity in C3H SCID mice but a reduction of arthritis
severity in normal C3H mice (2, 3). The extent of protection
against arthritis development provided by the innate immune response in
various mouse strains, however, is unknown.
In the present study, we infected immunocompetent (RAG+)
and immunodeficient recombinase-activating gene-knockout
RAG-1
/
(RAG
) mice on C3H,
BALB/c, B6, or DBA/2 (DBA) backgrounds and monitored arthritis
development for 21 days. Infection of RAG+ and
RAG
C3H or BALB/c mice resulted in the development of
severe arthritis. In contrast, infection of RAG+ and
RAG
B6 or DBA mice did not result in arthritis
development. These data demonstrate that an adaptive immune response is
not required for arthritis resistance. Thus, in the absence of specific
immunity, other genetic polymorphisms are capable of controlling
resistance or susceptibility to B. burgdorferi-induced
arthritis in mice.
 |
MATERIALS AND METHODS |
Mice and infections.
Female C3H, DBA, BALB/c, B6, B6 SCID
and B6×129 RAG-1
/
mice were purchased from
The Jackson Laboratory (Bar Harbor, Maine). The wild-type mouse strains
were made immunodeficient (RAG
) by crossing them to
B6×129 RAG-1
/
mice and then backcrossing to
the designated background. During the backcross breedings, heterozygous
mice were screened by PCR for the presence of the neomycin resistance
gene contained in the RAG
cassette. Heterozygous
littermates were then intercrossed following the designated number of
backcrosses to obtain RAG
animals. C3H RAG
mice were in the fifth backcross to C3H; DBA RAG
mice
were in the fifth backcross to DBA; BALB/c RAG
mice were
in the eighth backcross to BALB/c; and B6 RAG
mice were
in the third backcross to B6 when used in experiments. Genotypes were
confirmed by flow cytometry of peripheral blood mononuclear cells using
monoclonal antibodies against T cells (anti-CD3) and B cells
(anti-B220). All mice were between 4 and 6 weeks of age at the time of
infection. B. burgdorferi N40 was kindly provided by Steven
Barthold (Yale University, New Haven, Conn.). Spirochetes were
reisolated from SCID mice, passaged twice in Barbour-Stoenner-Kelly II
(BSK) medium (Sigma Chemical Co., St. Louis, Mo.), and frozen in
aliquots at
80°C. For infections, an aliquot was thawed, placed in
7 ml of medium and grown for 5 days at 32°C. Mice were inoculated in
both hind footpads with 5 × 105 B. burgdorferi in 50 µl of medium. Tibiotarsal joints were measured weekly with a metric caliper (Ralmike's Tool-A-Rama, South Plainfield, N.J.) through the thickest anteroposterior diameter of the ankle. Blood, heart, spleen, urinary bladder, skin, and ankles were
aseptically collected and cultured at 32°C for 14 days in BSK medium.
Cultures were scored by placing 10 µl of supernatant on a microscope
slide under a cover slip (22 by 22 mm) and examining 20 high-power
fields by dark-field microscopy.
Histology.
Mice were sacrificed 21 days following infection;
the ankles were washed with 70% ethanol, and the skin was removed. The
sample was excised and placed in 10% buffered formalin. The sample was embedded in paraffin, sectioned, and stained with hematoxylin and
eosin. Arthritis severity scores were determined in a blinded manner
and graded on a scale of 0 to 3 (6). Grade 0 represents no
inflammation, grades 1 and 2 represent mild to moderate inflammation, and grade 3 represents severe inflammation. Arthritis was characterized by the infiltration of neutrophils and monocytes into the joints, tendons, and ligament sheaths; hypertrophy and hyperplasia of the
synovium; and fibrin exudates. Arthritis severity scores were based
upon the extent of the observed inflammatory changes.
Competitive PCR.
Ankles were excised by first removing the
skin and then cutting just above and below the ankle joint. Ear samples
were taken with a 2-mm ear punch. To extract DNA from ankle tissue,
samples were digested in 0.5 ml of 1% collagenase for 4 h at
37°C. Following incubation, 0.25 ml of 3× lysis buffer (0.3-mg/ml
proteinase K in 600 mM NaCl-60 mM Tris-HCl [pH 8.0]-150 mM
EDTA-0.6% sodium dodecyl sulfate) was added, and the mixture was
incubated for 16 h at 55°C. The debris was pelleted, and the
supernatants were transferred to new tubes. Sample DNA was extracted
with phenol/chloroform and precipitated with ethanol. The sample DNA
was then pelleted, washed with 70% ethanol, air dried, and resuspended
in 0.2 ml of Tris-EDTA buffer. Ear punch DNA was extracted by the same
procedure but without the collagenase treatment. Competitive PCR was
performed using a constant amount (0.25 pg) of the BC3 polycompetitor
as previously described (13) and approximately 150 ng of
sample DNA. The BC3 polycompetitor consists of a linear DNA molecule containing modified portions of the fla and ospA
genes of Borrelia and a modified portion of the mammalian
IL4 gene (13). The following sets of primers were
used for PCR amplification of both wild-type and BC3 gene
segments: ospA 5' primer TCTTGAAGGAAGTTTAACTGCTG, ospA 3' primer CAAGTTTTGTAATTTCAACTGCTGA;
IL4pr 5' primer GATCAGCTGGGCTAGGATGCGAGA, IL4pr 3' primer GGGCCAATCAGCACCTCTCTTCCA.
Sample reactions contained 2.5 mM MgCl2. For
IL4pr reactions, samples were initially denatured for
60 s, and the cycling parameters thereafter were denaturation at
94°C for 50 s, annealing at 60°C for 30 s, and extension
at 72°C for 50 s, for 35 cycles. For ospA
amplification, an initial 60-s denaturation step was followed by cycles
of denaturation at 94°C for 60 s, annealing at 60°C for
60 s, and extension at 72°C for 90 s, for 45 cycles.
Statistics.
Results are expressed as means ± standard
deviations. Data were analyzed using analysis of variance followed by
the Tukey test for multiple comparisons. For significance tests, a
level of
= 0.05 was used.
 |
RESULTS |
We infected RAG+ and RAG
mice on C3H,
B6, BALB/c, or DBA backgrounds and monitored arthritis development for
21 days. Figure 1 shows measurement of
ankle diameters for representative mouse strains from three separate
experiments. In all experiments, 3 to 5 mice were injected in the hind
footpads with 5 × 105 B. burgdorferi, and
the diameters of tibiotarsal joints were measured weekly. Footpad
inoculations were used to deliver the organisms near the joint of
interest and to control for possible differences in spirochete
dissemination in the different mouse strains. Footpad inoculation of
media alone causes no histological changes in the tibiotarsal joints
compared with noninjected control mice (12a). We first
compared the response of B6 RAG
to that of C3H
RAG
mice. RAG+ C3H and B6 were used as
susceptible and resistant controls, respectively (Fig. 1A). Ankles from
C3H and C3H RAG
mice had significant swelling by day 14 compared to those of B6 or B6 RAG
mice (P < 0.001). Ankle swelling in C3H mice peaked about 14 days after
infection and was in remission by day 21. Ankle swelling in C3H
RAG
mice continued throughout the course of the
experiment and was significantly greater than swelling in C3H mice at
day 21 (P < 0.001). This result is consistent with the
findings of others that immunodeficient C3H mice develop a severe
progressive nonremitting arthritis (6, 22, 23). B6 and B6
RAG
mice did not display any significant increase in
ankle diameters throughout the experimental period, suggesting an
underlying resistance to the development of arthritis. Similar results
were obtained when B6 SCID mice were substituted for B6
RAG
mice (Fig. 1B). We also examined the response of
BALB/c RAG
and DBA RAG
mice to footpad
inoculation with B. burgdorferi (Fig. 1C). Ankle curves for
RAG+ control mice were similar to those for resistant and
susceptible strains in Fig. 1A and B (data not shown). The C3H
RAG
and BALB/c RAG
mice had significant
progressive swelling of their ankle joints which was discernible by day
14 postinfection (P < 0.001). In contrast, DBA
RAG
and B6 RAG
mice had no discernible
ankle swelling throughout the experimental period. DBA
RAG
and B6 RAG
mice that were monitored for
5 weeks did not develop ankle swelling or elevated arthritis severity
scores, indicating that resistance was not simply due to delayed
development of arthritis (data not shown).

View larger version (18K):
[in this window]
[in a new window]
|
FIG. 1.
Effect of immunodeficiency on ankle swelling following
infection of mice with B. burgdorferi. Mice (3 to 5 per
group) were 4 to 6 weeks old at the time of infection and were
inoculated in the hind footpad. Panels represent three separate
experiments. Error bars represent ± standard deviations.
Asterisks indicate significant differences in ankle swelling between
resistant and susceptible mouse strains (P < 0.001).
Crosses indicate significant differences in ankle swelling between C3H
and C3H RAG (C3H RAG°) mice (P < 0.05).
|
|
Ankle swelling does not always correlate with underlying arthritis
development. Therefore, a histological analysis was performed to more
accurately characterize the extent of pathology developing within the
ankle. Figure 2 shows
hematoxylin-and-eosin-stained sections of ankles from
infected RAG+ and RAG
mouse strains. The
slides are focused on the histological changes occurring around a major
anterior tendon of the tibiotarsal joint as studied by others
(18). Both RAG+ and RAG
C3H and
BALB/c mice had severe inflammation characterized by tendonitis and
hyperproliferation of the tendon sheath. Large inflammatory infiltrates
of neutrophils and monocytes were present along with other histological
abnormalities, such as synovial hypertrophy and effusion. These
inflammatory changes were absent in slides from RAG+ and
RAG
B6 and DBA mice. These data demonstrate that the lack
of gross ankle swelling, indeed, correlates with the absence of
underlying inflammatory responses in the resistant mouse strains.
Occasionally, small foci of inflammatory cells were seen in some
resistant animals (e.g., DBA RAG
; Fig. 2), but these were
isolated and not comparable to the levels seen in C3H or BALB/c
animals. Histological assessment of arthritis severity was determined
in a blinded manner, and the results are shown in Table
1. Arthritis severity was scored on a
scale from 0 (no inflammation) to 3 (severe arthritis) (6).
There was a clear demarcation of arthritis severity scores between
resistant and susceptible mouse strains. Susceptible strains had
arthritis severity scores significantly greater than those of the
resistant strains (P < 0.001). Severity scores of the
B6 RAG
and B6 SCID mice were identical (B6
RAG
, 0.8 ± 0.6; B6 SCID, 0.8 ± 0.4).


View larger version (191K):
[in this window]
[in a new window]
|
FIG. 2.
Histopathology of tibiotarsal joints comparing
immunocompetent and immunodeficient mouse strains infected with 5 × 105 B. burgdorferi. Joints were obtained on
day 21 of infection. Paraffin sections were stained with hematoxylin
and eosin. Panels show development of tendonitis and are indicative of
levels of inflammatory infiltrates in the ankles as a whole. Arrows
point out foci of inflammatory cell infiltrates. Magnification, ×16.
|
|
View this table:
[in this window]
[in a new window]
|
TABLE 1.
Isolation of B. burgdorferi from selected
tissues and arthritis development in ankles of control and
immunodeficient micea
|
|
Arthritis resistance in BALB/c mice is related to their ability to
control spirochete numbers and is overcome by high infectious doses
(18) or immunodeficiency (6). In contrast, high
infectious doses and high levels of spirochetes in the ankles of DBA
and B6 mice do not result in the development of arthritis (13,
18). To determine if there were differences in spirochete
presence in tissues of control and immunodeficient mice, we harvested
blood, hearts, spleens, bladders, ears, and joints from
RAG+ and RAG
mice and cultured them in BSK
media for 2 weeks. There was widespread dissemination and high numbers
of positive cultures in all tissues tested (Table 1). There was little
difference between resistant and susceptible mouse strains in the
presence of spirochetes in tissues. Thus, resistance to arthritis
development in both the RAG+ and RAG
B6 and
DBA mice was not dependent upon their ability to limit spirochete
presence in tissues. Indeed, the greatest spirochetal burdens may have
been in the DBA RAG
and B6 RAG
mice because
they had high numbers of positive blood cultures (3 of 4 and 5 of 6 cultures were positive, respectively), while blood cultures from
RAG+ C3H (0 of 9), DBA (1 of 9), and B6 (0 of 2) mice were
negative or positive only at very low levels.
To directly compare spirochete burdens between mouse strains, we
performed competitive PCR on DNA isolated from the ankle joints and ear
punch circles 21 days after infection. We have previously shown that
high levels of spirochete DNA in the ankles of immunocompetent mice are
not sufficient to induce arthritis development in resistant animals
(13). The BC3 polycompetitor (13) was spiked into
samples to enable the relative assessment of borrelial DNA in ankle
tissues by using competitive PCR. Each reaction was spiked with a
constant amount of the BC3 competitor. The upper bands in each lane are
the BC3 amplification products, and the lower bands are wild-type DNA
PCR products. The amount of mammalian DNA used in each sample was
equalized by using primers for IL4pr. Results of the PCR analysis of
ankle tissue (Fig. 3A) demonstrate that
resistance to the development of experimental Lyme arthritis in
immunodeficient animals is not dependent upon limiting spirochetal
loads. Ankle tissue from the control C3H mouse contained the highest
level of spirochete DNA while the control DBA contained the lowest.
Arthritis-susceptible C3H RAG
and BALB/c
RAG
mice and arthritis-resistant B6 RAG
mice all contained similar levels of spirochete DNA in their ankle
joints which were intermediate between the control C3H and DBA levels.
We also examined spirochete DNA levels in ear punch samples from these
same animals (Fig. 3B). Although the ear punch samples had greater
animal-to-animal variability, there was no overall correlation between
levels of spirochete DNA and arthritis development. Thus, similar to
the results described for most immunocompetent animals (13,
18), arthritis development in immunodeficient mice does not
correlate with spirochete loads.

View larger version (61K):
[in this window]
[in a new window]
|
FIG. 3.
Competitive PCR amplification of ospA and
IL4pr from ankles (A) and ears (B) of control C3H and DBA
mice, immunodeficient (C3H RAG [C3H RAG°], BALB/c
RAG [BALB/c RAG°], and B6 RAG [B6
RAG°]) mice, a water blank (H2O), and an uninfected mouse (UN). Each
lane represents data from an individual mouse. Amplification products
in the upper bands are from the BC3 competitor and those in the lower
bands are from wild-type DNA. The amount of BC3 competitor spiked into
each sample was 0.25 pg.
|
|
 |
DISCUSSION |
This study demonstrates that resistance to experimental
Lyme arthritis development, at least in some strains of mice, can occur
in the absence of specific immunity. RAG+ and
RAG
B6 and DBA mice were resistant to arthritis
development following footpad inoculation of 5 × 105
B. burgdorferi spirochetes. In contrast, RAG+
and RAG
C3H and BALB/c mice developed severe arthritis in
their tibiotarsal joints. The development of arthritis in
RAG
B6 and DBA mice was not merely delayed, as these mice
were still resistant up to 5 weeks after infection. We recently
reported that high levels of spirochetes in the ankles of DBA mice do
not result in arthritis development (13), and similar
results have been reported for B6 mice (18). We now extend
those observations and demonstrate that B6 and DBA mice remain
resistant to arthritis development in the presence of high numbers of
spirochetes in tissues, even in the absence of specific immunity. Thus,
resistance and susceptibility may be the summation of a set of
inflammatory regulators rather than antimicrobial effector mechanisms.
Whether resistance of RAG
B6 and DBA mice is due to
genetic polymorphisms within the innate immune system is still unknown. Genes expressed within cells of the innate immune system are known to
influence resistance and susceptibility to several infectious diseases.
The murine Nramp1 gene (Bcg/Lsh/Ity) encodes an integral membrane protein on macrophages and determines the susceptibilities of
inbred mouse strains to such pathogens as Mycobacterium
leprae, Leishmania donovani, and Salmonella
typhimurium (12, 21, 25, 27). Its human homologue,
NRAMP1, has recently been shown to control susceptibility to leprosy in
humans (1). Bacterial endotoxins (lipopolysaccharides) are
potent activators of macrophages and monocytes and trigger the release
of many cytokines, including IL-1, IL-6, and tumor necrosis factor
alpha. These cytokines together can lead to toxic shock and death
(26). Mice from the C3H/HeJ inbred strain or mice deficient
in CD14 are resistant to the lethal effects of lipopolysaccharide
(14). Similarly, polymorphisms in the Lgn1 gene
on chromosome 13 control the natural resistance of macrophages of
inbred mouse strains to infection with Legionella pneumophila (11). The patterns of inbred mouse strains
with resistant and susceptible alleles to these genes do not correlate with patterns of resistance and susceptibility to Lyme arthritis development. Thus, other genes are responsible for resistance to
Borrelia. Interestingly, in a study of mice with a
granulocyte deficiency, B6 beige mice developed arthritis similar in
severity to C3H mice (8).
Increasing the infectious dose in B6 or DBA mice does not result in
increased arthritis incidence or severity; however, resistance to
arthritis development in BALB/c mice appears to require efficient bacterial control and/or clearance (13, 18). The mechanism of resistance in BALB/c mice may therefore differ from the mechanism controlling resistance of B6 and DBA mice. The finding of arthritis exacerbation in C3H SCID mice treated with anti-IL-12 indicates that NK
cells, macrophages, or other components of the innate immune system may
play an important role in resistance to the development of Lyme
arthritis (3). Whether resistance to Lyme arthritis
development is mediated through macrophages or other components of the
innate immune system is currently under investigation.
Our finding that immunodeficient B6 mice are resistant to arthritis
development contrasts with the results of Keane-Myers et al.
(17). In that study, B6 SCID mice infected subcutaneously (s.c.) in the base of the tail with B. burgdorferi 910255 developed ankle swelling and had high numbers of spirochetes in joints, hearts, and skin. The level of arthritis severity in these mice, however, was not reported. The reason for the different outcomes between these two studies is not clear. It is possible that B. burgdorferi 910255 or the s.c. route of infection causes ankle swelling without arthritis development in those animals. It is also
possible that the two strains of B. burgdorferi used have different levels of pathogenicity. In the present study, both B6 SCID
and B6 RAG
mice were highly resistant to arthritis
development following footpad injection of B. burgdorferi
N40 in at least five separate experiments. The B6 RAG
mice did have high levels of spirochetes in tissues as indicated by
culture and PCR, which agrees with the previous study (17), but no swelling or arthritis development was observed.
In conclusion, this study demonstrates that resistance to experimental
Lyme arthritis can occur in mice in the absence of specific immunity.
Thus polymorphisms, possibly in innate immunity, could be responsible
for both resistance and susceptibility to arthritis development.
Identification of the gene(s) and mechanism(s) involved may be
important not only for patients with Lyme disease but for patients with
other arthritides as well.
 |
ACKNOWLEDGMENTS |
We thank Daniel Brown and Erica Smith for their critical review
of the manuscript, and Jennifer Bird for technical assistance.
This work was supported by NIH grant AR 44042 and by the Burroughs
Wellcome Fund.
 |
FOOTNOTES |
*
Corresponding author. Mailing address: Gwen Knapp
Center for Lupus and Immunology Research, 924 E. 57th St., R422,
Chicago, IL 60637. Phone: (773) 702-4730. Fax: (773) 702-1576. E-mail: sreiner{at}midway.uchicago.edu.
Editor:
J. M. Mansfield
 |
REFERENCES |
| 1.
|
Abel, L.,
F. O. Sanchez,
J. Oberti,
N. V. Hoa,
V. D. Lap,
E. Skamene,
P. H. Lagrange, and E. Schurr.
1998.
Susceptibility to leprosy is linked to the human NRAMP1 gene.
J. Infect. Dis.
177:133-145[Medline].
|
| 2.
|
Anguita, J.,
D. H. Persing,
M. Rincon,
S. W. Barthold, and E. Fikrig.
1996.
Effect of anti-interleukin 12 treatment on murine Lyme borreliosis.
J. Clin. Investig.
97:1028-1034[Medline].
|
| 3.
|
Anguita, J.,
S. Samanta,
S. W. Barthold, and E. Fikrig.
1997.
Ablation of interleukin-12 exacerbates Lyme arthritis in SCID mice.
Infect. Immun.
65:4334-4336[Abstract].
|
| 4.
|
Barthold, S. W.,
D. S. Beck,
G. M. Hansen,
G. A. Terwilliger, and K. O. Moody.
1990.
Lyme borreliosis in selected strains and ages of laboratory mice.
J. Infect. Dis.
162:133-138[Medline].
|
| 5.
|
Barthold, S. W.,
D. H. Persing,
A. L. Armstrong, and R. A. Peeples.
1991.
Kinetics of Borrelia burgdorferi dissemination and evolution of disease after intradermal inoculation of mice.
Am. J. Pathol.
139:263-273[Abstract].
|
| 6.
|
Barthold, S. W.,
C. L. Sidman, and A. L. Smith.
1992.
Lyme borreliosis in genetically resistant and susceptible mice with severe combined immunodeficiency.
Am. J. Trop. Med. Hyg.
47:605-613.
|
| 7.
|
Barthold, S. W.,
M. S. de Souza,
J. L. Janotka,
A. L. Smith, and D. H. Persing.
1993.
Chronic Lyme borreliosis in the laboratory mouse.
Am. J. Pathol.
143:959-971[Abstract].
|
| 8.
|
Barthold, S. W., and M. de Souza.
1995.
Exacerbation of Lyme arthritis in beige mice.
J. Infect. Dis.
172:778-784[Medline].
|
| 9.
|
Barthold, S. W.,
M. de Souza, and S. Feng.
1996.
Serum-mediated resolution of Lyme arthritis in mice.
Lab. Investig.
74:57-67[Medline].
|
| 10.
|
Barthold, S. W.,
S. Feng,
L. K. Bockenstedt,
E. Fikrig, and K. Feen.
1997.
Protective and arthritis-resolving activity in serum of mice actively infected with Borrelia burgdorferi.
Clin. Infect. Dis.
25:S9-S17.
|
| 11.
|
Beckers, M. C.,
E. Ernst,
E. Diaz,
C. Morissette,
F. Gervais,
K. Hunter,
D. Housman,
S. Yoshida,
E. Skamene, and P. Gros.
1997.
High-resolution linkage map of mouse chromosome 13 in the vicinity of the host resistance locus Lgn1.
Genomics
39:254-263[Medline].
|
| 12.
|
Bradley, D. J.
1977.
Genetic control of Leishmania populations within the host. II. Genetic control of acute susceptibility of mice to L. donovani infection.
Clin. Exp. Immunol.
30:130-140[Medline].
|
| 12a.
| Brown, C. R. Unpublished observations.
|
| 13.
|
Brown, C. R., and S. L. Reiner.
1998.
Clearance of Borrelia burgdorferi may not be required for resistance to experimental Lyme arthritis.
Infect. Immun.
66:2065-2071[Abstract/Free Full Text].
|
| 14.
|
Haziot, A.,
E. Ferrero,
F. Kontgen,
N. Hijiya,
S. Yamamoto,
J. Silver,
C. L. Stewart, and S. M. Goyert.
1996.
Resistance to endotoxin shock and reduced dissemination of gram-negative bacteria in CD14-deficient mice.
Immunity
4:407-414[Medline].
|
| 15.
|
Kang, I.,
S. W. Barthold,
D. H. Persing, and L. K. Bockenstedt.
1997.
T-helper-cell cytokines in the early evolution of murine Lyme arthritis.
Infect. Immun.
65:3107-3111[Abstract].
|
| 16.
|
Keane-Myers, A., and S. P. Nickell.
1995.
Role of IL-4 and IFN- in modulation of immunity to Borrelia burgdorferi in mice.
J. Immunol.
155:2020-2028[Abstract].
|
| 17.
|
Keane-Myers, A.,
C. R. Maliszewski,
F. D. Finkelman, and S. P. Nickell.
1996.
Recombinant IL-4 treatment augments resistance to Borrelia burgdorferi infections in both normal susceptible and antibody-deficient susceptible mice.
J. Immunol.
156:2488-2494[Abstract].
|
| 18.
|
Ma, Y.,
K. P. Seiler,
E. J. Eichwald,
J. H. Weis,
C. Teuscher, and J. J. Weis.
1998.
Distinct characteristics of resistance to Borrelia burgdorferi-induced arthritis in C57BL/6N mice.
Infect. Immun.
66:161-168[Abstract/Free Full Text].
|
| 19.
|
Matyniak, J., and S. L. Reiner.
1995.
T helper phenotype and genetic susceptibility in experimental Lyme disease.
J. Exp. Med.
181:1251-1254[Abstract/Free Full Text].
|
| 20.
|
Rao, T. D., and A. B. Frey.
1995.
Protective resistance to experimental Borrelia burgdorferi infection of mice by adoptive transfer of a CD4+ T cell clone.
Cell. Immunol.
162:225-234[Medline].
|
| 21.
|
Robson, H. G., and S. I. Vas.
1972.
Resistance of inbred to Salmonella typhimurium in mice.
J. Infect. Dis.
126:378-386[Medline].
|
| 22.
|
Schaible, U. E.,
M. D. Kramer,
C. Museteanu,
G. Zimmer,
H. Mossmann, and M. M. Simon.
1989.
The severe combined immunodeficiency (scid) mouse: a laboratory model for analysis of Lyme arthritis and carditis.
J. Exp. Med.
170:1427-1432[Abstract/Free Full Text].
|
| 23.
|
Schaible, U. E.,
S. Gay,
C. Museteanu,
M. D. Kramer,
G. Zimmer,
K. Eichmann,
U. Museteanu, and M. M. Simon.
1990.
Lyme borreliosis in the severe combined immunodeficiency (scid) mouse manifests predominantly in the joint, heart, and liver.
Am. J. Pathol.
137:811-820[Abstract].
|
| 24.
|
Schaible, U. E.,
R. Wallich,
M. D. Kramer,
G. Nerz,
T. Stehle,
C. Museteanu, and M. M. Simon.
1994.
Protection against Borrelia burgdorferi infection in SCID mice is conferred by presensitized spleen cells and partially by B cells but not by T cells alone.
Int. Immunol.
6:671-681[Abstract/Free Full Text].
|
| 25.
|
Skamene, E.,
P. Gros,
A. Forget,
P. J. Patel, and M. Nesbitt.
1984.
Regulation of resistance to leprosy by chromosome 1 locus in the mouse.
Immunogenetics
19:117-120[Medline].
|
| 26.
|
Ulevitch, R. J., and P. S. Tobias.
1995.
Receptor-dependent mechanisms of cell stimulation by bacterial endotoxin.
Annu. Rev. Immunol.
13:437-457[Medline].
|
| 27.
|
Vidal, S. M.,
D. Malo,
K. Vogan,
E. Skamene, and P. Gros.
1993.
Natural resistance to infection with intracellular parasites: isolation of a candidate for Bcg.
Cell
73:469-485[Medline].
|
| 28.
|
Yang, L.,
J. H. Weis,
E. Eichwald,
C. P. Kolbert,
D. H. Persing, and J. J. Weis.
1994.
Heritable susceptibility to severe Borrelia burgdorferi-induced arthritis is dominant and is associated with persistence of large numbers of spirochetes in tissues.
Infect. Immun.
62:492-500[Abstract/Free Full Text].
|
Infection and Immunity, April 1999, p. 1967-1973, Vol. 67, No. 4
0019-9567/99/$04.00+0
Copyright © 1999, American Society for Microbiology. All rights reserved.
This article has been cited by other articles:
-
Miller, J. C., Ma, Y., Bian, J., Sheehan, K. C. F., Zachary, J. F., Weis, J. H., Schreiber, R. D., Weis, J. J.
(2008). A Critical Role for Type I IFN in Arthritis Development following Borrelia burgdorferi Infection of Mice. J. Immunol.
181: 8492-8503
[Abstract]
[Full Text]
-
Brown, C. R., Lai, A. Y.-C., Callen, S. T., Blaho, V. A., Hughes, J. M., Mitchell, W. J.
(2008). Adenoviral Delivery of Interleukin-10 Fails To Attenuate Experimental Lyme Disease. Infect. Immun.
76: 5500-5507
[Abstract]
[Full Text]
-
Iliopoulou, B. P., Alroy, J., Huber, B. T.
(2007). CD28 Deficiency Exacerbates Joint Inflammation upon Borrelia burgdorferi Infection, Resulting in the Development of Chronic Lyme Arthritis. J. Immunol.
179: 8076-8082
[Abstract]
[Full Text]
-
Crandall, H., Ma, Y., Dunn, D. M., Sundsbak, R. S., Zachary, J. F., Olofsson, P., Holmdahl, R., Weis, J. H., Weiss, R. B., Teuscher, C., Weis, J. J.
(2005). Bb2Bb3 Regulation of Murine Lyme Arthritis Is Distinct from Ncf1 and Independent of the Phagocyte Nicotinamide Adenine Dinucleotide Phosphate Oxidase. Am. J. Pathol.
167: 775-785
[Abstract]
[Full Text]
-
Behera, A. K., Hildebrand, E., Scagliotti, J., Steere, A. C., Hu, L. T.
(2005). Induction of Host Matrix Metalloproteinases by Borrelia burgdorferi Differs in Human and Murine Lyme Arthritis. Infect. Immun.
73: 126-134
[Abstract]
[Full Text]
-
Wang, X., Ma, Y., Weis, J. H., Zachary, J. F., Kirschning, C. J., Weis, J. J.
(2005). Relative Contributions of Innate and Acquired Host Responses to Bacterial Control and Arthritis Development in Lyme Disease. Infect. Immun.
73: 657-660
[Abstract]
[Full Text]
-
Brown, C. R., Blaho, V. A., Loiacono, C. M.
(2004). Treatment of Mice with the Neutrophil-Depleting Antibody RB6-8C5 Results in Early Development of Experimental Lyme Arthritis via the Recruitment of Gr-1- Polymorphonuclear Leukocyte-Like Cells. Infect. Immun.
72: 4956-4965
[Abstract]
[Full Text]
-
Liu, N., Montgomery, R. R., Barthold, S. W., Bockenstedt, L. K.
(2004). Myeloid Differentiation Antigen 88 Deficiency Impairs Pathogen Clearance but Does Not Alter Inflammation in Borrelia burgdorferi-Infected Mice. Infect. Immun.
72: 3195-3203
[Abstract]
[Full Text]
-
Glickstein, L., Moore, B., Bledsoe, T., Damle, N., Sikand, V., Steere, A. C.
(2003). Inflammatory Cytokine Production Predominates in Early Lyme Disease in Patients with Erythema Migrans. Infect. Immun.
71: 6051-6053
[Abstract]
[Full Text]
-
Aguilar-Delfin, I., Homer, M. J., Wettstein, P. J., Persing, D. H.
(2001). Innate Resistance to Babesia Infection Is Influenced by Genetic Background and Gender. Infect. Immun.
69: 7955-7958
[Abstract]
[Full Text]
-
Wang, G., Ojaimi, C., Iyer, R., Saksenberg, V., McClain, S. A., Wormser, G. P., Schwartz, I.
(2001). Impact of Genotypic Variation of Borrelia burgdorferi Sensu Stricto on Kinetics of Dissemination and Severity of Disease in C3H/HeJ Mice. Infect. Immun.
69: 4303-4312
[Abstract]
[Full Text]
-
Glickstein, L., Edelstein, M., Dong, J. Z.
(2001). Gamma Interferon Is Not Required for Arthritis Resistance in the Murine Lyme Disease Model. Infect. Immun.
69: 3737-3743
[Abstract]
[Full Text]
-
Diterich, I., Harter, L., Hassler, D., Wendel, A., Hartung, T.
(2001). Modulation of Cytokine Release in Ex Vivo-Stimulated Blood from Borreliosis Patients. Infect. Immun.
69: 687-694
[Abstract]
[Full Text]
-
Potter, M. R., Noben-Trauth, N., Weis, J. H., Teuscher, C., Weis, J. J.
(2000). Interleukin-4 (IL-4) and IL-13 Signaling Pathways Do Not Regulate Borrelia burgdorferi-Induced Arthritis in Mice: IgG1 Is Not Required for Host Control of Tissue Spirochetes. Infect. Immun.
68: 5603-5609
[Abstract]
[Full Text]
-
Brown, C. R., Reiner, S. L.
(2000). Bone-Marrow Chimeras Reveal Hemopoietic and Nonhemopoietic Control of Resistance to Experimental Lyme Arthritis. J. Immunol.
165: 1446-1452
[Abstract]
[Full Text]
-
Straubinger, R. K.
(2000). PCR-Based Quantification of Borrelia burgdorferi Organisms in Canine Tissues over a 500-Day Postinfection Period. J. Clin. Microbiol.
38: 2191-2199
[Abstract]
[Full Text]
-
Di Genaro, M. S., Munoz, E., Aguilera, C., de Guzman, A. M. S.
(2000). Yersinia enterocolitica O:8 and O:5 lipopolysaccharide arthritogenicity in hamsters. Rheumatology (Oxford)
39: 73-78
[Abstract]
[Full Text]
-
Brown, J. P., Zachary, J. F., Teuscher, C., Weis, J. J., Wooten, R. M.
(1999). Dual Role of Interleukin-10 in Murine Lyme Disease: Regulation of Arthritis Severity and Host Defense. Infect. Immun.
67: 5142-5150
[Abstract]
[Full Text]