Previous Article | Next Article ![]()
Infection and Immunity, July 1999, p. 3357-3366, Vol. 67, No. 7
Department of
Ophthalmology,1 Department of
Microbiology and Immunology,3 and
Molecular Pathogenesis of Eye Infections Research Center,
Dean A. McGee Eye Institute,2 University of
Oklahoma Health Sciences Center, Oklahoma City, Oklahoma
Received 21 December 1998/Returned for modification 3 February
1999/Accepted 12 April 1999
Bacillus cereus is a rare cause of serious human
infection but, paradoxically, causes one of the most severe
posttraumatic or endogenous infections of the eye, endophthalmitis,
which frequently results in blindness. The virulence of B. cereus endophthalmitis historically has been attributed to toxin
production. We therefore sought to examine the contribution of the
dermonecrotic toxin, hemolysin BL, to the pathogenesis of B. cereus infection in an endophthalmitis system that is highly
amenable to study. The pathogenesis of infection resulting from
intravitreal injection of 102 CFU of either a clinical
ocular isolate of B. cereus producing hemolysin BL
(HBL+) or an isogenic mutant in this trait
(HBL Bacillus cereus is
associated primarily with cases of food-borne gastrointestinal
illnesses that are usually self-limiting and are rarely
life-threatening. In that context, B. cereus has not
generally been regarded as an important pathogen and is commonly dismissed as a laboratory contaminant. In the past several years, however, nongastrointestinal B. cereus infections have been
reported with increasing frequency, perhaps because of an increasing
awareness of the pathogenic potential of this saprophyte. B. cereus has been isolated as the causative agent of severe cases of
septicemia, endocarditis, pneumonia, cutaneous infections, orthopedic
infections, meningitis, and traumatic wound infections (2, 21, 23, 24, 34, 37, 39). The majority of reported cases of B. cereus nongastrointestinal disease occurred in immunocompromised individuals, patients with indwelling or prosthetic devices, or patients with traumatic injury (21, 34, 37, 39).
B. cereus ranks as a leading cause of posttraumatic
endophthalmitis, a potentially blinding infection of the tissues of the interior of the eye, resulting from intraocular contamination during
surgery or penetrating injury (1, 7, 30, 36, 41).
B. cereus is also a leading cause of endogenous
endophthalmitis, usually as a complication of high-grade bacteremia in
patients with prolonged indwelling devices or intravenous drug abusers (11, 32). In contrast to its limited virulence at other
anatomical sites, the course of B. cereus
endophthalmitis is extremely explosive; it is characterized by the
destruction of the posterior segment of the eye, with severe pain and a
rapid decline in visual acuity within 1 to 2 days (25). A
characteristic corneal ring abscess occurs in most cases. Severe edema
and spread of the infection into adjacent tissues are common findings
in severe cases. B. cereus endophthalmitis usually
results in loss of all useful vision (12, 17, 25).
Toxin production has been hypothesized to be central to the severity of
B. cereus endophthalmitis (11, 12, 32, 40). B. cereus produces a number of cytotoxins and enzymes
that could contribute to the rapid course and severity of
endophthalmitis, including hemolysins, lipases, enterotoxins, and
proteases (12, 13, 38). Initial interest in B. cereus as a diarrheal food poisoning agent led to the
characterization of a vascular permeability factor, termed hemolysin
BL. Hemolysin BL is a tripartite enterotoxin, consisting of a binding
component (B) and two lytic components (L1 and
L2), encoded by the hblA, hblD, and
hblC genes, respectively (16, 28). The hemolytic,
vascular permeability, and enterotoxic activities of hemolysin BL
require all three components for maximum activity, with initial binding
of the component B and subsequent addition of L1 and
L2 (4). Characterization of hemolysin BL led to
its implication in the pathogenesis of B. cereus
endophthalmitis (4, 5). Using an in vitro retinal button
toxicity assay and in vivo vitreal injections of sterile culture
supernatants and purified hemolysin BL, Beecher et al. (5)
demonstrated that B. cereus exotoxins, including
hemolysin BL, can cause ocular toxicity.
To study the host-parasite interactions in infections caused by
organisms of considerable public health importance that do not fit
paradigms established for traditional pathogens, such as
Enterococcus faecalis and Staphylococcus aureus,
we developed a rabbit endophthalmitis system (8, 9, 18, 19).
This system is exquisitely sensitive, as infections can be established routinely with 10 to 100 organisms. Moreover, because of the clarity of
the visual tract, repeated microscopic and electrophysiologic measurements can be made nondestructively, allowing differences in the
pathogenesis of infection by nontraditional pathogens to be assessed
noninvasively with precision. Because of the importance of eye
infections due to B. cereus, this system for analysis
provided a particularly appropriate launching point for examining the
contribution of known and putative B. cereus toxins to
the pathogenesis of nongastrointestinal infection.
In this report, we describe the generation of a hemolysin BL-deficient
allelic replacement mutant of B. cereus and comparison of its virulence with that of the wild-type parental strain, using the
endophthalmitis system. The results show that hemolysin BL is not
required for the fulminant and destructive course of infection, as
assessed with this in vivo system.
(This work was presented in part at the 99th General Meeting of the
American Society for Microbiology, 30 May to 3 June 1999, Chicago,
Ill.)
Bacterial strains and plasmids.
The B. cereus strain used in these studies was isolated locally from a
pediatric case of posttraumatic endophthalmitis that resulted in the
ultimate surgical removal of the eye. This strain (MGBC145) produces
hemolysin BL (5). Unless otherwise specified, bacterial
strains were grown in brain heart infusion medium (BHI; Difco, Detroit,
Mich.) with appropriate antibiotic selection. The relevant properties
and sources of all bacterial strains and plasmids used in this study
are summarized in Table 1.
0019-9567/99/$04.00+0
Copyright © 1999, American Society for Microbiology. All rights reserved.
Role of Hemolysin BL in the Pathogenesis of Extraintestinal
Bacillus cereus Infection Assessed in an
Endophthalmitis Model

![]()
ABSTRACT
Top
Abstract
Introduction
Materials and Methods
Results
Discussion
References
) was assessed bacteriologically and by slit lamp
biomicroscopy, electroretinography, histology, and
inflammatory cell enumeration. Both HBL+ and
HBL
strains evoked severe intraocular
inflammatory responses as early as 12 h postinfection, with
complete loss of retinal responsiveness by 12 h. The infections
caused by both strains spread of the infection to adjacent tissues by
18 h. No significant differences in intraocular bacterial growth
(P
0.21) or inflammatory changes
(P
0.21) were observed in eyes infected with either
HBL+ or HBL
strains during the course of
infection. The level of retinal responsiveness was greater in
HBL
infected eyes than in HBL+-infected eyes
at 6 h only (P = 0.01). These results
indicate that hemolysin BL makes no essential contribution to the
severe and rapid course of infection in the endophthalmitis model.
![]()
INTRODUCTION
Top
Abstract
Introduction
Materials and Methods
Results
Discussion
References
![]()
MATERIALS AND METHODS
Top
Abstract
Introduction
Materials and Methods
Results
Discussion
References
TABLE 1.
Bacterial strains and plasmids used
DNA techniques. B. cereus MGBC145 chromosomal DNA was isolated by phenol-chloroform extraction and CsCl gradient purification (29), and an internal fragment of the hemolysin BL operon was amplified by PCR as follows. PCR mixtures of 100 µl contained 25 ng of genomic DNA, 0.2 mM deoxynucleoside triphosphates Mg-free thermophilic DNA polymerase buffer (10×; Promega Corp., Madison, Wis.), 2.0 mM MgCl2, 0.5 mM of each primer (listed below), and 0.025 U of TaKaRa LA Taq polymerase (PanVera Corp., Madison, Wis.). Primers for amplification of the internal hemolysin BL fragment were derived from published sequences (GenBank accession no. L20441 and U63928) as follows: hblC forward primer with an EcoRI restriction site (underlined) incorporated into the 5' end, GAATTCCAGCTAGAGGAAGTCCCAGC; and hblA reverse primer with a PstI restriction site (underlined) incorporated into the 5' end, CTGCAGCAATATGCCCTAGAACGCCCG (Integrated DNA Technologies, Coralville, Iowa) (16, 28). The hemolysin BL fragment was amplified from B. cereus genomic DNA under the following conditions: hot-start denaturation for 1 min at 94°C, then 35 cycles of 1 min at 95°C, 1 min at 60°C, and 3 min at 72°C, followed by 10 min at 72°C. The amplified hemolysin BL fragment was resolved on a 1.0% low-melting-temperature agarose gel and purified by using GeneClean (BIO 101, Inc., Vista, Calif.).
DNA manipulations and Southern blot analyses were performed essentially as described by Sambrook et al. (29). Unless otherwise specified, all plasmids were propagated in E. coli strain JM110 (dam dcm). Plasmid DNA was prepared with the Wizard Mini-Prep DNA purification kit (Promega) according to the manufacturer's instructions. B. cereus transformation was performed essentially as described by Masson et al. (22), with minor modifications. Briefly, B. cereus MGBC145 was rendered electrocompetent by growth to mid-logarithmic phase (optical density at 650 nm [OD650] of 0.3 to 0.6) in BHI and stepwise concentration of 1010 CFU/ml in chilled 10% glycerol. Electrocompetent cells were stored at
70°C for up to 1 month. For
electroporation, 40-µl aliquots of cells were thawed on ice, plasmid
DNA (10 µg) was added, and the suspension was immediately transferred
to a chilled 0.2-cm-gap electroporation cuvette. Cells were pulsed at
2.0 kV for 4.7 s (Bio-Rad [Hercules, Calif.] Escherichia
coli Pulser). After pulsing, 1.0 ml of SOC medium (29)
was added to the cells for recovery (2 h, 28°C), and 500-µl
aliquots were plated onto BHI supplemented with 400 erythromycin
(µg/ml) and kanamycin (75 µg/ml). Transformants were subcultured
onto BHI supplemented with 2.5% (vol/vol) sheep erythrocytes and
erythromycin plus kanamycin. Erythromycin- and kanamycin-resistant
(Ermr Kanr) colonies identified with a loss of
the discontinuous hemolytic zone (6) were chosen for further analysis.
Phenotypic assessment of B. cereus strains.
Phenotypic profiles of the parental (hemolysin BL-expressing
[HBL+]) and hemolysin BL-deficient (HBL
)
strains were assessed biochemically. Cytolytic activities of culture
supernatants were assessed based on sheep erythrocytes and a hemolysis
readout. Briefly, twofold serial dilutions of overnight culture
supernatants were incubated with an equal volume of 4% (vol/vol) sheep
erythrocytes in phosphate-buffered saline for 30 min, and the
OD540 was measured. The hemolytic titer was determined as
the dilution of supernatant exhibiting 50% hemolysis.
Experimental B. cereus endophthalmitis. New Zealand White rabbits (2 to 3 kg) were maintained in accordance with institutional guidelines and the Association for Research in Vision and Ophthalmology Statement on the Use of Laboratory Animals in Ophthalmic Research. Prior to intravitreal injection, eyes were dilated with topical 1% tropicamide and 2.5% phenylephrine HCl. Rabbits were anesthetized by intramuscular injection of ketamine (Ketaved; Phoenix Scientific Inc., St. Joseph, Mo.; 35 mg/kg of body weight) and xylazine Rompun; Bayer Corp., Shawnee Mission, Kans.; 5 mg/kg of body weight). Topical anesthesia (0.5% proparacaine HCl [Ophthetic; Allergan, Hormigueros, Puerto Rico]) was also applied.
With the aid of a binocular surgical microscope, eyes were immobilized with iris forceps, and 100 µl of aqueous humor withdrawn to relieve intraocular pressure before injection. Inocula (102 CFU of either the HBL+ or HBL
strain in 100 µl of
BHI with or without 25 µg of erythromycin per ml) were delivered by
slow infusion into the midvitreous via a 30-gauge needle attached to a
1.0-ml syringe introduced through the pars plana, approximately 3 mm
from the limbus of one eye of each rabbit. The contralateral eye was
injected with either BHI or BHI supplemented with 25 µg of
erythromycin per ml (surgical controls) or was left undisturbed
(absolute control) (8-10, 18). At various times after
infection, the following parameters of infection and organ function
were quantified: (i) slit lamp biomicroscopy, (ii) electroretinography
(ERG), (iii) intraocular bacterial quantitation, (iv) quantitation of
inflammatory cells and total protein in aqueous humor, and (v)
thin-section histology. The inoculum was quantified retrospectively by
plating triplicate serial 10-fold dilutions on BHI (20).
Slit lamp examination.
Rabbits were observed in a Topcon
SL-5D slit lamp biomicroscope (Kogaku Kikai K.K., Tokyo, Japan) prior
to injection and again following injection at 3, 6, 12, and 18 h.
Ocular inflammation was scored by masked independent observers, using
scoring criteria for progressive inflammation of the cornea, anterior
chamber, vitreous, and retina as described in Table
2.
|
ERG.
ERG was used to measure the ability of the retina to
respond to a single low-intensity flash (one flash per second), and the resulting B-wave response (in millivolts) was measured. After dilation
and 30 min of dark adaptation, baseline B-wave amplitude was recorded
for each eye, using scotopic bright-flash ERG (EPIC-2000; LKC
Technologies, Inc., Gaithersburg, Md.) at time points 24 h prior
to injection and again following injection at 3, 6, 12, and 18 h.
B-wave amplitude for each time point represented the average of 14 repeated measures. Percent loss of retinal function was calculated as
[1
(experimental B-wave amplitude/baseline B-wave amplitude)] × 100 (8-10, 18).
Bacterial enumeration. To enumerate organisms in the vitreous, globes were enucleated, rinsed with sterile phosphate-buffered saline and placed cornea side up on sterile gauze. The cornea, iris, and lens were removed aseptically. The vitreous was then removed with a sterile pipette, its volume was measured, and the tissue was homogenized (60 s, 5,000 rpm; Mini-BeadBeater, Biospec Products, Bartlesville, Okla.) to reduce viscosity. Bacteria in the vitreous were quantified by plating serial 10-fold dilutions in triplicate on BHI. Colonies (50 or more) recovered from vitreous were replica plated onto 2.5% sheep blood agar to confirm the hemolysin BL phenotype of the infecting strains.
Anterior segment inflammation. Anterior segment inflammation was analyzed by (i) enumeration of infiltrating inflammatory cells in anterior chamber fluid, using a hemocytometer, and (ii) quantification of total protein in anterior chamber fluid, using a bicinchoninic acid protein assay kit (Pierce Co., Rockford, Ill.).
Thin-section histopathology. All globes recovered for histopathological analysis were fixed in 10% formalin for 24 h. Eyes were sectioned and stained with either hematoxylin and eosin or Brown & Hopps tissue Gram's stain following standard procedures (33). Stained tissue sections were analyzed by masked observers, using scoring criteria as summarized in Table 2.
Statistical analysis.
All values represent the mean ± standard deviation for
4 eyes per time point assayed unless otherwise
specified. Wilcoxon's rank sum test was used for statistical
comparison between groups. A P value of <0.05 was
considered significant.
| |
RESULTS |
|---|
|
|
|---|
Construction of p
HBL.
The construction of p
HBL is
illustrated in Fig. 1.
PCR amplification of B. cereus MGBC145 chromosomal DNA
with hemolysin BL-specific primers (hblC and
hblA) generated a 3.3-kb DNA fragment containing 966 bp from
the 5' end of hblC, the entire hblD gene (1,154 bp), and 760 bp of the 3' end of hblA, with synthetic
EcoRI and PstI restriction sites at its 5' and 3'
ends, respectively (Fig. 1A). The amplified fragment was ligated into
the multicloning region of pKRX at the EcoRI and
PstI sites, resulting in a 6.3-kb plasmid
(pKRX-hbl). Sequencing of pKRX-hbl confirmed the
identity of the hemolysin BL fragment (3).
|
HBL) was created by digesting both pCASPER
and pKRX-hbl::ermR with
EcoRI/PstI and ligating the appropriate fragments
(3.3 kb of pCASPER and 2.9 kb of
pKRX-hbl::ermR) to
generate p
HBL (6.2 kb) (Fig. 1C).
Generation of the hemolysin BL-deficient allelic replacement
mutant.
Transformation of B. cereus MGBC145 with
p
HBL and incubation for 24 h at 28°C yielded two
Ermr Kanr colonies. Resistance to erythromycin
and kanamycin indicated integration of the entire plasmid into the
chromosome of these strains. Replica plating onto sheep blood agar with
and without selective antibiotics and incubation at 37°C revealed
that neither strain exhibited the discontinuous zone of hemolysis
associated with the Hbl
phenotype and that this mutation
was stable at 37°C. The first mutant (strain CJ145-1) was chosen for
further analysis.
mutant containing the erm
marker specifically within the hemolysin BL operon (instead of
insertion of the entire p
HBL plasmid), CJ145-1 was cultured in BHI
supplemented with 100 µg of erythromycin per ml to maintain selection
for the interrupted hbl operon, at elevated temperatures to
facilitate plasmid curing (18 h at 42°C) (15). The
resulting cultures were serially diluted and plated for isolation on
BHI agar supplemented with 100 µg of erythromycin per ml and then
cultured for an additional 18 h at 42°C. Isolated colonies
(approximately 100) were replica plated on BHI agar supplemented with
either erythromycin (100 µg/ml) or kanamycin (50 µg/ml) and
incubated overnight at 37°C. A single Ermr
Kans clone (strain CJ145-1.1) was recovered for further
analysis. Kanamycin susceptibility indicated excision of the pCASPER
vector by a second recombination and loss by temperature-induced curing.
PCR amplification of the hemolysin BL genes in chromosomal DNA
preparations of B. cereus MGBC145 and CJ145-1.1
revealed that the HBL
mutant contained the deleted 2.8-kb
hemolysin BL PCR fragment, compared to a 3.3-kb fragment from the
wild-type strain. Since construction of
pKRX-hbl::ermR involved
deletion of a 1.6 kb Eco47III/PacI fragment and
insertion of the 1.1-kb erythromycin marker, the isogenic
HBL
mutant had a corresponding amplified hemolysin BL
fragment that was 0.5 kb smaller than that in the wild type (Fig.
2A).
|
mutant.
Phenotypic assessment.
Results of the phenotypic assessment of
the wild-type HBL+ strain and the HBL
mutant
are summarized in Table 3. The two
strains differed only in hemolysin BL activities, as measured by
several criteria. The hemolytic titer of the HBL
mutant
for sheep erythrocytes was significantly less than that observed for
the HBL+ strain. Isolated colonies of both strains
exhibited comparable hemolytic zones adjacent to each colony on sheep
erythrocyte agar. However, the characteristic hemolysin BL-mediated
discontinuous zone of hemolysis surrounding isolated HBL
colonies was absent (Fig. 3A). Similarly,
concentrated supernatants of the HBL
mutant did not
induce the vascular permeability reaction observed with supernatants of
the HBL+ strain (Fig. 3B). These results indicated that
hemolysin BL was indeed not functional in the HBL
mutant.
The cereolysin AB and proteolytic activities of the HBL+
and HBL
strains were not different (Table 3).
|
|
Experimental B. cereus endophthalmitis. Reproducible endophthalmitis was achieved by intravitreal injection of 215 ± 27 CFU of the wild-type HBL+ B. cereus strain. A very rapid and intense inflammatory response beginning as early as 3 h was observed. Mild to moderate conjunctival inflammation and 10 to 20 inflammatory cells per microscopic field were present in the anterior chamber. All eyes had a normal fundus reflex. At 6 h postinfection, inflammatory symptoms progressed, with a haze developing in the vitreous and a decrease in fundus reflex. From 12 to 18 h, inflammatory symptoms were severe in all animals, with anterior chamber hyphema, severe iritis, significant inflammatory cell infiltration into the vitreous, and no fundus reflex. Gross examination of enucleated globes and surrounding tissues showed severe inflammation of periorbital tissues at 12 and 18 h postinfection. Because of the extensive panophthalmitis evident at 18 h, infections were not allowed to progress further. Sham-injected eyes were indistinguishable from uninjected eyes by slit lamp biomicroscopy.
Experimental hemolysin BL-deficient B. cereus endophthalmitis.
The inflammatory changes
observed with eyes infected with 195 ± 30 CFU of the
HBL
mutant were similar to those observed in eyes
infected with the HBL+ strain at all time points except
6 h. Eyes infected with the HBL
mutant showed
minimal conjunctival inflammation and no anterior chamber inflammatory
cells present in four of six eyes at 6 h. The remaining two eyes
exhibited infiltration of 5 to 10 inflammatory cells per microscopic
field present in the anterior chamber, and a slight reduction of the
fundus reflex. After 12 h, however, eyes infected with the
HBL
mutant were indistinguishable from eyes infected with
the HBL+ strain. Sham-injected eyes were indistinguishable
from uninjected eyes by slip lamp biomicroscopy.
In vitro and in vivo growth of HBL+ and
HBL
strains.
Growth of the HBL+ strain
and that of the HBL
mutant in BHI were similar. The
patterns of intraocular growth of the HBL+ and
HBL
strains were also similar at each time point assayed
(P
0.21) (Fig. 4A).
Each strain grew logarithmically until approximately 12 h, after
which a stationary phase of growth was maintained at 108
CFU/ml until the termination of the experiment.
|
Anterior segment inflammation.
There were no significant
differences in anterior segment inflammation in terms of inflammatory
cells per milliliter of aqueous humor (P
0.21) (Fig.
4B) or total protein concentration per milliliter of aqueous humor
(P
0.38) (Fig. 4D) throughout the course of
infection. Aqueous humor samples from both sham-injected and uninjected
control eyes were free of inflammatory cells (Fig. 4B) and maintained
only baseline levels of total protein (Fig. 4D) throughout the duration
of the experiment.
ERG.
The results of ERG of eyes infected with the wild-type
HBL+ strain or HBL
mutant are summarized in
Fig. 4C. Values at 3 h were not included in the study because the
retinal responses of injected, surgical control, and absolute control
eyes were each diminished at this time. This generalized loss of
retinal response in eyes with little to no inflammation was likely the
result of the recent anesthetization of the animals, causing a general
unresponsiveness to light stimuli.
mutant was significantly greater than that of eyes
injected with the HBL+ strain at 6 h only
(P = 0.01). At 12 h, retinal responses diminished completely in each infection group (P = 0.91).
Histological assessment.
Immediately following intravitreal
injection and at 3 h postinfection, eyes from both infection
groups possessed intact retinal architecture, no observable
inflammation, and few bacilli in the vitreous. At 6 h, eyes
injected with the HBL+ strain exhibited a mild to moderate
inflammatory response in the anterior segment and the vitreous. Bacilli
were observed throughout the vitreous but occurred in greatest numbers
at vitreous interfaces and on the posterior surface of the ciliary
body. Retinal architecture was disrupted, with retinal detachment,
photoreceptor layer folding, and bacilli located within the retinal
layers (Fig. 5). Eyes injected with the HBL
mutant
exhibited inflammation and B. cereus localization
similar to that observed with the HBL+ strain (Fig. 5).
Some normal retinal tissue was seen. Disruption of the retinal
architecture and bacilli within the retinal layers was also observed.
In general, these eyes were slightly, but not significantly, less
inflamed than those infected with the HBL+ strain.
strain were histopathologically
indistinguishable from those infected with the HBL+ strain
(Fig. 5).
|
| |
DISCUSSION |
|---|
|
|
|---|
Isogenic mutants deficient in single or multiple virulence determinants are used routinely to assess the relative contributions of such factors to the pathogenesis of infection. To our knowledge, this is the first report of the generation of an allelic replacement mutant of B. cereus and its use in assessing the relative contribution of a specific protein to B. cereus virulence.
B. cereus endophthalmitis is unique in its fulminance and invariably devastating outcome. The experimental model used in these studies mimicked several findings of clinical B. cereus endophthalmitis, namely, photoreceptor layer folding, retinal epithelial disruption, ciliary body damage, corneal ring abscess formation, and severe vitritis. Comparison of an isogenic B. cereus mutant deficient in hemolysin BL with its parental strain in this model specifically addressed the contribution of this toxin to natural infection pathogenesis. Previous studies of the contribution of hemolysin BL to endophthalmitis relied on in vitro retinal toxicity studies using purified toxins at concentrations of unknown physiological relevance (5). The results of the present study show that B. cereus endophthalmitis results in complete destruction of organ function by 12 h, irrespective of hemolysin BL production. Comparable levels of intraocular inflammation, retinal detachment, and photoreceptor layer folding occurred in the absence of hemolysin BL, highlighting the importance of inflammogenic and toxic factors other than hemolysin BL in intraocular virulence.
The present study suggests that while hemolysin BL may contribute to retinal toxicity during the earliest stage of infection (i.e., at 6 h), its role is limited, and the unique virulence of B. cereus for the eye results from other host/parasite interactions. A recent study from our laboratory demonstrated the inflammogenic potential of B. cereus cell walls (10). Metabolically inactive B. cereus and cell wall sacculus preparations did not affect retinal architecture or neuroresponsiveness but did elicit significant intraocular inflammation. B. cereus supernatants resulted in both retinal toxicity and intraocular inflammation, indicating that secreted toxins or other proteins contribute to retinal toxicity, as previously observed (5), and that intraocular inflammation results from the combination of toxins and cell wall constituents. The present study unambiguously demonstrates that in the multifactorial pathogenesis of extraintestinal B. cereus infection, hemolysin BL does not play an essential role. Continuing efforts are directed toward identifying the principle interactions resulting in this unusually explosive infection of the eye and toward defining precisely the role of hemolysin BL and other toxins in gastroenteritis and other diseases caused by B. cereus.
| |
ACKNOWLEDGMENTS |
|---|
We thank William J. Moar (Auburn University, Auburn, Ala.) for providing transformation protocols. The technical assistance of Judy Hanna (DMEI Pathology), Russ Burris, Carolyn Thompson, and Jan Sullivan (DMEI Photography), and Mark Dittmar (DMEI Animal Facility) is greatly appreciated. We also thank Mary C. Booth, James Chodosh, Viswanathan Shankar, Wolfgang Haas, Brett Shepard, and Phillip Coburn for critical reading and stimulating discussions and Willis Owen (OUHSC Biostatistics and Epidemiology) for statistical expertise.
This work was supported in part by National Research Service Award EY06813 (to M.C.C.), grant EY08289 (to M.S.G.), and an unrestricted grant from Research to Prevent Blindness, Inc., New York, N.Y.
| |
FOOTNOTES |
|---|
* Corresponding author. Mailing address: Department of Ophthalmology, University of Oklahoma Health Sciences Center, 608 Stanton L. Young Blvd., Oklahoma City, OK 73104. Phone: (405) 271-1084. Fax: (405) 271-8128. E-mail: mgilmore{at}aardvark.ou.edu.
Present address: Department of Biology, Oklahoma Baptist
University, Shawnee, Okla.
Editor: E. I. Tuomanen
| |
REFERENCES |
|---|
|
|
|---|
| 1. | Affeldt, J. C., H. W. Flynn, R. K. Forster, S. Mandelbaum, J. G. Clarkson, and G. D. Jarus. 1987. Microbial endophthalmitis resulting from ocular trauma. Ophthalmology 94:407-413[Medline]. |
| 2. | Akesson, A., S. A. Hedstrom, and T. Ripa. 1991. Bacillus cereus: a significant pathogen in postoperative and post-traumatic wounds on orthopaedic wards. Scand. J. Infect. Dis. 23:71-77[Medline]. |
| 3. | Altschul, S. F., W. Gish, W. Miller, E. W. Myers, and D. J. Lipman. 1990. Basic local alignment search tool. J. Mol. Biol. 215:403-410[Medline]. |
| 4. |
Beecher, D. J., and J. D. Macmillan.
1991.
Characterization of the components of hemolysin BL from Bacillus cereus.
Infect. Immun.
59:1778-1784 |
| 5. | Beecher, D. J., J. S. Pulido, N. P. Barney, and A. C. L. Wong. 1995. Extracellular virulence factors in Bacillus cereus endophthalmitis: methods and implication of involvement of hemolysin BL. Infect. Immun. 63:632-639[Abstract]. |
| 6. |
Beecher, D. J., and A. C. L. Wong.
1997.
Tripartite hemolysin BL from Bacillus cereus: hemolytic analysis of component interactions and a model for its characteristic paradoxical zone phenomenon.
J. Biol. Chem.
272:233-239 |
| 7. | Boldt, H. C., J. S. Pulido, C. F. Blodi, J. C. Folk, and T. A. Weingeist. 1989. Rural endophthalmitis. Ophthalmology 96:1722-1726[Medline]. |
| 8. |
Booth, M. C.,
R. V. Atkuri,
S. K. Nanda,
J. J. Iandolo, and M. S. Gilmore.
1995.
Accessory gene regulator controls Staphylococcus aureus virulence in endophthalmitis.
Invest. Ophthalmol. Visual Sci.
36:1828-1836 |
| 9. | Booth, M. C., A. L. Cheung, K. L. Hatter, B. D. Jett, M. C. Callegan, and M. S. Gilmore. 1997. Staphylococcal accessory regulator (sar) in conjunction with agr contributes to Staphylococcus aureus virulence in endophthalmitis. Infect. Immun. 65:1550-1556[Abstract]. |
| 10. |
Callegan, M. C.,
M. C. Booth,
B. D. Jett, and M. S. Gilmore.
1999.
Pathogenesis of gram-positive bacterial endophthalmitis.
Infect. Immun.
67:3348-3356 |
| 11. | Cowan, C. L., W. M. Madden, G. F. Hatem, and J. C. Merritt. 1987. Endogenous Bacillus cereus panophthalmitis. Ann. Ophthalmol. 19:65-68[Medline]. |
| 12. | Davey, R. T., and W. B. Tauber. 1987. Post-traumatic endophthalmitis: the emerging role of Bacillus cereus infection. Rev. Infect. Dis. 9:110-123[Medline]. |
| 13. |
Drobniewski, F. A.
1993.
Bacillus cereus and related species.
Clin. Microbiol. Rev.
6:324-338 |
| 14. |
Gilmore, M. S.,
A. L. Cruz-Rodz,
M. Leimeister-Wachter,
J. Kreft, and W. Goebel.
1989.
A Bacillus cereus cytolytic determinant, cereolysin AB, which comprises the phospholipase C and sphingomyelinase genes: nucleotide sequence and genetic linkage.
J. Bacteriol.
171:744-753 |
| 15. |
Gutierrez, J. A.,
P. J. Crowley,
D. P. Brown,
J. D. Hillman,
P. Youngman, and A. S. Bleiweis.
1996.
Insertional mutagenesis and recovery of interrupted genes of Streptococcus mutans by using transposon Tn917: preliminary characterization of mutants displaying acid sensitivity and nutritional requirements.
J. Bacteriol.
178:4166-4175 |
| 16. |
Heinrichs, J. H.,
D. J. Beecher,
J. D. Macmillan, and B. A. Zilinskas.
1993.
Molecular cloning and characterization of the hblA gene encoding the B component of hemolysin BL from Bacillus cereus.
J. Bacteriol.
175:6760-6766 |
| 17. |
Ho, P. C.,
D. M. O'Day, and W. S. Head.
1982.
Fulminating panophthalmitis due to exogenous infection with Bacillus cereus: a report of 4 cases.
Br. J. Ophthalmol.
66:205-208 |
| 18. |
Jett, B. D.,
H. G. Jensen,
R. E. Nordquist, and M. S. Gilmore.
1992.
Contribution of the pAD1-encoded cytolysin to the severity of experimental Enterococcus faecalis endophthalmitis.
Infect. Immun.
60:2445-2452 |
| 19. | Jett, B. D., D. W. Parke, M. C. Booth, and M. S. Gilmore. 1997. Host/parasite interactions in bacterial endophthalmitis. Zentrbl. Bakteriol. 285:341-367. |
| 20. | Jett, B. D., K. L. Hatter, M. M. Huycke, and M. S. Gilmore. 1997. Simplified agar plate method for quantifying viable bacteria. BioTechniques 23:648-650[Medline]. |
| 21. | Marley, E. F., N. K. Saini, C. Venkatraman, and J. M. Orenstein. 1995. Fatal Bacillus cereus meningoencephalitis in an adult with acute myelogenous leukemia. South. J. Med. 88:969-972. |
| 22. | Masson, L., G. Prefontaine, and R. Brousseau. 1989. Transformation of Bacillus thuringiensis vegetative cells by electroporation. FEMS Microbiol. Lett. 60:273-278. |
| 23. | Meredith, F. T., V. G. Fowler, M. Gautier, G. R. Corley, and L. B. Reller. 1997. Bacillus cereus necrotizing cellulitis mimicking clostridial myonecrosis: case report and review of the literature. Scand. J. Infect. Dis. 29:528-529[Medline]. |
| 24. | Miller, J. M., J. G. Hair, M. Hebert, L. Hebert, and F. J. Roberts. 1997. Fulminating bacteremia and pneumonia due to Bacillus cereus. J. Clin. Microbiol. 35:504-507[Abstract]. |
| 25. | O'Day, D. M., R. S. Smith, C. R. Gregg, P. C. B. Turnbull, W. S. Head, J. A. Ives, and P. C. Ho. 1981. The problem of Bacillus species infection with special emphasis on the virulence of Bacillus cereus. Ophthalmology 88:833-838[Medline]. |
| 26. |
Park, S. S.,
N. Samiy,
K. Ruoff,
D. J. D'Amico, and A. S. Baker.
1995.
Effect of intravitreal dexamethasone in treatment of pneumococcal endophthalmitis in rabbits.
Arch. Ophthalmol.
113:1324-1329 |
| 27. | Peyman, G. A., J. T. Pague, H. I. Meisels, and T. O. Bennett. 1975. Postoperative endophthalmitis: a comparison of methods for treatment and prophylaxis with gentamicin. Ophthalmic Surg. 6:45-55[Medline]. |
| 28. |
Ryan, P. A.,
J. D. Macmillan, and B. A. Zilinskas.
1997.
Molecular cloning and characterization of the genes encoding the L1 and L2 components of hemolysin BL from Bacillus cereus.
J. Bacteriol.
179:2551-2556 |
| 29. | Sambrook, J., E. F. Fritsch, and T. Maniatis. 1989. Molecular cloning: a laboratory manual, 2nd ed. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y. |
| 30. |
Schemmer, G. R., and W. T. Driebe.
1987.
Post-traumatic Bacillus cereus endophthalmitis.
Arch. Ophthalmol.
105:342-344 |
| 31. | Schutte, B. C., K. Ranade, J. Pruessner, and N. Dracopoli. 1997. Optimized conditions for cloning PCR products into an XcmI T-vector. BioTechniques 22:40-44[Medline]. |
| 32. | Shamsuddin, D., C. U. Tuazon, C. Levy, and J. Curtin. 1982. Bacillus cereus panophthalmitis: source of the organism. Rev. Infect. Dis. 4:97-103[Medline]. |
| 33. | Sheehan, D. C., and B. B. Hrapchak. 1987. Theory and practice of histotechnology. Battelle Press, Columbus, Ohio. |
| 34. | Sliman, R., S. Rehm, and D. M. Shlaes. 1987. Serious infections caused by Bacillus species. Medicine 66:218-223[Medline]. |
| 35. | Tao, L., D. J. LeBlanc, and J. J. Ferretti. 1992. Novel streptococcal-integration shuttle vectors for gene cloning and inactivation. Gene 120:105-110[Medline]. |
| 36. | Thompson, S. T., L. M. Parver, C. L. Enger, W. F. Meiler, and P. E. Liggett. 1993. Infectious endophthalmitis after penetrating injuries with retained intraocular foreign bodies. Ophthalmology 100:1468-1474[Medline]. |
| 37. |
Tuazon, C. U.,
H. W. Murray,
C. Levy,
M. N. Solny,
J. A. Curtin, and J. N. Sheagren.
1979.
Serious infections from Bacillus sp.
JAMA
241:1137-1140 |
| 38. | Turnbull, P. C. B. 1981. Bacillus cereus toxins. Pharmacol. Ther. 13:453-505[Medline]. |
| 39. |
Turnbull, P. C. B.,
K. Jorgensen,
J. M. Kramer,
R. J. Gilbert, and J. M. Parry.
1979.
Severe clinical conditions associated with Bacillus cereus and the apparent involvement of exotoxins.
J. Clin. Pathol.
32:289-293 |
| 40. |
Turnbull, P. C. B., and J. M. Kramer.
1983.
Non-gastrointestinal Bacillus cereus infections: an analysis of exotoxin production by strains isolated over a two-year period.
J. Clin. Pathol.
36:1091-1096 |
| 41. | Williams, D. R., W. F. Meiler, G. W. Abrams, and H. Lewis. 1988. Results and prognostic factors in penetrating ocular injuries with retained intraocular foreign bodies. Ophthalmology 95:911-916[Medline]. |
This article has been cited by other articles:
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Copyright © 2009 by the American Society for Microbiology. For an alternate route to Journals.ASM.org, visit: http://intl-journals.asm.org | More Info»