Previous Article | Next Article 
Infection and Immunity, June 1999, p. 2996-3001, Vol. 67, No. 6
0019-9567/99/$04.00+0
Copyright © 1999, American Society for Microbiology. All rights reserved.
Construction of a Single-Chain
Interleukin-12-Expressing Retroviral Vector and Its Application in
Cytokine Gene Therapy against Experimental Coccidioidomycosis
Chengyong
Jiang,*
D.
Mitchell
Magee, and
Rebecca A.
Cox
Department of Clinical Investigation, Texas
Center for Infectious Disease, San Antonio, Texas 78223
Received 6 January 1999/Returned for modification 20 February
1999/Accepted 24 March 1999
 |
ABSTRACT |
T-cell-mediated immunity is an important determinant in protection
against primary infection with Coccidioides immitis, a dimorphic fungal pathogen that causes the disease coccidioidomycosis. To determine if interleukin-12 (IL-12) gene therapy could potentiate host response against C. immitis, we constructed a
single-chain cDNA encoding the p40 and p35 subunits linked by a
polylinker and, using a retroviral vector, transfected J774 macrophages
with the construct. The transduced J774 cells expressed IL-12 in vitro, with a mean concentration of 28,440 pg from 106 cells in 48 h as measured by an IL-12 (p75)-specific enzyme-linked immunosorbent
assay. The secreted IL-12 was biologically active, as judged by its
ability to induce the production of gamma interferon (IFN-
) by
spleen cells from BALB/c mice. Treatment of the highly susceptible
BALB/c mouse strain with the IL-12-transduced J774 cells inhibited
C. immitis growth in tissues from mice challenged by a
pulmonary route, as evidenced by 1.37-, 2.59-, and 1.22-log reductions
in the number of CFU in the lungs, spleens, and livers, respectively,
compared to the fungal load in mice given vector-transduced J774 cells.
The protective effect of IL-12 gene therapy was accompanied by
increased levels of IFN-
in the lungs and sera of mice treated with
IL-12-transduced J774 cells and the constitutive production of IFN-
by their spleen cells cultured in vitro. These results suggest that
IL-12 gene therapy could be used as adjunct therapy for coccidioidomycosis.
 |
INTRODUCTION |
Coccidioidomycosis is a mycotic
disease caused by the dimorphic fungus Coccidioides immitis.
The disease is endemic in the semiarid areas of Texas, Arizona, New
Mexico, and southern California. Primary infection is acquired by
inhalation of mycelial-phase arthroconidia, which enter the alveoli and
undergo a morphologic conversion into endosporulating spherules
(35). Coccidioidomycosis presents a diverse clinical
spectrum, ranging from benign, self-limited pulmonary infection to a
severe, progressive, and often lethal extrapulmonary dissemination.
Investigations in humans and experimentally infected animals have shown
strong T-cell reactivity to coccidioidal antigens in subjects with
controlled infection, whereas T-cell responses are depressed or
nondemonstrable in subjects with progressive, multifocal disease
(4, 6, 12-15, 26, 27). Recovery from primary asymptomatic
or benign infection with C. immitis confers lifelong
immunity to exogenous reinfection. The acquired resistance is
associated with the acquisition of a delayed-type hypersensitivity response and the production of T helper-1 (Th1)-associated cytokines, such as gamma interferon (IFN-
) and interleukin-2 (IL-2), to coccidioidal antigens (4, 6, 12-15, 26, 27).
IL-12, a heterodimeric Th1-promoting cytokine consisting of two
disulfide-bonded subunits of 35 and 40 kDa, has been shown to have
potent immunotherapeutic effects against tumor cells and a wide range
of microbial pathogens (7, 11, 16, 20, 28, 29, 40, 42, 43).
This cytokine has pleiotropic effects, including activation of
macrophages, augmentation of the cytolytic activity of NK and T cells,
and induction of the Th1-associated cytokines, notably IFN-
(38). In a previous study, we showed that IL-12 plays a
critical role in host defense against C. immitis (27). Treatment of the highly susceptible BALB/c mouse
strain with recombinant murine IL-12 (mIL-12) ameliorated the course of
the disease and enhanced production of IFN-
. Daily injections of 0.1 µg of the recombinant cytokine were required, however, to achieve
optimal therapeutic effects. Since gene therapy offers a means for
constitutive production of a protein in vivo, we engineered a
retroviral construct containing the cDNA encoding the p40 and p35
subunits of IL-12 as a single chain. Treatment of BALB/c mice with J774
macrophages that had been transduced with the single-chain IL-12
retroviral construct afforded a significant level of protection against
lethal pulmonary challenge with C. immitis and was
accompanied by increased production of IFN-
.
 |
MATERIALS AND METHODS |
Animal model.
Pathogen-free female BALB/c mice, 5 to 7 weeks
of age, were purchased from Jackson Laboratory (Bar Harbor, Maine) and
used throughout this study. These animals arrived in filtered cages and
were maintained for 1 more week before use.
Cell lines.
The J774A.1 (J774) and PA317 cell lines were
obtained from the American Type Culture Collection, Rockville, Md.
(ATCC TIB-67 and CRL-9078, respectively). The J774 cell line is a
BALB/c-derived reticulum cell sarcoma having macrophage-like properties
(30). The PA317 cell line was derived from NIH 3T3 TK
fibroblast cells. The cell lines were maintained at 37°C under 5%
CO2 in Dulbecco's modified Eagle's medium (DMEM; Gibco,
Grand Island, N.Y.), supplemented with 2 mM glutamine, 100 U of
penicillin/ml, 100 µg of streptomycin/ml, 4,500 mg of glucose/ml, and
10% fetal bovine serum (Atlanta Biological, Inc., Norcross, Ga.).
Cloning of single-chain murine IL-12 into retroviral vector.
The cDNAs for murine IL-12 p35 and p40 subunits were generously
provided by Ueli Gubler (Hoffmann-La Roche, Nutley, N.J.) (32). We introduced an XhoI site at the 5' end of
p40 and a BglII site at the 3' end of p35 by PCR
amplification, using synthetic oligonucleotide primers for p40 and p35,
with a polylinker on the 3' end of the p40 primer and the 5' end for
the p35 primer. The primers contained the following sequences (5' to
3'): for p40, upstream TCTAGAGGCTCGAGCCCCACCAT and
downstream
TGGAATGACCCTAGATCCGCCGCCACCCGACCCACCACCGCCCGAGCCACCGCCACCGGATCGGACCCT; and for p35, upstream
AGGGTCCGATCCGGTGGCGGTGGCTCGGGCGGTGGTGGGTCGGGTGGCGGCGGATCTAGGGTCATTCCA and downstream CGCTCTAGATCTAGTCGACCAATG. A 35-cycle
PCR was performed to amplify the p40 and p35 fragments by high-fidelity
PCR (Boehringer, Mannheim, Germany) under the following conditions:
94°C for 5 min; 94°C for 1 min, 55°C for 1.5 min, and 68°C for
1.5 min; and 72°C for 7 min. The single-chain PCR-amplified fragment
for mIL-12 was constructed by linkage of the p35 and p40 cDNA fragments
with the upstream primer of p40 and the downstream primer of p35 in a
second round of PCR (22). The 1.66-kb PCR fragment of mIL-12 was directly cloned into PCR 2.1 vector (TA cloning kit; Invitrogen, San Diego, Calif.) and sequenced to confirm the nucleotide sequence of
the adjacent subunit regions, linker, and the p40 and p35 coding regions. Thereafter, the single-chain cDNA of mIL-12 was ligated into
the pLXSN vector (Clontech, Palo Alto, Calif.). The pLXSN/p40.L
p35 construct, hereafter referred to as pLXSN/mIL-12, contains the gene
encoding neomycin resistance as a selectable marker. The immunopotentiating capacity of the pLXSN/mIL-12 construct was compared
with that of the pLXSN vector alone.
Cell transfection.
The pLXSN/mIL-12 construct was transduced
into the amphotropic packaging cell line PA317 by calcium phosphate
precipitation (Gibco). After a 72-h incubation, supernatants were
collected from the transduced cells and assayed for IL-12 by using the
p75 enzyme-linked immunosorbent assay (ELISA) procedures as described below. Transfectants were selected by culturing the cells for 2 weeks
in complete DMEM containing G418 (Gibco) at a concentration of 800 µg/ml. IL-12 viral particle-producing PA317 clones were identified by
reverse transcription (RT)-PCR (for both neomycin resistance gene and
IL-12 mRNAs) and by a p75 ELISA as described below. IL-12-producing
PA317 clones were expanded in DMEM, and virus-containing supernatant
was harvested and used to infect J774 macrophages.
Expression of bioactive IL-12 by transduced J774 cells.
To
test the ability of the pLXSN/mIL-12 constructs to induce the
expression of mIL-12, total RNA was isolated from 5 × 106 transduced J774 cells and assayed for IL-12 mRNA by
RT-PCR. PCR amplification was performed with primer pairs for
-actin
(Clontech), the neomycin resistance gene (41), and IL-12
(p40
p35 as described above) mRNA transcripts. Expression of IL-12 at
the protein level was determined by a sandwich ELISA devised
specifically to detect IL-12 p75. The capture antibody was a hamster
immunoglobulin G (IgG) anti-mIL-12 monoclonal antibody (Red-T;
PharMingen, San Diego, Calif.), which reacts with mIL-12 p35 and the
p75 heterodimer but not the p40 monomer. Captured IL-12 was detected by
the addition of biotinylated rat IgG2a anti-mIL-12 p40 (clone C17.8).
Recombinant mIL-12 (PharMingen) was used to prepare a standard curve.
The bioactivity of the secreted IL-12 was assayed by measuring its
ability to induce IFN-
production by spleen cells from nonimmune
mice. For these experiments, spleens were collected from normal BALB/c
mice and gently teased into single-cell suspensions. The spleen cell
suspension was treated with isotonic ammonium chloride to lyse
erythrocytes and, after being washed by centrifugation, the splenocytes
were resuspended in DMEM containing 10% fetal bovine serum. The cells
were dispensed into wells on a microtiter plate at a concentration of
2 × 106 mononuclear cells per well. The cell cultures
were incubated in medium alone or in medium containing a 1:10 dilution
of the supernatant from the IL-12-transduced J774 cells. After a 48-h incubation at 37°C under 5% CO2, supernatants were
collected for assays of IFN-
protein by a two-site sandwich ELISA by
using rat IgG1 anti-mouse IFN-
monoclonal antibodies from clones
R4-6A2 for capture and biotinylated XMG1.2 for detection (PharMingen) as previously reported (19). Recombinant mouse IFN-
(PharMingen) was used to establish a standard curve.
Infection of mice.
The procedure for infecting mice via a
pulmonary route has been detailed in an earlier report (13).
In brief, arthroconidia were harvested from 6- to 8-week-old
mycelial-phase cultures of C. immitis Silveira (ATCC 28868).
The arthroconidial suspension was passed over a nylon column to remove
hyphal elements, and the cells were enumerated by hemacytometer counts.
Pulmonary challenge was performed by intranasal instillation of 60 arthroconidia in 30 µl of physiologic saline.
Gene therapy.
J774 cells, transduced with pLXSN/mIL-12 or
with pLXSN alone, were administered via an intraperitoneal (i.p.) route
6 h after pulmonary challenge and again on days 1, 4, and 7. Control mice were treated in the same manner with saline alone. Mice
were sacrificed at day 12 after challenge, and the lungs, livers, and
spleens were collected, weighed, and homogenized. Serial dilutions of the homogenates were plated on mycobiotic medium (Difco Laboratories, Detroit, Mich.) for enumeration of fungal CFU.
To assess the effect of IL-12 gene therapy on the Th1 response in vivo,
mice treated with the pLXSN/mIL-12-transduced J774
cells,
vector-transduced J774 cells, or saline alone were sacrificed
at 12 days postinfection, and their serum, lungs, and spleens
were collected
for assays of IFN-

. Prior to assay, the lungs
were suspended in
sterile saline, homogenized in sterile Whirl-Pak
bags (American
Scientific Products, Dallas, Tex.), and filtered
through a
22-µm-pore-size membrane. The filtered lung homogenates
and the serum
samples were maintained at

70°C until assayed by
the ELISA
described above. For assays of IFN-

production by spleen
cells,
splenocytes (2 × 10
6) were incubated in tissue
culture medium alone or medium containing
concanavalin A (ConA, 2 µg;
Sigma Chemical Co., St. Louis, Mo.).
Forty-eight hours later, the
spleen cell supernatants were collected
and assayed for IFN-

by
ELISA.
Statistical analysis.
The statistical significance of
differential findings between experimental groups of animals was
determined by the nonparametric Mann-Whitney rank sum test. Findings
were regarded as significant if two-tailed P values were
<0.05.
 |
RESULTS |
Expression of bioactive mIL-12 in transduced cells.
Generation
of the functionally active IL-12 heterodimer requires the expression of
both the p40 and the p35 genes (21, 22, 32). Although this
can be achieved by simultaneously transfecting cells with two separate
plasmids encoding the p40 and p35 genes, excessive p40 expression has
been shown to lead to the inhibition of the bioactivities of IL-12 in
mice (9, 17). To avoid this potential problem, we generated
a single-chain construct containing both the p40 and the p35 genes
(32), connected by a 45-bp linker encoding 15 amino acids
(22), with the neomycin resistance gene as a selectable
marker. This polycistronic construct is depicted in Fig.
1.

View larger version (17K):
[in this window]
[in a new window]
|
FIG. 1.
Schematic representation of the retroviral construct
that carries both the p40 and p35 genes and the neomycin resistance
gene selectable marker. The p40 and p35 cDNAs were linked by a
(Gly4Ser)3 polylinker and were regulated by the
long terminal repeat (LTR) promoter. This plasmid vector, designated
pLXSN/mIL-12, was capable of coordinately expressing the p40, p35, and
neomycin resistance genes. CMV, cytomegalovirus; SV40, simian virus
40.
|
|
J774 cells were infected by coculture with viral
particle-containing supernatant from pLXSN/mIL-12-transduced
PA317 cells
or PA317 cells that had been transduced with the
pLXSN vector
alone. The transduced J774 cell clones were obtained after
a 2-week
selection with G418 and examined for expression of IL-12 at
both
the molecular and protein levels by RT-PCR and IL-12 ELISA,
respectively.
The results obtained by the RT-PCR assays are shown in
Fig.
2.
J774 cells transduced with
pLXSN/mIL-12 expressed mRNAs for both
full-length 1.66-kb IL-12 and the
0.68-kb neomycin resistance
gene, while vector-transduced J774 cells
expressed mRNA only for
the neomycin resistance gene. IL-12 was also
detected when the
supernatants from transduced J774 cells were assayed
by ELISA,
with a mean level of 28,440 pg from 10
6 cells in
48 h (Fig.
3A). The secreted IL-12
was bioactive, as
evidenced by the induction of 3,300 pg of IFN-

in
resting spleen
cells (Fig.
3B). These IL-12-transduced J774 cells have
constitutively
produced bioactive IL-12 for over 1 year and have
retained their
original morphology, growth pattern, and expression of
the cell
surface markers Mac-3, major histocompatibility complex class
I (MHC-I), and MHC-II, as measured by flow cytometry (data not
shown).

View larger version (48K):
[in this window]
[in a new window]
|
FIG. 2.
Expression of mRNA transcripts for -actin, the
neomycin resistance gene, and mIL-12 in pLXSN/mIL-12-J774 cells. Lanes
1, 2, and 3 depict the results obtained with cellular RNA obtained from
nontransduced J774 cells, J774 cells transduced with the pLXSN plasmid
vector alone, and J774 cells transduced with the pLXSN/mIL-12
construct, respectively.
|
|

View larger version (18K):
[in this window]
[in a new window]
|
FIG. 3.
Secretion of bioactive IL-12 from
pLXSN/mIL-12-transduced J774 cells. Supernatants were collected at
48 h from in vitro cultures of 106
pLXSN/mIL-12-transduced J774 cells and, for negative controls,
nontransduced and vector-transduced J774 cells. The supernatants were
assayed for IL-12 by ELISA (A) and for bioactive IL-12 (B) as measured
by the induction of IFN- production in (2 × 106)
spleen cells from normal BALB/c mice. Results are representative of
those obtained in at least two separate experiments.
|
|
Treatment of mice with IL-12-transduced J774 cells protects against
pulmonary challenge with C. immitis.
To examine the capacity
of IL-12-transduced J774 cells to protect mice against challenge,
BALB/c mice were infected with 60 arthroconidia via a pulmonary route
and then treated with 2 × 106 pLXSN/mIL-12-transduced
J774 cells or vector-transduced J774 cells. Twelve days after
challenge, the mice were sacrificed and examined for fungal CFU. The
results, depicted in Fig. 4, established that mice treated with pLXSN/mIL-12-transduced J774 macrophages showed
a significant decrease in the number of C. immitis CFU in
the lungs compared to the vector (P < 0.001) and
saline control groups (P < 0.001). Recipients of the
IL-12-transduced J774 cells also showed significant reductions in the
fungal load in their spleens (P < 0.0001) and livers
(P < 0.001).

View larger version (27K):
[in this window]
[in a new window]
|
FIG. 4.
Protection in BALB/c mice treated with
pLXSN/mIL-12-transfected J774 cells. Mice were infected with 60 arthroconidia via a pulmonary route and then treated with 2 × 106 IL-12-transduced or vector-transduced J774 cells via
the i.p. route. A third group of mice received saline alone. Treatments
were begun 6 h after pulmonary challenge and repeated on days 1, 4, and 7 after challenge. Twelve days postchallenge, the mice were
sacrificed and evaluated for C. immitis CFU in tissues. Bars
depict means ± standard errors obtained in two experiments
involving a total of 22 mice given saline alone, 23 mice treated with
vector-transduced J774 cells, and 21 mice given IL-12-transduced J774
cells.
|
|
It is perhaps noteworthy that mice given pLXSN/mIL-12-transduced J774
cells, but not those receiving vector-transduced cells,
showed marked
splenomegaly, with a greater-than-twofold increase
in weight compared
to spleens from mice treated with the vector-transduced
J774 cells.
This finding is consistent with a recent report by
Kim et al.
(
21) that mice given an IL-12 cDNA expression vector
showed
a level of splenomegaly that was comparable to that observed
in mice
given recombinant IL-12.
In vivo induction of Th1 response in mice given IL-12 gene
therapy.
The preceding results established that retroviral
vector-mediated IL-12 gene therapy effected a significant decrease in
the fungal load in the lungs, livers, and spleens of mice. To determine if this protection was accompanied by induction of IFN-
, mice treated with the IL-12-transduced J774 or nontransduced cells were
sacrificed 12 days after challenge, and their sera and lung homogenates
were assayed for IFN-
. As shown in Table
1, sera from mice treated with the
pLXSN/mIL-12-transduced J774 cells showed 1,580 pg of IFN-
per ml,
whereas no IFN-
was detected in sera from mice treated with the
vector-transduced J774 cells or saline. Likewise, the mean IFN-
level in lung homogenates from mice treated with the
pLXSN/mIL-12-transduced J774 cells was 1,300 pg/100 mg of tissue,
compared to 200 pg and <15 pg in lung tissue from mice treated with
the pLXSN vector or saline alone, respectively. Further proof that the
transduced J774 cells induced IFN-
production in vivo was evidenced
by our finding that spleen cells from mice treated with the
pLXSN/mIL-12-transduced J774 cells secreted 290 pg of IFN-
when
cultured in vitro in medium alone (Table
2). No IFN-
was detected when
splenocytes from mice given saline alone or vector-transduced J774
cells were incubated in medium alone. When the spleen cells were
assayed for IFN-
production in response to stimulation with ConA,
cells from recipients of IL-12-transduced J774 cells secreted 3,900 pg
compared to 60 and 160 pg by splenocytes from recipients of saline
alone or vector-transduced J774 cells, respectively. The decreased
production of IFN-
by ConA-stimulated spleen cells from the latter
two groups of mice is consistent with the immunosuppressive effect of
active coccidioidomycosis on Th1-associated responses (12, 13, 15,
26).
 |
DISCUSSION |
The results of this investigation demonstrate the efficacy of
IL-12 gene therapy with a genetically engineered single-chain IL-12
fusion construct created by linkage of the p35 and p40 genes with a
(Gly4Ser)3 polylinker. The monomeric nature of
this single-chain IL-12 fusion protein ensures equimolar expression of
each subunit, thereby avoiding the formation of p40 dimers which have
been shown to antagonize the activity of IL-12 (9, 17). The
bioactivity and efficacy of gene therapy with this construct were
examined by treating BALB/c mice, which are highly susceptible to
C. immitis (13), with J774 cells transduced with
the single-chain IL-12 construct. Recipients of the IL-12-transduced
J774 cells showed a reduced fungal load in their lungs, livers, and
spleens after pulmonary challenge and an increased production of the
Th1-associated cytokine IFN-
.
It is now clearly established that IL-12 plays a pivotal role in
orchestrating the immune response by amplifying cytokine networks
involved in the induction of Th1 cells while suppressing Th2 responses
(38). In murine studies, recombinant IL-12 has been shown to
prevent growth of a wide spectrum of tumors (7, 22, 29) and
to augment host resistance to several pathogens, including
Mycobacterium tuberculosis (11), Listeria
monocytogenes (40), Toxoplasma gondii
(20), Leishmania major (28),
Schistosoma mansoni (42), Histoplasma
capsulatum (43), Cryptococcus neoformans (16), and C. immitis (27). The
limitations of recombinant cytokine therapy include the need for daily
administrations, often with significant systemic toxicity (27,
45), and the inability to target the cytokine to a specific organ
or tissue site. To address these limitations, investigators have
focused on using gene transfer therapy for the in vivo production of
bioactive IL-12. This approach has proved to be highly effective as
evaluated in experimental tumor models (8, 9, 17, 21-23, 30, 36, 45) and infectious diseases (1, 10, 18, 37, 39, 44) and appears to be without toxicity.
We have previously reported that IL-12 has an essential role in host
defense against C. immitis (27). Administration
of 0.1 µg of recombinant IL-12 to susceptible BALB/c mice on the day
before pulmonary challenge with C. immitis and then daily for 12 days afterward resulted in a significant reduction in the fungal
load in the spleens and livers but not the lungs. Protection at the
lung level was not achieved even with the administration of a
10-fold-higher dose of the recombinant protein. These results and the
finding that mice treated with the higher dose showed toxic
manifestations, evidenced by ruffled fur, lethargy, and a marked
reduction in total body weight by 8 days postinfection (27),
led us to examine the efficacy of IL-12 gene therapy. In this
investigation, we used a single-chain IL-12 retroviral construct
expressed in J774 cells to provide a potent and stable delivery system
for bioactive IL-12. Treatment of BALB/c mice with the IL-12-expressing
J774 cells effected a reduction in the fungal load in tissues and
induced IFN-
production, as evidenced by increased levels of IFN-
in serum and lungs from treated mice 12 days after challenge with
C. immitis. The induction of IFN-
is an important
consequence of IL-12 gene therapy, since this cytokine has been shown
to activate macrophages to an anticoccidioidal level, both in vitro and
in vivo (5, 14).
The protective effect of IL-12 gene therapy has in other models been
shown to be attributable to the induction of the IFN-
by NK cells
and T lymphocytes and to the subsequent development of Th1 responses
(10, 11, 16, 36, 38-40, 42, 43). The in vivo elaboration of
IFN-
in the mice given IL-12-transduced J774 cells is consistent
with a role of IL-12 in the activation of antifungal host defense via
the induction of this Th1-associated cytokine. It is also possible that
the IL-12-transduced J774 macrophages themselves were activated to an
anticoccidioidal level via in situ expression of the IL-12 gene. We
chose to use the J774 cell line for delivery of the pLXSN/mIL-12
retroviral construct because investigators have shown that J774 cells
are highly effective for expressing retroviral vectors containing
mycobacterial genes (25, 33, 34). Although we did not
initially consider that IL-12 transduction of the J774 cells might
enhance their antimicrobial activity, this possibility should be
explored by comparing the anticoccidioidal effect of IL-12-transduced
J774 cells with that of IL-12-transduced cells of a nonmacrophage
lineage. Studies should also be done to examine the therapeutic
efficacy of IL-12-transduced dendritic cells, since dendritic cells
have been reported to be highly effective for expressing cytokine genes
in the therapy of cancer and infectious diseases (2, 3, 24,
31).
Cytokine gene therapy is a promising approach for inducing efficient
immune responses against infectious diseases. We have demonstrated the
feasibility of IL-12 gene therapy for the treatment of
coccidioidomycosis by retrovirally-transduced J774 cells. To our
knowledge, this study is the first to show that gene therapy with a
single-chain IL-12 fusion construct will induce protective immunity and
increase IFN-
production in a fungal disease. The results are
extremely encouraging and indicate that IL-12 gene therapy has
potential as adjunct therapy for coccidioidomycosis.
 |
ACKNOWLEDGMENTS |
This work was supported by grant AI32134 from the National
Institutes of Health.
We gratefully acknowledge Yiqiang Zhang and Teresa Quitugua for their
valuable assistance and advice in this study. We also thank Ueli Gubler
for graciously providing the plasmid for the mIL-12 p35 and p40 subunits.
 |
FOOTNOTES |
*
Corresponding author. Mailing address: Dept. of
Clinical Investigation, Texas Center for Infectious Disease, 2303 SE
Military Dr., San Antonio, TX 78223. Phone: (210) 534-8857. Fax: (210) 531-4550. E-mail: chengyong.jiang{at}tdh.state.tx.us.
Editor:
T. R. Kozel
 |
REFERENCES |
| 1.
|
Ahlers, J. D.,
N. Dunlop,
D. W. Alling,
P. L. Nara, and J. A. Berzofsky.
1997.
Cytokine-in-adjuvant steering of the immune response phenotype to HIV-1 vaccine constructs. Granulocyte-macrophage colony-stimulating factor and TNF- synergize with IL-12 to enhance induction of cytotoxic T lymphocytes.
J. Immunol.
158:3947-3958[Abstract].
|
| 2.
|
Ahuja, S. S.,
M. R. Brown,
T. A. Fleisher,
S. K. Ahuja, and H. L. Malech.
1996.
Autocrine activation of hemopoietic progenitor-derived myelo-monocytic cells by IFN- gene transfer.
J. Immunol.
156:4345-4353[Abstract].
|
| 3.
|
Ahuja, S. S.,
S. Mummidi,
H. L. Malech, and S. K. Ahuja.
1998.
Human dendritic cells (CD)-based anti-infective therapy: engineering dendritic cells to secrete functional IFN- and IL-12.
J. Immunol.
161:868-876[Abstract/Free Full Text].
|
| 4.
|
Ampel, N. M.,
G. C. Bejarano,
S. D. Salas, and J. N. Galgiani.
1992.
In vitro assessment of cellular immunity in human coccidioidomycosis: relationship between dermal hypersensitivity, lymphocyte transformation, and lymphokine production by peripheral blood mononuclear cells from healthy adults.
J. Infect. Dis.
165:710-715[Medline].
|
| 5.
|
Beaman, L.
1987.
Fungicidal activation of murine macrophages by recombinant gamma interferon.
Infect. Immun.
55:2951-2955[Abstract/Free Full Text].
|
| 6.
|
Beaman, L.,
D. Pappagianis, and E. Benjamini.
1977.
Significance of T cells in resistance to experimental murine coccidioidomycosis.
Infect. Immun.
17:580-585[Abstract/Free Full Text].
|
| 7.
|
Brunda, M. J.,
L. Luistro,
R. R. Warrier,
R. B. Wright,
B. R. Hubbard,
M. Murphy,
S. F. Wolf, and M. K. Gately.
1993.
Antitumor and antimetastatic activity of interleukin 12 against murine tumors.
J. Exp. Med.
178:1223-1230[Abstract/Free Full Text].
|
| 8.
|
Car, B. D.,
V. M. Eng,
B. Schnyder,
M. LeHir,
A. N. Shakhov,
G. Woerly,
S. Huang,
M. Aguet,
T. D. Anderson, and B. Ryffel.
1995.
Role of interferon- in interleukin 12-induced pathology in mice.
Am. J. Pathol.
147:1693-1707[Abstract].
|
| 9.
|
Chen, L.,
D. Chen,
E. Block,
M. O'Donnell,
D. W. Kufe, and S. K. Clinton.
1997.
Eradication of murine bladder carcinoma by intratumor injection of a bicistronic adenoviral vector carrying cDNAs for the IL-12 heterodimer and its inhibition by the IL-12 p40 subunit homodimer.
J. Immunol.
159:351-359[Abstract].
|
| 10.
|
Chow, Y.-H.,
B.-L. Chiang,
Y.-L. Lee,
W.-K. Chi,
W.-C. Lin,
Y.-T. Cheu, and M.-H. Tao.
1998.
Development of Th1 and Th2 populations and the nature of the immune responses to hepatitis B virus DNA vaccines can be modulated by codelivery of various cytokine genes.
J. Immunol.
160:1320-1329[Abstract/Free Full Text].
|
| 11.
|
Cooper, A. M.,
A. D. Roberts,
E. R. Rhoades,
J. E. Callahan,
D. M. Getzy, and I. M. Orme.
1995.
The role of interleukin-12 in acquired immunity to Mycobacterium tuberculosis.
Immunology
84:423-432[Medline].
|
| 12.
|
Corry, D. B.,
N. M. Ampel,
L. Christian,
R. M. Locksley, and J. N. Galgiani.
1996.
Cytokine production by peripheral blood mononuclear cells in human coccidioidomycosis.
J. Infect. Dis.
174:440-443[Medline].
|
| 13.
|
Cox, R. A.,
W. Kennell,
L. Boncyk, and J. W. Murphy.
1988.
Induction and expression of cell-mediated immune responses in inbred mice infected with Coccidioides immitis.
Infect. Immun.
56:13-17[Abstract/Free Full Text].
|
| 14.
|
Cox, R. A., and D. M. Magee.
1998.
Protective immunity in coccidioidomycosis.
Res. Immunol.
149:417-428[Medline].
|
| 15.
|
Cox, R. A., and J. R. Vivas.
1977.
Spectrum of in vivo and in vitro immune responses in coccidioidomycosis.
Cell. Immunol.
31:130-141[Medline].
|
| 16.
|
Decken, K.,
G. Kohler,
K. Palmer-Lehmann,
A. Wunderlin,
F. Mattner,
J. Magram,
M. K. Gately, and G. Alber.
1998.
Interleukin-12 is essential for a protective Th1 response in mice infected with Cryptococcus neoformans.
Infect. Immun.
55:4994-5000.
|
| 17.
|
Gillessen, S.,
D. Carvajal,
P. Ling,
F. J. Podlaski,
D. L. Stremlo,
P. C. Familletti,
U. Gubler,
D. H. Presky,
A. S. Stern, and M. K. Gately.
1995.
Mouse interleukin-12 (IL-12) p40 homodimer: a potent IL-12 antagonist.
Eur. J. Immunol.
23:200-206.
|
| 18.
|
Greenberger, M. J.,
S. Kunkel,
R. M. Strieter,
N. W. Lukacs,
J. Bramson,
J. Gauldie,
F. L. Graham,
M. Hitt,
J. M. Danforth, and T. J. Standiford.
1996.
IL-12 gene therapy protects mice in lethal Klebsiella pneumoniae.
J. Immunol.
157:3006-3012[Abstract].
|
| 19.
|
Jiang, C.,
D. M. Magee,
T. N. Quitugua, and R. A. Cox.
1999.
Genetic vaccination against Coccidioides immitis: comparison of vaccine efficacy of recombinant antigen 2 and antigen 2 cDNA.
Infect. Immun.
67:630-635[Abstract/Free Full Text].
|
| 20.
|
Johnson, L. L., and P. C. Sayles.
1997.
Interleukin-12, dendritic cells, and the initiation of host-protective mechanisms against Toxoplasma gondii.
J. Exp. Med.
186:1799-1802[Free Full Text].
|
| 21.
|
Kim, J. J.,
V. Ayyavoo,
M. L. Bagarazzi,
M. A. Chaattergoon,
K. Dang,
B. Wang,
J. D. Boyer, and D. B. Weiner.
1997.
In vivo engineering of a cellular immune response by coadministration of IL-12 expression vector with a DNA immunogen.
J. Immunol.
158:816-826[Abstract].
|
| 22.
|
Lieschke, G. J.,
P. K. Rao,
M. K. Gately, and R. C. Mulligan.
1997.
Bioactive murine and human interleukin-12 fusion proteins which retain antitumor activity in vivo.
Nat. Biotechnol.
15:35-40[Medline].
|
| 23.
|
Lotze, M. T.,
L. Zitvogel,
R. Campbell,
P. D. Robbins,
E. Elder,
C. Haluszczak,
D. Martin,
T. L. Whiteside,
W. J. Storkus, and H. Tahara.
1996.
Cytokine gene therapy of cancer using interleukin-12: murine and clinical trials.
Ann. N. Y. Acad. Sci.
795:440-454[Medline].
|
| 24.
|
Lotze, M. T.,
B. Hellerstedt,
L. Stolinski,
T. Tueting,
C. Wilson,
D. Kinzler,
H. Vu,
J. T. Rubin,
W. Storkus,
H. Tahara,
E. Elder, and T. Whiteside.
1993.
The role of interleukin-2, interleukin-12, and dendritic cells in cancer therapy.
Cancer J. Sci. Am.
3(Suppl.):S109-S114.
|
| 25.
|
Lowrie, D. B.,
R. E. Tascon,
M. J. Colston, and C. L. Silva.
1994.
Towards a DNA vaccine against tuberculosis.
Vaccine
12:1537-1540[Medline].
|
| 26.
|
Magee, D. M., and R. A. Cox.
1995.
Roles of gamma interferon and interleukin-4 in genetically determined resistance to Coccidioides immitis.
Infect. Immun.
63:3514-3519[Abstract].
|
| 27.
|
Magee, D. M., and R. A. Cox.
1996.
Interleukin-12 regulation of host defenses against Coccidioides immitis.
Infect. Immun.
64:3609-3613[Abstract].
|
| 28.
|
Murray, H. W., and J. Harisprashad.
1995.
Interleukin-12 is effective treatment for an established systemic intracellular infection: experimental visceral leishmaniasis.
J. Exp. Med.
181:387-391[Abstract/Free Full Text].
|
| 29.
|
Nastala, C. L.,
H. D. Edington,
T. G. McKinney,
H. Tahara,
M. A. Nalesnik,
M. J. Brunda,
M. K. Gately,
S. F. Wolf,
R. D. Schreiber, and W. J. Storkus.
1994.
Recombinant IL-12 administration induces tumor regression in association with IFN- .
J. Immunol.
153:1697-1705[Abstract].
|
| 30.
|
Ralph, P.,
J. Prichard, and M. Cohn.
1975.
Reticulum cell sarcoma: an effector cell in antibody-dependent cell-mediated immunity.
J. Immunol.
114:898-904[Abstract/Free Full Text].
|
| 31.
|
Reid, C. D.
1998.
The biology and clinical applications of dendritic cells.
Transfusion Med.
8:77-86[Medline].
|
| 32.
|
Schoenhaut, D. S.,
A. O. Chua,
A. G. Wolitzky,
M. Phyllis,
P. M. Quinn,
C. M. Dwyer,
W. McComas,
P. C. Familletti,
M. K. Gately, and U. Gubler.
1992.
Cloning and expression of murine IL-12.
J. Immunol.
148:3433-3440[Abstract].
|
| 33.
|
Silva, C. L., and D. B. Lowrie.
1994.
A single mycobacterial protein (hsp 65) expressed by a transgenic antigen-presenting cell vaccinates mice against tuberculosis.
Immunology
82:244-248[Medline].
|
| 34.
|
Silva, C. L.,
A. Palacios,
M. J. Colston, and D. B. Lowrie.
1992.
Mycobacterium leprae 65 hsp antigen expressed from a retroviral vector in a macrophage cell line is presented to T cells in association with MHC class II in addition to MHC class I.
Microb. Pathog.
12:27-38[Medline].
|
| 35.
|
Stevens, D. A.
1995.
Current concepts: coccidioidomycosis.
N. Engl. J. Med.
332:1077-1082[Free Full Text].
|
| 36.
|
Tahara, H.,
L. Zitvogel,
W. J. Storkus,
H. J. Zeh III,
T. G. McKinney,
R. D. Schreiber,
U. Gubler,
P. D. Robbins, and M. T. Lotze.
1995.
Effective eradication of established murine tumors with IL-12 gene therapy using a polycistronic retroviral vector.
J. Immunol.
154:6466-6474[Abstract].
|
| 37.
|
Tascon, R. E.,
M. J. Colston,
S. Ragno,
E. Stavropoulos,
D. Gregory, and D. B. Lowrie.
1996.
Vaccination against tuberculosis by DNA injection.
Nat. Med.
2:888-898[Medline].
|
| 38.
|
Trinchieri, G.
1995.
Interleukin-12: a proinflammatory cytokine with immunoregulatory functions that bridge innate resistance and antigen-specific adaptive immunity.
Annu. Rev. Immunol.
152:1883-1887.
|
| 39.
|
Tsuji, T.,
K. Hamajima,
J. Fukushima,
K. Q. Xin,
N. Ishii,
I. Aoki,
Y. Ishigatsubo,
K. Tani,
S. Kawamoto,
Y. Nitta,
J. Miyazaki,
W. C. Koff,
T. Okubo, and K. Okuda.
1997.
Enhancement of cell-mediated immunity against HIV-1 induced by coinoculation of plasmid-encoded HIV-1 antigen with plasmid expressing IL-12.
J. Immunol.
158:4008-4013[Abstract].
|
| 40.
|
Wagner, R. D.,
H. Steinberg,
J. F. Brown, and C. J. Czuprynski.
1994.
Recombinant interleukin 12 enhances resistance to mice to Listeria monocytogenes infection.
Microb. Pathog.
17:175-186[Medline].
|
| 41.
|
Westermann, J.,
A. Aicher,
Z. Qin,
Z. Cayeux,
K. Daemen,
T. Blankenstein,
B. Dorken, and A. Pezzutto.
1998.
Retroviral interleukin-7 gene transfer into human dendritic cells enhances T cell activation.
Gene Ther.
5:264-271[Medline].
|
| 42.
|
Wynn, T. A.,
D. Jankovic,
S. Hieny,
A. W. Cheever, and A. Sher.
1995.
IL-12 enhances vaccine-induced immunity to Schistosoma mansoni in mice and decreases T helper 2 cytokine expression, IgE production, and tissue eosinophilia.
J. Immunol.
154:4701-4709[Abstract].
|
| 43.
|
Zhou, P.,
M. C. Sieve,
J. Bennett,
K. J. Kwon-Chung,
R. P. Tewari,
R. T. Gazzinelli,
A. Sher, and R. A. Seder.
1995.
IL-12 prevents mortality in mice infected with Histoplasma capsulatum through induction of IFN- .
J. Immunol.
155:785-795[Abstract].
|
| 44.
|
Zhu, Z.,
N. Venkataprasad,
H. S. Thangaraj,
M. Hill,
M. Singh,
J. Ivanyi, and H. M. Vordermeier.
1997.
Functions and specificity of T cells following nucleic acid vaccination of mice against Mycobacterium tuberculosis infection.
J. Immunol.
158:5921-5926[Abstract].
|
| 45.
|
Zitvogel, L.,
H. Tahara,
P. D. Robbins,
W. J. Storkes,
M. R. Clarke,
M. A. Nalesnik, and M. T. Lotze.
1995.
Cancer immunotherapy of established tumors with IL-12. Effective delivery by genetically engineered fibroblasts.
J. Immunol.
155:1393-1403[Abstract].
|
Infection and Immunity, June 1999, p. 2996-3001, Vol. 67, No. 6
0019-9567/99/$04.00+0
Copyright © 1999, American Society for Microbiology. All rights reserved.
This article has been cited by other articles:
-
Cox, R. A., Magee, D. M.
(2004). Coccidioidomycosis: Host Response and Vaccine Development. Clin. Microbiol. Rev.
17: 804-839
[Abstract]
[Full Text]
-
Bermudez-Humaran, L. G., Langella, P., Cortes-Perez, N. G., Gruss, A., Tamez-Guerra, R. S., Oliveira, S. C., Cardenas, O. S., Montes de Oca-Luna, R., Le Loir, Y.
(2003). Intranasal Immunization with Recombinant Lactococcus lactis Secreting Murine Interleukin-12 Enhances Antigen-Specific Th1 Cytokine Production. Infect. Immun.
71: 1887-1896
[Abstract]
[Full Text]
-
Jiang, C., Magee, D. M., Ivey, F. D., Cox, R. A.
(2002). Role of Signal Sequence in Vaccine-Induced Protection against Experimental Coccidioidomycosis. Infect. Immun.
70: 3539-3545
[Abstract]
[Full Text]
-
Jiang, C., Magee, D. M., Cox, R. A.
(1999). Coadministration of Interleukin 12 Expression Vector with Antigen 2 cDNA Enhances Induction of Protective Immunity against Coccidioides immitis. Infect. Immun.
67: 5848-5853
[Abstract]
[Full Text]