Previous Article | Next Article 
Infection and Immunity, June 1999, p. 3073-3081, Vol. 67, No. 6
0019-9567/99/$04.00+0
Copyright © 1999, American Society for Microbiology. All rights reserved.
Chitinase Secretion by Encysting Entamoeba invadens
and Transfected Entamoeba histolytica Trophozoites:
Localization of Secretory Vesicles, Endoplasmic Reticulum, and
Golgi Apparatus
Sudip K.
Ghosh,1
Jessica
Field,1
Marta
Frisardi,1
Benjamin
Rosenthal,1
Zhiming
Mai,1
Rick
Rogers,2 and
John
Samuelson1,*
Department of Immunology and Infectious
Diseases1 and BioMedical Imaging
Institute,2 Harvard School of Public Health,
Boston, Massachusetts 02115
Received 8 October 1998/Returned for modification 10 November
1998/Accepted 23 February 1999
 |
ABSTRACT |
Entamoeba histolytica, the protozoan parasite that
phagocytoses bacteria and host cells, has a vesicle/vacuole-filled
cytosol like that of macrophages. In contrast, the infectious cyst form has four nuclei and a chitin wall. Here, anti-chitinase antibodies identified hundreds of small secretory vesicles in encysting E. invadens parasites and in E. histolytica trophozoites
overexpressing chitinase under an actin gene promoter.
Abundant small secretory vesicles were also identified with antibodies
to the surface antigen Ariel and with a fluorescent substrate of
cysteine proteinases. Removal of an N-terminal signal sequence directed
chitinase to the cytosol. Addition of a C-terminal KDEL peptide,
identified on amebic BiP, retained chitinase in a putative endoplasmic
reticulum, which was composed of a few vesicles of mixed sizes. A
putative Golgi apparatus, which was Brefeldin A sensitive and
composed of a few large, perinuclear vesicles, was identified with
antibodies to ADP-ribosylating factor and to
-COP. We conclude that
the amebic secretory pathway is similar to those of other eukaryotic cells, even if its appearance is somewhat different.
 |
INTRODUCTION |
Entamoeba histolytica is
a protozoan parasite that causes dysentery and liver abscess in
developing countries which cannot prevent its fecal-oral spread
(56). Amebae have three virulence-associated properties,
which are of interest to cell biologists (43). First, amebae
survive anaerobic conditions in the lumen of the colon and tissue
abscesses by means of fermentation enzymes that resemble those of
anaerobic bacteria (31, 48, 57, 60). Indeed, amebae lack
enzymes of oxidative phosphorylation and have an atrophic mitochondrion-derived organelle, which resembles the petite
mitochondria of yeast cells grown under anaerobic conditions (11,
20, 41). Second, amebae have a vesicle/vacuole-filled cytosol
like that of macrophages (63). Amebae phagocytose bacteria
in the colonic lumen and epithelial cells and erythrocytes (RBC)
when parasites invade tissues and cause dysentery (46, 56).
Third, amebae form a chitin-walled cyst, which is the infectious form
of the parasite, because cysts are resistant to stomach acids (5, 15).
Phagocytosis is the best studied of the amebic virulence mechanisms.
Parasites attach to bacteria, epithelial cells, and RBC via amebic
lectins, which recognize Gal or GalNAc sugars on the surface of target
cells (42, 45). Amebae kill bacteria or lyse host cells
within their phagolysosomes via oxygen-independent mechanisms including
lysozyme, cysteine proteases, and amebapores (also known as
pore-forming peptides) (8, 34, 64). Lysosomal proteins,
which have been identified in supernatants of cultured trophozoites,
include cysteine proteases, acid phosphatase, collagenases, glycosidases, and esterases but not pore-forming peptides (1, 35,
68). One cysteine proteinase (CP-5) is present on the surface
E. histolytica trophozoites but is absent from the surface of avirulent E. dispar (26). Amebic phagocytosis
is disrupted by wortmannin and by overexpression of hyperactive amebic
p21rac, a ras-family protein involved
in the site selection of actin polymerization (18, 23, 36).
In animal models, phagocytosis mutants of amebae, selected by
consumption of bromodeoxyuridine-loaded bacteria, are less virulent
than wild-type parasites (58).
Secretion by amebae is much less well understood than phagocytosis.
Amebae have on their surface vaccine candidates, including the Ser-rich
E. histolytica protein (SREHP) and Gal or GalNAc lectin,
which presumably get there when secretory vesicles fuse with the plasma
membrane (42, 45, 51, 52, 61, 67, 73). Small and large
subunits of the Gal or GalNAc lectin have signal sequences that are
cleaved at sites predicted by the "
3,
1" rule of von Heijne
(Table 1) (50). Signal
sequences as well as propeptide sequences are cleaved from pore-forming
peptides and cysteine proteases (Table 1) (8, 34). An
E. histolytica gene has been cloned that encodes a 54-kDa
peptide of the signal recognition particle, a ribonuclear protein that
binds N-terminal signal sequences on secreted proteins (55).
An amebic gene has also been cloned that encodes an endoplasmic
reticulum (ER) retention receptor (ERD2), a
cis-Golgi-associated transmembrane protein (62).
ERD2 binds C-terminal KDEL peptides on proteins such as the 70-kDa heat
shock protein BiP, which is a chaperonin in the lumen of the ER
(10, 22). We recently cloned the E. histolytica bip gene and confirmed that the predicted BiP has a C-terminal KDEL peptide (16a). Although amebae lack a Golgi with tight
lamellae, a putative Golgi was identified by confocal microscopy with
NBD-ceramide and by transmission electron microscopy with
thiamine-pyrophosphatase (44).
We recently used molecular cloning methods to identify amebic
chitinases, which are secretory proteins expressed by encysting parasites (14). Each amebic chitinase contains a series of
acidic and hydrophilic repeats between an N-terminal signal sequence and a C-half catalytic domain (50). As E. histolytica trophozoites are difficult to encyst in axenic
culture, cyst formation has for the most part been studied by using the
reptilian pathogen E. invadens, which converts to
chitin-walled cysts within 2 days when deprived of glucose
(15). During E. invadens cyst formation, chitin
synthase and chitinase are both expressed, and cyst formation is
inhibited by the chitin synthase inhibitors polyoxin D and Nikkomycin
and by the chitinase inhibitor allosamidin (6, 13, 72).
The goal of the present studies was to visualize structures involved in
secretion (secretory vesicles, ER, and Golgi) in amebic trophozoites
and encysting organisms. These studies were patterned after similar
studies of Giardia lamblia, a second intestinal protozoan
parasite, which forms cysts with an acid-resistant wall (19,
39). Secretory vesicles and Golgi apparatus of G. lamblia trophozoites (motile forms) are very difficult to
visualize. In contrast, secretory vesicles, which contain cyst wall
proteins, are so prominent in encysting giardia that they were given a
special name, encystation-specific vesicles or ESV (47).
Similarly, encysting G. lamblia show increased expression of
Golgi proteins and the ER-associated protein BiP (22, 37,
38). Here amebic secretory vesicles, putative ER, and putative
Golgi, which were visualized by the various probes presented in Table
2, were prominent in trophozoites, as well as in
encysting parasites (secretory vesicles and Golgi). Further, targeting
of chitinase in transfected parasites was modified by removal of an
N-terminal signal sequence or addition of a C-terminal, ER retention
peptide (KDEL).
 |
MATERIALS AND METHODS |
Parasites used and conditions for pinocytosis, phagocytosis, and
encystation.
The HM-1 strain of E. histolytica, from
which chitinase, ariel, arf, and
bip genes were identified, was used to study secretion in
amebic trophozoites (14, 40). The IP-1 strain of E. invadens, a generous gift of Dan Eichinger of New York University,
was used to study secretion during encystation (15).
E. histolytica and E. invadens were grown at 37 and 25°C, respectively, in the same axenic TYI-S33 medium.
Pinocytosis by
E. histolytica and
E. invadens was
observed by incubating trophozoites for 30 min with fluorescein
isothiocyanate
(FITC)-dextran (1 mg/ml) in culture medium
(
18). Amebae were
washed in phosphate-buffered saline (PBS),
fixed in 2% paraformaldehyde,
and passed through a
fluorescence-activated cell sorter (Becton
Dickinson). Negative
controls included paraformaldehyde-fixed
parasites not exposed to
FITC-dextran.
Phagocytosis by
E. histolytica and
E. invadens
was studied by using
Escherichia coli expressing recombinant
green fluorescent
protein (GFP) under an
isopropyl-

-
D-thiogalactopyranoside-inducible
promoter
(
70). Trophozoites (10
5/ml) were incubated in
culture medium with GFP-labeled bacteria
(10
7/ml) for 30 min and then fixed with 2% paraformaldehyde in PBS
(
18).
E. invadens encystation was induced by simultaneously
reducing the osmolarity, glucose, and serum in the cultures
(
15).
Encystating organisms after 1 to 3 days induction were
identified
in three ways: (i) observation of rounded organisms with a
refractile
wall, which were resistant to lysis in 1% Triton X-100;
(ii) staining
parasites with Calcofluor; or (iii) staining organisms
with anti-chitinase
antibodies (see below). To determine the effects of
various inhibitors
on cyst formation, we incubated
E. invadens in encysting medium
containing 100 µg of Brefeldin A
per ml, 0.3 µM okadoic acid,
or 100 nM wortmannin (
18,
25,
29).
Cloning of E. histolytica and E. invadens
arf genes.
Segments of the E. invadens and
E. histolytica arf genes were isolated from DNA of E. invadens IP-1 strain and E. histolytica HM-1:IMSS
strain genomic DNAs by using the PCR and degenerate primers to
conserved peptides in ADP-ribosylating factor (ARF) of other eukaryotes
(3, 21, 28, 32). A degenerate sense primer
[AGAAT(CT)(CT)T(AT) ATGGT(AT)GG] was to RILMVG,
while an antisense primer [GG(AT)A(AG)
(AG)TCTTGTTT(AG)TT(AT)(AG)CG] was to F(AV)NKQDL. PCR
products were cloned in TA-vector and sequenced by dideoxy methods. As
expected, the E. histolytica arf PCR product was more
AT-rich in the third position (89%) than the E. invadens arf PCR product (60%) (8, 14, 31, 36, 40, 53, 55, 60,
62). The predicted E. histolytica ARF was compared
with proteins in the GenBank database by using BLAST2 (2).
An alignment of ARF and ARF-like sequences was made by using PIMA-2,
and a neighbor-joining (NJ) tree was constructed by using Treecon
(66, 71). The reproducibility of the resulting topology was
determined by replicating the analysis on 100 bootstrap resamplings of
each alignment.
RT-PCR of arf, erd2, and
chitinase mRNAs of E. histolytica and E. invadens parasites.
Total RNA was extracted from E. histolytica trophozoites and from encysting E. invadens
by lysing organisms in saturated guanidinium and centrifuging the
lysate through a cesium chloride cushion. First-strand cDNA synthesis
was performed with E. histolytica RNA by using reverse
transcriptase (RT) and antisense primers specific for arf
(ATTTCTCATCTCATCTTC), erd2
(TCAATATGGCAAAACGAATTT), or chitinase
(TTAACATTTCTCAATTAG) genes (14, 62). PCRs were then performed with these antisense primers and sense primers specific
for E. histolytica arf (GGACTTGATGCTGCCGG),
erd2 (ATGGTGTTTAATCTTTTTAGA), and
chitinase (ATGTCACTACTGGCATTAAT) genes,
respectively. Controls included PCR without prior RT. RT-PCR was
performed in a similar manner with RNAs from encysting E. invadens by using sense (GTGACATCGTCCCAAGAA) and
antisense (GGGCACAGTACAGACAAA) primers to E. invadens
chitinase genes, and the same sense and antisense primers were
used to amplify E. histolytica arf cDNAs (14).
Sources of antibodies against chitinases, Ariel antigens, ADH1,
ARF, and
-COP.
E. histolytica and E. invadens
chitinases each have a series of degenerative repeats, which are
hydrophilic and acidic, between signal peptides and catalytic domains
(14). Because the chitinase repeats differ from each other,
two sets of rabbit polyclonal, monospecific anti-chitinase antibodies
were prepared (Table 2) (24). The first antibodies were
against a multiantigenic peptide (MAP) containing E. histolytica chitinase repeats (HESSEIKPDSSESKHESSEK). The second antibodies were against a MAP containing E. invadens chitinase repeats (PKPEESSEQPKPEESSEEKK).
Rabbit antibodies were purified on affinity columns containing
each chitinase MAP and checked against Western blots of amebic proteins.
Anti-Ariel antibodies were made by immunizing a rabbit with a
glutathione
S-transferase (GST) fusion protein containing
octapeptide
repeats from the Ariel 1 protein, an
E. histolytica surface protein
(
40,
65). Anti-alcohol
dehydrogenase 1 (ADH1) antibodies were
made by immunizing a rabbit with
a GST-ADH1 fusion protein (
31,
41). Anti-Ariel and anti-ADH1
antibodies were affinity purified
on columns made of each fusion
protein. Mouse ID9 monoclonal antibodies
to ARF, a Golgi-associated
coatomer protein, and polyclonal rabbit
antibodies to

-COP were a
generous gift of Victor Hsu of the
Brigham and Women's Hospital
(
4).
Expression of chitinase genes under an actin promoter
in transfected E. histolytica trophozoites.
E.
histolytica trophozoites, which do not encyst in axenic culture,
do not express their chitinase gene (14). To
identify secretory vesicles in E. histolytica trophozoites,
we expressed the E. histolytica chitinase gene in
transfected amebae under an E. histolytica actin 1 gene
promoter (Table 2) (17, 18). Briefly, the coding region of
the E. histolytica chitinase gene was isolated from genomic
DNA by PCR. The sense primer (S1 = GCGGTACCATGTCACTACTGGCATTAAT) contained a KpnI site (italics) and encoded the first
six amino acids at the amino terminus of the parasite's chitinase
(MSLLAL [underlined]). The antisense primer (A1 = GCGGATCCTTAACATTTCTCAATTAG) contained
a BamHI site (italics) and encoded five amino acids at the C
terminus of the organism's chitinase (LIEKC [underlined]). The
chitinase gene was cloned into the pJST4 amebic
transformation vector and electroporated into E. histolytica
HM-1 strain amebae (17). Parasites were step selected in 10 to 100 µg of G418 per ml (4 to 6 weeks), when the expression of
chitinase mRNA was checked by RT-PCR. Overexpression of intact
chitinase or modified chitinases (described below) had no effect on
amebic viability, growth rate, pinocytosis, or phagocytosis.
N-terminal signal sequences on amebic secretory, ER, or plasma membrane
proteins were identified by using the SignalP algorithm
at the website
of the Center for Biological Sequence Analysis
at the Technical
University of Denmark (Table
1) (
50). A truncated
E. histolytica chitinase gene encoding a chitinase lacking its
12-amino-acid signal sequence was made with the PCR (
14).
The
antisense primer was A1 (described above), while the sense primer
(GC
GGTACCATGGCTCACAACTGTGAAG)
contained a
BamHI site (italics)
and encoded Met and
Ala
13 to Glu
19. To determine whether a
C-terminal KDEL peptide would cause chitinase
to be retained in the
lumen of the ER of transfected parasites,
we made a modified
chitinase gene by using PCR. The sense primer
was S1
(described above), while the antisense primer
(GG
GGATCCTTA
AAGTTCATCTTTTAGACTCTTAATGTATTTTG)
contained a
BamHI site (italics) and encoded
KYIKSLKDEL (underlined)
at the C terminus of the chitinase
instead of the wild-type C-terminal
sequence (KYIKSLIEKC)
(
14). The truncated chitinase and the
chitinase-KDEL
PCR products were cloned into pJST4 and expressed
in amebae as
described
above.
As a control for localization of the ER, amebic BiP was overexpressed
with a myc tag in
E. histolytica trophozoites (
10,
16,
22,
38). The coding region of the
E. histolytica
bip gene was isolated from genomic DNA by using PCR. A sense
primer
(GC
GGTACCATGTTAACTTTCTTATTC)
contained a
KpnI site (italics) and
encoded the first
six amino acids at the amino terminus of the
parasite's BiP
(MLTFLF [underlined]). An antisense primer
(GC
GGATCCTTA
AAGTTCATCTTTTAAATCTTCTTCTGAAATTAATTTTTGTTCTTCATATTCTTCATAATT)
contained a
BamHI site (italics) and encoded the
C-terminal KDEL
(underlined), the myc epitope EQKLISEEDL
(boldface), and the BiP
hexapeptide NYEEYE adjacent to
the C terminus (not underlined).
The BiP constructs were cloned into
the pJST4 amebic transformation
vector and electroporated into
E. histolytica HM-1 strain amebae
as described
above.
Confocal microscopy.
To immunolocalize secretory proteins on
the surface of E. histolytica and E. invadens, we
fixed parasites with 2% paraformaldehyde for 10 min at 4°C. To
visualize secretory vesicles or Golgi-associated proteins, we
permeabilized amebae by incubation with 0.1% Triton X-100 for 5 min at
room temperature. Similar results were obtained when parasites were
permeabilized with 0.1% saponin. Amebae were immunostained for 60 min
with polyclonal rabbit antibodies to chitinases, Ariel, or
-COP,
diluted 1:100 or 1:200 in PBS with 1 mg of bovine serum albumin per ml
(24). Organisms were washed four times and immunodecorated
for 60 min with a Texas red-conjugated goat anti-rabbit antiserum.
Controls included parasites stained with preimmune rabbit serum.
Similar methods were performed with mouse monoclonal anti-ARF and
anti-myc antibodies, each diluted 1:200. Lysosomes were visualized by
incubating living parasites in Arg-Arg-4-methoxy-2-naphthylamide, a
substrate of cysteine proteinases that fluoresces when it is cleaved
(64). Fluorescently labeled parasites were observed with a
Leica NT-TCS confocal microscope fitted with argon and krypton lasers.
Images of amebae were recorded in 512 image size format with a ×40 or
×100 Planapo objective. The number of vesicles per ameba labeled with
anti-ARF, anti-
-COP, or anti-chitinase antibodies in parasites
transfected with the chitinase-KDEL construct was determined by making
serial optical sections through the parasites with the confocal
microscope. To illustrate some of these structures, composite figures
were made that combined multiple optical sections. The number of
secretory vesicles, which were identified with antibodies to intact
chitinase or Ariel, was too many to count accurately.
Nucleotide sequence accession numbers.
Nucleotide and
derived amino acid sequences of E. histolytica and E. invadens arf gene segments have been submitted to GenBank under
accession numbers AF082517 and AF082518.
 |
RESULTS |
Chitinase is an appropriate reporter protein for studying secretion
in transfected E. histolytica because it is not expressed
by trophozoites.
GFP, which is a popular epitope tag used to
localize proteins in living eukaryotic cells, does not work in
transfected amebae (unpublished observations) (54). This is
because GFP fluorescence is dependent upon the presence of free oxygen,
which is not present in amebic cultures. Amebic chitinase was chosen
here to study secretion in transfected trophozoites because chitinase
contains a series of antigenic repeats and is normally secreted by
encysting parasites (14). Chitinase mRNAs, detected by
RT-PCR, were present in extracts of encysting E. invadens
parasites but were absent in extracts of either E. histolytica or E. invadens trophozoites (Fig.
1). In contrast, mRNAs of the
Golgi-associated protein ARF were present in extracts of trophozoites
of E. histolytica and E. invadens and in
extracts of encysting E. invadens (Fig. 1 and see further
discussion below) (12). ERD2 mRNAs were also present in
extracts of E. histolytica trophozoites (Fig. 1)
(62).

View larger version (74K):
[in this window]
[in a new window]
|
FIG. 1.
RT-PCR of arf, erd2, and
chitinase (chit) mRNAs in nontransfected E. histolytica trophozoites and E. invadens encysting for
0 to 48 h. Ethidium staining of PCR products, separated on agarose
gels, was electronically reversed for ease of reproduction.
|
|
Chitinase-associated secretory vesicles in encysting E. invadens parasites are numerous and small.
Antibodies to
antigenic repeats of the E. invadens chitinase were used to
demonstrate hundreds of mostly small secretory vesicles in
encysting E. invadens parasites (Fig.
2 and Table 2) (14, 61). In
most cells, these chitinase-associated secretory vesicles were so
abundant that their exact number could not be determined. Chitinase was
also present in patches on the surface of encysting parasites.
Chitinase was absent from trophozoites, which lack detectable messages
for this gene (as above). The chitinase-associated vesicles of
encysting amebae are similar in their appearance to ESV previously
described in encysting G. lamblia (19, 39, 47).

View larger version (57K):
[in this window]
[in a new window]
|
FIG. 2.
Confocal micrographs of chitinase-associated secretory
vesicles of encysting E. invadens identified with
anti-chitinase antibodies. (A) Chitinase-associated secretory vesicles
were absent from trophozoites (data not shown) but were widely
distributed in amebae encysting for 24 h. (B) Anti-chitinase
antibodies in nonpermeabilized amebae mark secreted products on the
parasite surface. Bars, 5 µm.
|
|
When encysting parasites were incubated with FITC-dextran or
GFP-labeled bacteria prior to fixation and staining with anti-chitinase
antibodies, two results were apparent. First, parasites with many
chitinase-associated secretory vesicles, which were well into
encystation, pinocytosed much less FITC-dextran and phagocytosed
many
fewer bacteria than trophozoites. For example, after 24 h,
most
encysting parasites pinocytosed the same amount of FITC-dextran
as the
control parasites fixed before incubation with FITC-dextran
(data not
shown). After 24 h, most encysting parasites no longer
phagocytosed bacteria. Second, chitinase-associated secretory
vesicles
were not overlapping with pinosomes and phagosomes, so
double-staining
(orange vesicles) was rare or absent (data not
shown).
Secretory vesicles of E. histolytica trophozoites,
marked by anti-chitinase antibodies in transfected parasites, are
numerous and small like vesicles containing Ariel antigens or cysteine
proteinases.
Axenic amebae, which were transfected with an
unmodified chitinase gene under an actin gene
promoter, had numerous small chitinase-associated vesicles (Fig.
3 and Table 2). Again, these secretory
vesicles in most cells were too abundant to make an accurate count.
Double-labeling studies, which were performed with Texas red-labeled
chitinase and FITC-dextran or GFP-labeled E. coli, showed
that chitinase-associated vesicles did not fuse with pinocytotic or
phagocytotic vacuoles. Chitinase-associated secretory vesicles were
about the same size as lysosomes (identified with
Arg-Arg-4-methoxy-2-naphthylamide, a fluorescent substrate of the
cysteine proteases) (64). Because the signal from the
cysteine proteinase was present in both FITC and Texas red channels, it
was not possible to colocalize the lysosomes and the
chitinase-containing vesicles. Chitinase was absent from the surface of
transfected parasites (data not shown), suggesting that the surface of
trophozoites lacked chitin-binding activity present on the surface of
encysting parasites.

View larger version (23K):
[in this window]
[in a new window]
|
FIG. 3.
Confocal micrographs of E. histolytica
trophozoites transfected with their own chitinase gene under
an actin promoter. Anti-chitinase antibodies (red)
demonstrated secretory vesicles in transfected, fixed, and
permeabilized E. histolytica trophozoites. These vesicles
were independent of pinocytotic vacuoles marked with FITC-dextran
(green in panel A) or phagocytotic vacuoles marked with GFP-labeled
bacteria (green in panel B). Anti-chitinase antibodies failed to stain
the surface of nonpermeabilized, transfected parasites, thus
demonstrating that the enzyme is secreted and shed (data not shown).
Chitinase-associated vesicles were about the same size and abundance as
lysosomes, as marked by the fluorescent substrate
(Arg-Arg-4-methoxy-2-naphthylamide) of cysteine proteases (yellow in
panel C). Bars, 5 µm.
|
|
Vesicles containing the
E. histolytica surface antigen Ariel
were small and numerous and so most closely resembled
chitinase-associated
vesicles of encysting
E. invadens (Fig.
4 and Table
2) (
40).
Ariel
antigens were also present in phagocytotic vacuoles and
coated the
surface of nonpermeabilized
E. histolytica trophozoites.
A
similar appearance has been described for the vaccine candidate
SREHP,
which is encoded by a gene that belongs to the same superfamily
of
antigen-encoding genes as Ariel (
67).

View larger version (32K):
[in this window]
[in a new window]
|
FIG. 4.
Confocal micrographs of nontransfected E. histolytica trophozoites which were fixed, permeabilized, and
stained with antibodies to Ariel, a homologue of the vaccine candidate
SREHP. While most Ariel-associated secretory vesicles (red) were
independent of pinocytosed FITC-dextran (green in panel A), some
localized with phagocytotic vacuoles marked with GFP-labeled bacteria
(green in panel B). Anti-Ariel antibodies outlined the surface of
nonpermeabilized trophozoites (red in panel C). Bars, 5 µm.
|
|
Targeting of chitinase in transfected E. histolytica
parasites is changed when an N-terminal signal sequence is removed or a
C-terminal ER retention signal is added.
Amebic chitinase and
other secretory or plasma membrane proteins have at their N-termini
signal sequences, which fit the
3,
1 rule of von Heijne (Table 1)
(50). To test the necessity of the 12-amino-acid signal
sequence of the E. histolytica chitinase, we transfected
parasites with chitinase genes that encoded an intact
chitinase and a truncated chitinase lacking the signal sequence (Fig.
5 and Table 2). Anti-chitinase antibodies
demonstrated a vesicle-bright, cytosol-dark distribution of the intact
chitinase that was similar to that of Ariel. In contrast,
anti-chitinase antibodies demonstrated a reverse image of the truncated
chitinase, in which vesicles were dark and the cytosol was bright. This
cytosolic distribution, in which vesicles appear dark, like the holes
in Swiss cheese, was also demonstrated with antibodies to ADH1, an abundant amebic fermentation enzyme (31, 41).

View larger version (103K):
[in this window]
[in a new window]
|
FIG. 5.
Confocal micrographs of amebic secretory vesicles,
cytosol, and putative ER. (A) Intact chitinase was targeted in
transfected E. histolytica trophozoites to secretory
vesicles, which were small and numerous. (B) Similar vesicles were
visualized with anti-Ariel antibodies in nontransfected parasites. (C)
A truncated chitinase lacking an N-terminal signal sequence went to the
cytosol, which has dark vesicles against a bright background. (D) This
is the same appearance as that of nontransfected amebae stained with
antibodies to ADH1. (E) A modified chitinase with a C-terminal KDEL
peptide was retained in a putative ER, which was composed of many fewer
vesicles than the secretory vesicles marked by unmodified chitinase or
Ariel. (F) A similar pattern of staining was observed with myc-labeled
BiP, which is retained by its native C-terminal KDEL in the putative
ER. Bars, 5 µm.
|
|
To localize the amebic ER,
E. histolytica trophozoites were
transfected with construct which overexpressed BiP with a myc
epitope
tag (Fig.
5 and Table
2). Amebic BiP, which has a C-terminal
KDEL
peptide, should bind ERD2 receptors in the proximal Golgi
and be
retained in the ER (
10,
22,
62). myc-labeled BiP
was present
in a putative ER, which was composed of much fewer
(

20 per parasite)
vesicles than the secretory vesicles marked
by intact chitinase or
Ariel. To determine whether the KDEL peptide
is sufficient to retain
amebic proteins in the ER, we overexpressed
chitinase with a KDEL
peptide at its C terminus in
E. histolytica trophozoites.
Anti-chitinase antibodies demonstrated putative
ER-associated vesicles
in these parasites, which resembled those
identified with myc-labeled
BiP. The ER was not visualized in
encysting
E. invadens
because transfection methods have not been
developed for these
parasites.
E. histolytica and E. invadens arf genes
encode a conserved Golgi-associated coatomer protein (COP) called ARF.
To better understand the role of Golgi apparatus in secretion by
amebic trophozoites and encysting parasites, we used the PCR and
degenerate primers to conserve peptides in other ARF to clone segments
of E. invadens and E. histolytica arf genes (Fig. 6) (3, 21, 28, 32). The
predicted 113-amino-acid open reading frame (ORF) of the amebic
arf genes, which encode about two-thirds of the expected
20-kDa ARF proteins, showed 96% positional identity with each other
and 76 to 88% positional identities with other eukaryotic ARFs.
Perfectly conserved in the amebic ARFs were guanine
nucleotide-binding domains, including the pyrophosphate-binding loop (GLDAAGKT), switch region (DVGG), and
guanine recognition motif (NKQD) (3, 21). In NJ trees,
amebic ARF was easily distinguished from ARF-like proteins of
parasites or humans (Fig. 7)
(71).

View larger version (32K):
[in this window]
[in a new window]
|
FIG. 6.
ARF alignment. Predicted ORF of a segment of the
E. histolytica (Eh) arf gene aligned
with ARF segments of E. invadens (Ei), G. lamblia (Gl; GenBank accession number S29008),
Plasmodium falciparum (Pf, U57370),
Dictyostelium discoideum (Dd; AJ000063),
Saccharomyces cerevisiae (Sc; M35158), and
Bos taurus (Bt; A45422). Dashes indicate
identities with the E. histolytica ARF, while periods
indicate gaps. Vertical boxes indicate locations of conserved
pyrophosphate-binding loop (GLDAAGKT), switch region (DVGG), and
guanine-recognition motif (NKQD) (3, 34).
|
|

View larger version (9K):
[in this window]
[in a new window]
|
FIG. 7.
NJ tree of ARF shown in Fig. 6 as well as ARF of
Xenopus laevis (Xl; GenBank accession number
U31350), Drosophila melanogaster [Dm(A);
S62079], Cryptococcus neoformans (Cn; L25115),
and Schizosaccharomyces pombe (Sp; L09551), and ARF-like
proteins of D. melanogaster [Dm(AL); A40438],
Homo sapiens (Hs; L28997), P. falciparum [Pf(AL); U57370], and Leishmania
tarentolae (Lt; X97072). Branch lengths are
proportional to differences between adjacent sequences, while numbers
at each node indicate the extent of bootstrap support (of 100 replicates). Unmarked nodes occurred in fewer than 50 replicates.
|
|
The amebic Golgi and encystation are disrupted by Brefeldin A and
okadoic acid.
As discussed above, RT-PCR showed that mRNAs
that encode the Golgi-associated protein ARF and the ER-retention
receptor (ERD2) are expressed by E. histolytica
trophozoites (Fig. 1) (12, 62). ARF was also
expressed by E. invadens trophozoites and encysting E. invadens (Fig. 1). Anti-ARF antibodies identified a
stage-independent, putative Golgi apparatus, which was composed of a
few large perinuclear vesicles (5 to 20 per cell) (Fig.
8). Similar Golgi-associated vesicles
were identified with antibodies to
-COP (Fig.
9). This putative Golgi apparatus was
disrupted into tiny vesicles Brefeldin A, which targets the GTPase of
ARF (29). Brefeldin A also reduced the number of E. invadens parasites that encyst by 60%. Okadoic acid, which
targets protein phosphatases and disrupts trans-Golgi of
eukaryotic cells, disrupted the amebic Golgi and eliminated encystation
completely (25). Wortmannin, which targets
phosphoinositide 3-kinases and eliminates amebic pinocytosis and
phagocytosis, also eliminated encystation (18).
Previously, an amebic Golgi was seen with NBD-ceramide (as seen by
fluorescence microscopy) and thiamine-pyrophosphatase (as seen by
electron microscopy) (44).

View larger version (64K):
[in this window]
[in a new window]
|
FIG. 8.
Confocal micrographs of E. invadens parasites
stained with heterologous anti-ARF antibodies. (A) ARF was present in
large vesicles (presumed Golgi apparatus) surrounding the nucleus of
trophozoites. (B) The ARF-stained vesicles of trophozoites were
disrupted by Brefeldin A. (C) The Golgi apparatus of encysting
parasites was similar when stained with anti-ARF. Micrographs shown in
panels A and B represent a single section each, while the micrograph in
panel C is a composite of multiple sections. Bars, 5 µm.
|
|

View larger version (34K):
[in this window]
[in a new window]
|
FIG. 9.
Confocal micrographs of E. histolytica and
E. invadens parasites stained with antibodies to
Golgi-associated coatomer protein -COP. Vesicles that contain
-COP were relatively few and large in trophozoites of E. histolytica (A), trophozoites of E. invadens (B), or
encysting E. invadens (C). The micrograph shown in panel A
represents a single section, while the micrographs in panels B and C
are each composed of multiple sections. Bars, 5 µm.
|
|
 |
DISCUSSION |
These are the first arf genes identified in amebae, and
this is the first use of transfection methods to localize amebic
proteins and the first experimental demonstration of N-terminal
signal and C-terminal ER retention sequences. Roughly
drawn, the amebic cytosol is composed of small vesicles, which
include those of the putative ER, secretory vesicles, lysosomes,
pinocytotic vacuoles, and large vesicles, which include those of the
putative Golgi and phagocytotic vacuoles.
Conservation of secretory apparatus and protein-targeting sequences
in amebae.
Perhaps because amebae have such prominent pinosomes,
phagosomes, and lysosomes, secretory structures of the parasite were not obvious in the absence of the specific probes used here (Table 2)
(18, 43, 63). Chitinase expression in transfected parasites was used to show that amebic N-terminal signal sequences and C-terminal ER retention signals appear to follow the same rules as those established for higher eukaryotes (50, 61, 62). Indeed the
3,
1 rule appears to hold for all signal sequences of amebic secretory and plasma membrane proteins which have been identified to
date (Table 1). The amebic Golgi and encystation were disrupted by
Brefeldin A and okadoic acid, which disrupt the Golgi of higher eukaryotes (25). Disruption of the G. lamblia
Golgi, which is encystation specific, also inhibits cyst formation
(37).
Unique properties of the amebic secretory pathway.
Amebic
secretion is different from that of higher eukaryotes in at least four
ways. First, the putative amebic Golgi apparatus does not form tightly
packed lamellae but instead forms a few large vesicles, which are
adjacent to the nucleus (12, 44, 79). This is similar to the
Golgi of G. lamblia, whereas Tritrichomonas foetus, another lumenal parasite, has a Golgi with tight lamellae (19, 37). Second, an amebic protein disulfide isomerase
(PDI) lacks a C-terminal KDEL peptide, which usually retains other PDI in the ER (27). Third, a sharp distinction between amebic
lysosomes and secretory vesicles has not yet been made (63).
Fourth, signals that direct amebic proteins to the lysosomes cannot be
the same as those of higher eukaryotes. Amebic lysosomal proteins lack signals for Asn-linked glycosylation, which is necessary for the addition of mannose-6-phosphates that might bind to lysosomal receptors
(30, 61, 69). We are presently performing experiments to
distinguish secretory vesicles from lysosomes and to identify signals
that target amebic proteins to lysosomes. We plan to use immunoelectron
microscopy to visualize amebic secretory vesicles, putative ER, and
putative Golgi.
Implications of these findings for our understanding of amebic
virulence.
Four implications of these data may be important in
understanding amebic virulence. First, the secretory apparatus, which targets proteins to the plasma membrane of amebic trophozoites, likely
releases numerous proteins into the medium, even though to date only
lysosomal enzymes have been identified in amebic supernatants (1,
35, 68). Second, the
3,
1 algorithm might be used to identify
secretory proteins in EST databases of amebic trophozoites or encysting
parasites (50). Third, ARF in the cytosol of amebae may
activate cholera toxin in individuals who are coinfected with
Vibrio cholerae and amebae (49). Other targets for bacterial toxins previously identified in amebae include elongation factor 2 (diphtheria and pseudomonas toxins) and Ras-superfamily proteins (clostridial toxins) (36, 53). Fourth,
stage-independent Golgi and ER in amebae suggest that these parasites
may be susceptible to bacterial toxins, which enter the cytosol through
the Golgi or ER (49).
Changing image of amebae and other lumenal parasites: from
primitive to divergently evolved.
Lumenal parasites
(E. histolytica, G. lamblia, and
Trichomonas vaginalis) branched early from the main
eukaryotic tree, lack mitochondria and enzymes of oxidative
phosphorylation, and have fermentation enzymes like those of bacteria
(31, 33, 48, 57). These observations led to the idea that
these microaerophilic parasites are "primitive" or living fossils
from a time before eukaryotic cells were exposed to oxygen and captured
the mitochondrial endosymbiont (7, 20, 57). The experiments
described here show the similarity of the amebic secretory pathway to
those of other eukaryotic cells, even if its appearance is somewhat
different. Further, amebae, giardias, and trichomonads each have a gene
encoding a homologue of the mitochondrial 60-kDa heat shock protein
(Hsp60) (9, 11, 59). The presence of Hsp60 genes in
"amitochondriate" parasites strongly suggests that all extant
eukaryotes share a common ancestor that had a mitochondrion
(20). In trichomonads, the mitochondrion-derived organelle
was converted over time into a fermentation factory called the
hydrogenosome (9, 48). The function of an atrophic
mitochondrion-derived organelle of amebae is not known, while a
mitochondrion-derived organelle has not yet been identified in giardias
(41, 59).
 |
ACKNOWLEDGMENTS |
This work was supported in part by National Institutes of Health
grants AI-33492 and GM-31318 (to J.S.) and grants HL-330099 and
HL-43510 (to R.R.).
We acknowledge the expert technical support of Jean Lai for confocal
microscopy and image analysis.
 |
FOOTNOTES |
*
Corresponding author. Mailing address: Department of
Immunology and Infectious Diseases, Harvard School of Public Health, 665 Huntington Ave., Boston, MA 02115. Phone: (617) 432-4670. Fax:
(617) 738-4914. E-mail: jsamuels{at}hsph.harvard.edu.
Editor:
S. H. E. Kaufmann
 |
REFERENCES |
| 1.
|
Agrawal, A.,
V. C. Pandey,
S. Kumar, and P. Sagar.
1989.
Secretion of acid phosphatase by axenic Entamoeba histolytica NIH-200 and properties of the extracellular enzyme.
J. Protozool.
36:90-92[Medline].
|
| 2.
|
Altschul, S. F.,
T. L. Madden,
A. A. Schaffer,
J. Zhang,
Z. Zhang,
W. Miller, and D. J. Lipman.
1997.
Gapped BLAST and PSI-BLAST: a new generation of protein database search programs.
Nucleic Acids Res.
25:3389-3402[Abstract/Free Full Text].
|
| 3.
|
Amor, J. C.,
D. H. Harrison,
R. A. Kahn, and D. Ringe.
1994.
Structure of the human ADP-ribosylation factor 1 complexed with GDP.
Nature
372:704-708[Medline].
|
| 4.
|
Aoe, T.,
E. Cukierman,
A. Lee,
D. Cassel,
P. J. Peters, and V. W. Hsu.
1997.
The KDEL receptor, ERD2, regulates intracellular traffic by recruiting a GTPase-activating protein for ARF1.
EMBO J.
16:7305-7316[Medline].
|
| 5.
|
Arroyo-Begovich, A., and A. Carbez-Trejo.
1982.
Location of chitin in the cyst wall of Entamoeba invadens with the colloidal gold tracers.
J. Parasitol.
68:253-258[Medline].
|
| 6.
|
Avron, B.,
R. M. Deutsch, and D. Mirelman.
1982.
Chitin synthesis inhibitors prevent cyst formation by trophozoites.
Biochem. Biophys. Res. Commun.
108:815-821[Medline].
|
| 7.
|
Bakker-Grunwald, T., and C. Wostmann.
1993.
Entamoeba histolytica as a model for the primitive eukaryotic cell.
Parasitol. Today
9:27-31.
[Medline] |
| 8.
|
Bruchhaus, I.,
T. Jacobs,
M. Leippe, and E. Tannich.
1996.
Entamoeba histolytica and Entamoeba dispar. Differences in numbers and expression of cysteine proteinase genes.
Mol. Microbiol.
22:255-263[Medline].
|
| 9.
|
Bui, E. T. N.,
P. J. Bradley, and P. J. Johnson.
1996.
A common evolutionary origin for mitochondria and hydrogenosomes.
Proc. Natl. Acad. Sci. USA
93:9651-9656[Abstract/Free Full Text].
|
| 10.
|
Bukau, B., and A. L. Horwich.
1998.
The Hsp70 and Hsp60 chaperone machines.
Cell
92:351-366[Medline].
|
| 11.
|
Clark, C. G., and A. J. Roger.
1995.
Direct evidence for secondary loss of mitochondria in Entamoeba histolytica.
Proc. Natl. Acad. Sci. USA
92:6518-6521[Abstract/Free Full Text].
|
| 12.
|
Cosson, P., and F. Letourneur.
1997.
Coatomer (COPI)-coated vesicles: role in intracellular transport and protein sorting.
Curr. Opin. Cell Biol.
9:484-487[Medline].
|
| 13.
|
Das, S., and F. D. Gillin.
1991.
Chitin synthase in encysting Entamoeba invadens.
Biochem. J.
280:641-647.
|
| 14.
|
de la Vega, H.,
C. A. Specht,
C. E. Semino,
P. W. Robbins,
D. Eichinger,
D. Caplivski,
S. Ghosh, and J. Samuelson.
1997.
Cloning and expression of chitinases of Entamoebae.
Mol. Biochem. Parasitol.
85:139-147[Medline].
|
| 15.
|
Eichinger, D.
1997.
Encystation of entamoeba parasites.
Bioessays
19:633-639[Medline].
|
| 16.
|
Evan, G. I.,
G. K. Lewis,
G. Ramsay, and J. M. Bishop.
1985.
Isolation of monoclonal antibodies specific for human c-myc proto-oncogene product.
Mol. Cell. Biol.
5:3610-3616[Abstract/Free Full Text].
|
| 16a.
| Field, J., and J. Samuelson. Unpublished
observations.
|
| 17.
|
Ghosh, S. K.,
A. Lohia,
A. Kumar, and J. Samuelson.
1996.
Overexpression of P-glycoprotein gene 1 by transfected Entamoeba histolytica confers emetine-resistance.
Mol. Biochem. Parasitol.
82:257-260[Medline].
|
| 18.
|
Ghosh, S., and J. Samuelson.
1997.
Inhibition of phagocytosis, cytokinesis, and capping by overexpression of mutated p21racA in cultured Entamoeba histolytica.
Infect. Immun.
65:4243-4249[Abstract].
|
| 19.
|
Gillin, F. D.,
D. S. Reiner, and J. M. McCaffery.
1996.
Cell biology of the primitive eukaryote Giardia lamblia.
Annu. Rev. Microbiol.
50:679-705[Medline].
|
| 20.
|
Gray, M. W.
1989.
The evolutionary origins of organelles.
Trends Genet.
5:294-299[Medline].
|
| 21.
|
Greasley, S. E.,
H. Jhoti,
C. Teahan,
R. Solari,
A. Fensome,
G. M. Thomas,
S. Cockcroft, and B. Bax.
1995.
The structure of rat ADP-ribosylation factor-1 (ARF-1) complexed to GDP determined from two different crystal forms.
Nat. Struct. Biol.
2:797-806[Medline].
|
| 22.
|
Gupta, R. S.,
K. Aitken,
M. Fala, and B. Singh.
1994.
Cloning of Giardia lamblia heat shock protein HSP70 homologs: implications regarding the origin of eukaryotic cells and of endoplasmic reticulum.
Proc. Natl. Acad. Sci. USA
91:2895-2899[Abstract/Free Full Text].
|
| 23.
|
Hall, A.
1994.
Small GTP-binding proteins and the regulation of the actin cytoskeleton.
Annu. Rev. Cell Biol.
10:31-54.
|
| 24.
|
Harlow, E., and D. Lane.
1988.
Antibodies: a laboratory manual.
Cold Spring Harbor Press, Cold Spring Harbor, N.Y.
|
| 25.
|
Horn, M., and G. Banting.
1994.
Okadoic acid treatment leads to fragmentation of the trans-Golgi network and an increase in expression of TGN38 at the cell surface.
Biochem. J.
301:69-73.
|
| 26.
|
Jacobs, T.,
I. Bruchhaus,
T. Dandekar,
E. Tannich, and M. Leippe.
1998.
Isolation and molecular characterization of a surface-bound proteinase of Entamoeba histolytica.
Mol. Microbiol.
27:269-276[Medline].
|
| 27.
|
Kimura, A.,
Y. Hara,
T. Kimoto,
Y. Okuno, and T. Nakabayashi.
1997.
Cloning and expression of E. histolytica gene which includes a PDI active site.
Arch. Med. Res.
28S:76-77.
|
| 28.
|
Kjeldgaard, M.,
J. Nyborg, and B. F. Clark.
1996.
The GTP binding motif: variations on a theme.
FASEB J.
10:1347-1368[Abstract].
|
| 29.
|
Klausner, R. D.,
J. G. Donaldson, and J. Lippincott-Schwartz.
1992.
Brefeldin A: insights into control of membrane traffic and organelle structure.
J. Cell Biol.
116:1071-1080[Free Full Text].
|
| 30.
|
Kornfeld, R., and S. Kornfeld.
1985.
Assembly of asparagine-linked oligosaccharides.
Annu. Rev. Biochem.
54:631-664[Medline].
|
| 31.
|
Kumar, A.,
P.-S. Shen,
S. Descoteaux,
J. Pohl,
G. Bailey, and J. Samuelson.
1992.
Cloning and expression of an NADP+-dependent alcohol dehydrogenase gene of Entamoeba histolytica.
Proc. Natl. Acad. Sci. USA
89:10188-10192[Abstract/Free Full Text].
|
| 32.
|
Lee, C. C.,
X. Wu,
R. A. Gibbs,
R. G. Cook,
D. M. Muzny, and C. T. Caskey.
1988.
Generation of cDNA probes directed by amino acid sequence: cloning of urate oxidase.
Science
239:1288-1291[Abstract/Free Full Text].
|
| 33.
|
Leipe, D. D.,
J. H. Gunderson,
T. A. Nerad, and M. L. Sogin.
1993.
Small subunit ribosomal RNA+ of Hexamita inflata and the quest for the first branch in the eukaryotic tree.
Mol. Biochem. Parasitol.
59:41-48[Medline].
|
| 34.
|
Leippe, M.
1997.
Amoebapores.
Parasitol. Today
13:178-183.
[Medline] |
| 35.
|
Leippe, M.,
H. J. Sievertsen,
E. Tannich, and R. D. Horstmann.
1995.
Spontaneous release of cysteine proteinases but not of pore-forming peptides by viable Entamoeba histolytica.
Parasitology
111:569-574.
|
| 36.
|
Lohia, A., and J. Samuelson.
1996.
Heterogeneity of Entamoeba histolytica rac genes encoding p21rac homologues.
Gene
173:205-208[Medline].
|
| 37.
|
Lujan, H. D.,
A. Marotta,
M. R. Mowatt,
N. Sciaky,
J. Lippincott-Schwartz, and T. E. Nash.
1995.
Developmental induction of Golgi structure and function in the primitive eukaryote Giardia lamblia.
J. Biol. Chem.
270:4612-4618[Abstract/Free Full Text].
|
| 38.
|
Lujan, H. D.,
M. R. Mowatt,
J. T. Conrad, and T. E. Nash.
1996.
Increased expression of the molecular chaperone BiP/GRP78 during differentiation of a primitive eukaryote.
Biol. Cell
86:11-18[Medline].
|
| 39.
|
Lujan, H. D.,
M. R. Mowatt, and T. E. Nash.
1997.
Mechanisms of Giardia lamblia differentiation into cysts.
Microbiol. Mol. Biol. Rev.
61:294-304[Abstract].
|
| 40.
|
Mai, Z., and J. Samuelson.
1998.
A new gene family (ariel) encodes asparagine-rich Entamoeba histolytica antigens, which resemble the vaccine candidate serine-rich E. histolytica protein.
Infect. Immun.
66:353-355[Abstract/Free Full Text].
|
| 41.
|
Mai, Z.,
S. Ghosh,
M. Frisardi,
B. Rosenthal,
R. Rogers, and J. Samuelson.
1999.
Hsp60 is targeted to a cryptic mitochondrion-derived organelle ("crypton") in the microaerophilic protozoan parasite Entamoeba histolytica.
Mol. Cell. Biol.
19:2198-2205[Abstract/Free Full Text].
|
| 42.
|
Mann, B. J.,
B. E. Torian,
T. S. Vedvick, and W. A. Petri, Jr.
1991.
Sequence of a cysteine-rich galactose-specific lectin of Entamoeba histolytica.
Proc. Nat. Acad. Sci. USA
88:3248-3252[Abstract/Free Full Text].
|
| 43.
|
Martinez-Palomo, A.
1982.
Cell biology, p. 5-59.
In
K. N. Brown (ed.), The biology of Entamoeba histolytica. John Wiley/Research Studies Press, New York, N.Y.
|
| 44.
|
Mazzuco, A.,
M. Benchimol, and W. De Souza.
1997.
Endoplasmic reticulum and Golgi-like elements in entamoeba.
Micron
28:241-247.
|
| 45.
|
McCoy, J. J.,
B. J. Mann,
T. S. Vedvick, and W. A. Petri, Jr.
1993.
Sequence analysis of genes encoding the light subunit of the Entamoeba histolytica galactose-specific adhesin.
Mol. Biochem. Parasitol.
61:325-328[Medline].
|
| 46.
|
Mirelman, D.
1987.
Ameba-bacterium relationship in amebiasis.
Microb. Rev.
51:272-284[Free Full Text].
|
| 47.
|
Mowatt, M. R.,
H. D. Lujan,
D. B. Cotten,
B. Bowers,
J. Yee,
T. E. Nash, and H. H. Stibbs.
1995.
Developmentally regulated expression of a Giardia lamblia cyst wall protein gene.
Mol. Microbiol.
15:955-963[Medline].
|
| 48.
|
Muller, M.
1988.
Energy metabolism of protozoa without mitochondria.
Annu. Rev. Microbiol.
42:465-488[Medline].
|
| 49.
|
Nambiar, M. P.,
T. Oda,
C. Chen,
Y. Kuwazuru, and H. C. Wu.
1993.
Involvement of the Golgi region in the intracellular trafficking of cholera toxin.
J. Cell. Physiol.
154:222-228[Medline].
|
| 50.
|
Nielsen, H.,
J. Engelbrecht,
S. Brunak, and G. von Heijne.
1997.
Identification of prokaryotic and eukaryotic signal peptides and prediction of their cleavage sites.
Protein Eng.
10:1-6[Abstract/Free Full Text].
|
| 51.
|
Petri, W. A., Jr.,
M. D. Chapman,
T. Snodgrass,
B. J. Mann,
J. Broman, and J. I. Ravdin.
1989.
Subunit structure of the galactose and N-acetyl-galactosamine-inhibitable lectin of Entamoeba histolytica.
J. Biol. Chem.
264:3007-3012[Abstract/Free Full Text].
|
| 52.
|
Petri, W. A., Jr., and J. I. Ravdin.
1991.
Protection of gerbils from amebic liver abscess by immunization with the galactose-specific adherence lectin of Entamoeba histolytica.
Infect. Immun.
59:97-101[Abstract/Free Full Text].
|
| 53.
|
Plaimauer, B.,
S. Ortner,
G. Wiedermann,
O. Scheiner, and M. Duchene.
1993.
Molecular characterization of the cDNA coding for translation elongation factor-2 of pathogenic Entamoeba histolytica.
DNA Cell Biol.
12:89-96[Medline].
|
| 54.
|
Prasher, D. C.
1995.
Using GFP to see the light.
Trends Genet.
11:320-323[Medline].
|
| 55.
|
Ramos, M. A.,
G. C. Mercado,
L. M. Salgado,
R. Sanchez-Lopez,
R. P. Stock,
P. M. Lizardi, and A. Alagon.
1997.
Entamoeba histolytica contains a gene encoding a homologue to the 54-kD subunit of the signal recognition particle.
Mol. Biochem. Parasitol.
88:225-235[Medline].
|
| 56.
|
Ravdin, J. I.
1995.
Amebiasis. State-of-the-art clinical article.
Clin. Infect. Dis.
20:1453-1464[Medline].
|
| 57.
|
Reeves, R. E.
1984.
Metabolism of Entamoeba histolytica Schaudinn, 1903.
Adv. Parasitol.
23:105-142[Medline].
|
| 58.
|
Rodriguez, M. A., and E. Orozco.
1986.
Isolation and characterization of phagocytosis- and virulence-deficient mutants of Entamoeba histolytica.
J. Infect. Dis.
154:27-32[Medline].
|
| 59.
|
Roger, A. J.,
S. G. Svard,
J. Tovar,
C. G. Clark,
M. W. Smith,
F. D. Gillen, and M. L. Sogin.
1998.
A mitochondrial-like chaperonin 60 gene in Giardia lamblia: evidence that diplomonads once harbored an endosymbiont related to the progenitor of mitochondria.
Proc. Natl. Acad. Sci. USA
95:229-234[Abstract/Free Full Text].
|
| 60.
|
Rosenthal, B.,
Z. Mai,
D. Caplivski,
S. Ghosh,
H. de la Vega,
T. Graf, and J. Samuelson.
1997.
Evidence for the bacterial origin of genes encoding fermentation enzymes of the amitochondriate protozoan parasite Entamoeba histolytica.
J. Bacteriol.
179:3736-3745[Abstract/Free Full Text].
|
| 61.
|
Rothman, J. E., and F. T. Wieland.
1996.
Protein sorting by transport vesicles.
Science
272:227-234[Abstract].
|
| 62.
|
Sanchez-Lopez, R.,
S. Gama-Castro,
M. A. Ramos,
E. Merino,
P. M. Lizardi, and A. Alagon.
1998.
Cloning and expression of the Entamoeba histolytica ERD2 gene.
Mol. Biochem. Parasitol.
92:355-359[Medline].
|
| 63.
|
Schlesinger, P.
1988.
Lysosomes and Entamoeba histolytica, p. 297-313.
In
J. I. Ravdin (ed.), Amebiasis: human infection by Entamoeba histolytica. Churchill Livingstone, New York, N.Y.
|
| 64.
|
Scholze, H., and E. Tannich.
1994.
Cysteine endopeptidases of Entamoeba histolytica.
Methods Enzymol.
244:512-523[Medline].
|
| 65.
|
Smith, D. B., and K. S. Johnson.
1988.
Single-step purification of polypeptides expressed in Escherichia coli as fusions with glutathione S-transferase.
Gene
67:31-40[Medline].
|
| 66.
|
Smith, R. F., and T. F. Smith.
1992.
Pattern-induced multi-sequence alignment (PIMA) algorithm employing secondary structure-dependent gap penalties for use in comparative protein modeling.
Protein Eng.
5:35-41[Abstract/Free Full Text].
|
| 67.
|
Stanley, S. L., Jr.,
K. Tian,
J. P. Koester, and E. Li.
1995.
The serine-rich Entamoeba histolytica protein is a phosphorylated membrane protein containing O-linked terminal N-acetylglucosamine residues.
J. Biol. Chem.
270:4121-4126[Abstract/Free Full Text].
|
| 68.
|
Talamas-Rohana, P., and I. Meza.
1988.
Interaction between pathogenic amebae and fibronectin: substrate degradation and changes in cytoskeleton organization.
J. Cell Biol.
120:577-585[Free Full Text].
|
| 69.
|
Traub, L. M., and S. Kornfeld.
1997.
The trans-Golgi network: a late secretory sorting station.
Curr. Opin. Cell Biol.
9:527-533[Medline].
|
| 70.
|
Valdivia, R. H.,
A. E. Hromockyj,
D. Monack,
L. Ramakrishnan, and S. Falkow.
1996.
Applications for green fluorescent protein (GFP) in the study of host-pathogen interactions.
Gene
173:47-52[Medline].
|
| 71.
|
Van de Peer, Y., and R. De Wachter.
1994.
TREECON for Windows: a software package for the construction and drawing of evolutionary trees for the Microsoft Windows environment.
CABIOS
10:569-570[Free Full Text].
|
| 72.
|
Villagomez-Castro, J. C.,
C. Calvo-Mendez, and E. Lopez-Romero.
1992.
Chitinase activity in encysting Entamoeba invadens and its inhibition by allosamidin.
Mol. Biochem. Parasitol.
52:53-62[Medline].
|
| 73.
|
Zhang, T.,
P. R. Cieslak, and S. L. Stanley, Jr.
1994.
Protection of gerbils from amebic liver abscess by immunization with recombinant Entamoeba histolytica antigen.
Infect. Immun.
62:1166-1170[Abstract/Free Full Text].
|
Infection and Immunity, June 1999, p. 3073-3081, Vol. 67, No. 6
0019-9567/99/$04.00+0
Copyright © 1999, American Society for Microbiology. All rights reserved.
This article has been cited by other articles:
-
Welter, B. H., Temesvari, L. A.
(2009). Overexpression of a Mutant Form of EhRabA, a Unique Rab GTPase of Entamoeba histolytica, Alters Endoplasmic Reticulum Morphology and Localization of the Gal/GalNAc Adherence Lectin. Eukaryot Cell
8: 1014-1026
[Abstract]
[Full Text]
-
Teixeira, J. E., Huston, C. D.
(2008). Evidence of a Continuous Endoplasmic Reticulum in the Protozoan Parasite Entamoeba histolytica. Eukaryot Cell
7: 1222-1226
[Abstract]
[Full Text]
-
Teixeira, J. E., Huston, C. D.
(2008). Participation of the Serine-Rich Entamoeba histolytica Protein in Amebic Phagocytosis of Apoptotic Host Cells. Infect. Immun.
76: 959-966
[Abstract]
[Full Text]
-
McGugan, G. C. Jr., Joshi, M. B., Dwyer, D. M.
(2007). Identification and Biochemical Characterization of Unique Secretory Nucleases of the Human Enteric Pathogen, Entamoeba histolytica. J. Biol. Chem.
282: 31789-31802
[Abstract]
[Full Text]
-
Dacks, J. B., Field, M. C.
(2007). Evolution of the eukaryotic membrane-trafficking system: origin, tempo and mode. J. Cell Sci.
120: 2977-2985
[Abstract]
[Full Text]
-
Frederick, J. R., Petri, W. A. Jr.
(2005). Roles for the galactose-/N-acetylgalactosamine-binding lectin of Entamoeba in parasite virulence and differentiation. Glycobiology
15: 53R-59R
[Abstract]
[Full Text]
-
Bredeston, L. M., Caffaro, C. E., Samuelson, J., Hirschberg, C. B.
(2005). Golgi and Endoplasmic Reticulum Functions Take Place in Different Subcellular Compartments of Entamoeba histolytica. J. Biol. Chem.
280: 32168-32176
[Abstract]
[Full Text]
-
Marti, M., Li, Y., Schraner, E. M., Wild, P., Kohler, P., Hehl, A. B.
(2003). The Secretory Apparatus of an Ancient Eukaryote: Protein Sorting to Separate Export Pathways Occurs Before Formation of Transient Golgi-like Compartments. Mol. Biol. Cell
14: 1433-1447
[Abstract]
[Full Text]
-
Van Dellen, K., Ghosh, S. K., Robbins, P. W., Loftus, B., Samuelson, J.
(2002). Entamoeba histolytica Lectins Contain Unique 6-Cys or 8-Cys Chitin-Binding Domains. Infect. Immun.
70: 3259-3263
[Abstract]
[Full Text]
-
Frisardi, M., Ghosh, S. K., Field, J., Van Dellen, K., Rogers, R., Robbins, P., Samuelson, J.
(2000). The Most Abundant Glycoprotein of Amebic Cyst Walls (Jacob) Is a Lectin with Five Cys-Rich, Chitin-Binding Domains. Infect. Immun.
68: 4217-4224
[Abstract]
[Full Text]
-
Ghosh, S., Field, J., Rogers, R., Hickman, M., Samuelson, J.
(2000). The Entamoeba histolytica Mitochondrion-Derived Organelle (Crypton) Contains Double-Stranded DNA and Appears To Be Bound by a Double Membrane. Infect. Immun.
68: 4319-4322
[Abstract]
[Full Text]
-
Que, X., Reed, S. L.
(2000). Cysteine Proteinases and the Pathogenesis of Amebiasis. Clin. Microbiol. Rev.
13: 196-206
[Abstract]
[Full Text]