INTRODUCTION

Top Abstract Introduction Materials and Methods Results Discussion References

Streptococcus mutans is the primary etiologic agent of smooth-surface tooth decay in humans (14). The primary virulence traits of S. mutans are sucrose-dependent adherence, aciduricity, and acidogenicity (14). Sucrose-dependent adherence is mediated by glucans, the products of the extracellular glucosyltransferase (GTF) enzymes, which have glucan-binding properties (8). GTF-I, GTF-SI, and GTF-S, encoded by the gtfB, gtfC, and gtfD genes, respectively, polymerize the glucose moieties of sucrose into glucans. The importance of the GTFs, particularly the products of the gtfB and gtfC genes, in cariogenicity has been established by many labs (16, 26, 27). Ueda and Kuramitsu found that within S. mutans the tandemly arranged, highly homologous gtfB and gtfC genes could spontaneously recombine at a frequency of 10³ to form a single hybrid gtfBC gene (24). This recombination resulted in a dramatic decrease in the synthesis of water-insoluble glucan (24) and a reduction in virulence (26). When the intact gtfB and gtfC genes were cloned in Escherichia coli, it was found that recombination of these genes was RecA dependent and resulted in recombinant gtfBC genes with markedly dissimilar sites of recombination (24). It was later reported that gtfBC recombination within S. mutans was not RecA dependent and that a variety of in vivo-generated gtfBC recombinants had similar sites of recombination (11).

S. mutans also synthesizes three glucan-binding proteins with no known enzymatic activities, GbpA, GbpB, and GbpC, whose contributions to virulence, or properties associated with virulence, have begun to be explored. GbpC appears to be anchored to the cell wall, is partially similar to members of the Spa family of oral streptococcal proteins, and is involved in rapid dextran-dependent aggregation under defined, stressful growth conditions (19). The contribution of GbpC to virulence has yet to be documented. Immunization with GbpB has been reported to be caries protective (23), although the actual function of GbpB is unknown and the gene encoding it has yet to be cloned.

Like the GTFs, GbpA is a secreted protein found in association with the cell surface and in the extracellular medium. The carboxyl-terminal three-quarters of GbpA, which has homology to the carboxyl-terminal repeat domains of the GTFs (1), mediates binding to -1,6 glucosidic linkages (10, 18) present in water-soluble and, to a lesser extent, water-insoluble glucans and undergoes a conformational shift upon binding to dextran (9). Analysis of gbpA transcriptional regulation, as determined with a gbpA::cat reporter construct, indicated that gbpA was maximally expressed under anaerobic and neutral-pH conditions but that sucrose did not induce gbpA expression (3).

Previously we utilized wild-type (wt) and gbpA-isogenic strains to test the hypothesis that GbpA contributes to the virulence of S. mutans (11). Contrary to expectations, the gbpA strain was hypercariogenic in the gnotobiotic rat model. Since the colonization levels of gbpA mutant and wt S. mutans were not significantly different, the increased virulence of the gbpA strain was not due to an increase in the number of adherent organisms. In vitro, the gbpA mutant plaque was more resistant to mechanical stress than that of the wt, suggesting that they were structurally different (11). On the basis of these findings, we hypothesized that gbpA S. mutans was hypercariogenic due to an altered plaque structure which modified either acid production or diffusion. After 35 days in vivo, the gbpA strain had become enriched to various degrees with organisms with reduced GTF activity due to recombination involving the highly homologous, continguous gtfB and gtfC genes. The incidence of gtfBC recombinant organisms within the gbpA background was inversely correlated with caries development, such that gbpA S. mutans containing 22.33% gtfBC recombinant organisms was not significantly different from wt S. mutans in cariogenicity or colonization levels. These results suggested the possibility that the reduced GTF activity of gtfBC recombinant organisms restored a less cariogenic, more wt-like plaque structure.

The purpose of the present work was to test the hypothesis that the absence of GbpA alters S. mutans plaque structure and that the presence of gtfBC recombinant organisms within a gbpA background restores a wt-like plaque structure. We show that the loss of GbpA dramatically alters the structure of S. mutans plaque biofilm and that gtfBC recombination within a gbpA background partially restores a wt-like plaque structure. We also show that these changes in plaque structure both have functional consequences and correlate with changes in virulence. Our findings have implications both for further understanding S. mutans cariogenicity and for the study of biofilms. To our knowledge, this work, in conjunction with our previous findings, represents the first experimental evidence that changes in biofilm structure influence virulence.

(Part of this work was conducted by K. R. O. Hazlett in partial fulfillment of the requirements for a Ph.D. from Albany Medical College, Albany, N.Y.)

	MATERIALS AND METHODS

Top Abstract Introduction Materials and Methods Results Discussion References

Bacteria and their cultivation. Construction of the gbpA strains of S. mutans UA130 (serotype c) has been described previously (2). When grown on mitis salivarius (MS) agar, nonrecombinant (GTF-wt) S. mutans produces rough colonies whereas gtfBC recombinant S. mutans produces smooth colonies. The laboratory gbpA gtfBC strain used in this work was a spontaneous mutant isolated by streaking S. mutans UA130 gbpA on MS agar (Difco Laboratories, Grand Island, N.Y.) plates and picking a smooth colony. This isolate was phenotypically indistinguishable from gtfBC recombinant organisms previously recovered from gbpA mutant-infected rats. PCR amplification of the gtfB-gtfC region (11) confirmed that this isolate was a gtfBC recombinant. The clinical gbpA gtfBC strains were recovered from gbpA S. mutans-infected gnotobiotic rats (11). Broth cultures of gbpA gtfBC strains were individually mixed with broth cultures of the nonrecombinant gbpA strain such that the resulting mixture (termed gbpA/25%gtfBC) contained 25% gtfBC recombinant organisms. These mixtures were immediately used to generate frozen glycerol stocks. By plating the glycerol stocks of the gbpA/25%gtfBC mixtures on MS agar and enumerating the smooth and rough colonies, we confirmed that inoculation broths generated from the glycerol stocks contained the appropriate ratio of recombinants and nonrecombinants. This ratio of nonrecombinants to recombinants was used to mimic the previously observed level of in vivo accumulation of gtfBC organisms by gbpA S. mutans (11). Glycerol stocks of S. mutans UA130 wt, gbpA, and the gbpA/25%gtfBC mixtures were stored at 70°C and used to generate overnight chemically defined medium (CDM) broth cultures. S. mutans strains were routinely grown anaerobically at 37°C in CDM (JRH Biosciences, Lenexa, Kansas). Growth on Todd-Hewitt (Difco Laboratories) and MS agar plates was used to confirm culture purity and colony morphology, respectively. The gbpA and gbpA/25%gtfBC strains were maintained in vitro with erythromycin at 25 µg/ml.

In vitro S. mutans plaques. The method described by Schilling et al. (20) was used in the preparation of hydroxyapatite-coated plates. Briefly, 333 µl (96-well plates [product no. 25860; Corning, Corning, N.Y.] and 16-well Nunc Lab-Tek Chamber slides [Fisher Scientific, Pittsburgh, Pa.]) or 2.5 ml (24-well plates [product no. 3524; Costar, Cambridge, Mass.]) of a 2.5 mM CaCl₂ · H₂O-7.5 mM KH₂PO₄-250 mM triethanolamine solution (pH 7.3) was added to each of the wells of tissue culture plates. The plates were incubated at 75°C without lids for 90 min. Following the incubation, the supernatants were carefully aspirated, the plates were allowed to dry, and the process was repeated three times. Hydroxyapatite-coated plates and lids were sterilized prior to use by exposure to 2 kJ of UV (254-nm) radiation.

Light microscopy. S. mutans plaques grown within the wells of hydroxyapatite-coated 24-well plates were photographed unmagnified against a black background with a Polaroid MP-4 Land camera and at low magnification with a 35-mm camera coupled to an Olympus IM inverted microscope with a 4× objective.

Confocal microscopy. S. mutans plaques for use in confocal microscopy were generated within the hydroxyapatite-coated wells of 16-well Nunc Lab-Tek Chamber slides (Fisher Scientific). Following 4 days of growth, plaques were rinsed twice with 300 µl of TKS buffer (10 mM Tris-HCl, 50 mM KCl, 5% sucrose; pH 7.0)/well, stained for 15 min in the dark with 200 µl of the LIVE Baclight Bacterial Gram Stain fluorescent dye mixture (5 µM SYTO 9, 7 µM hexidium iodide, and 0.3% dimethyl sulfoxide in TKS buffer) (Molecular Probes, Eugene, Oreg.)/well, and rinsed once with 300 µl of TKS buffer/well. The well walls were gently removed, 50 µl of TKS was deposited on each plaque, and the plaques were covered with a 22-mm by 50-mm coverslip which was secured with superglue. Because the silicone sealing gasket (which previously connected the well walls to the slide) was left intact on the slide, the coverslip did not disturb the S. mutans plaques.

Determination of GTF activity. To visualize water-insoluble GTF activity of S. mutans, cell-associated proteins were resolved by sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE) followed by incubation with Triton X-100 (Fisher Biotech) and sucrose (18). Specifically, overnight CDM broth cultures were diluted into 20 ml of Todd-Hewitt broth, grown to an OD₅₄₀ of 1.3, and harvested by centrifugation. Cells were resuspended in 150 µl of 2× cracking buffer (0.038 M Tris-HCl [pH 6.8], 1% SDS, 2.5% 2-mercaptoethanol 15% glycerol) and incubated at 25°C for 2 h. A 25-µl volume of cell-free supernatant was resolved by SDS-PAGE. Following electrophoresis, the SDS was eluted from the gel by two 30-min washes with 50 mM Tris buffer, pH 7.5. In situ water-insoluble GTF activity was visualized by incubation of the gel for 16 h in phosphate-buffered saline (PBS; pH 6.5) containing 2% sucrose, 2% Triton X-100, and 0.05% 11,000-molecular-weight dextran (Sigma, St. Louis, Mo.). The gels were briefly rinsed with PBS and incubated in a 45% methanol-10% acetic acid solution for 20 min to enhance the glucan bands. Gels were photographed against a black background. Scanning densitometry was used to quantify water-insoluble GTF activity. The glucan signals were normalized to the fructan signals; the normalized glucan signals were divided by the normalized wt glucan signal and presented as a percentage of wt GTF activity.

Sequencing of gtfBC recombination junctions. A combination of restriction digestions, Southern blotting analysis, and PCR analyses indicated that the recombination junctions of all gtfBC gene fusions were contained on 1.8-kb HindIII fragments of chromosomal DNA. Cloning of this region was achieved by PCR amplification of gtfBC gene fusions (11), digestion of the 5.3-kb PCR products with HindIII (Promega, Madison, Wis.), and ligation of the 1.8-kb fragments to HindIII-digested, alkaline phosphatase (Promega) treated pUC19. INVF' One Shot competent cells (Invitrogen, Carlsbad, Calif.) were transformed with ligation mixtures as per the manufacturer's instructions and plated on 2× yeast extract-tryptone agar plates containing 100 µg of ampicillin (Sigma)/ml and 40 µg of 5-bromo-4-chloro-3-indolyl--D-galactopyranoside Gold Biotechnology, St. Louis, Mo.)/ml. Clones containing a 1.8-kb HindIII insert were sequenced in both directions with universal M13 primers and primers gtfB@1639 (5'-GCAACTATTCAAGCAAAAATTG) and gtfC@2107 (GAAAGTGCCGTATTATAGTG), using a Perkin-Elmer ABI Prism 310 Genetic Analyzer. The published sequences of the gtfB (21) and gtfC (25) genes and the DNA analysis program MacDNASIS Pro version 3.5 (Hitachi Software, San Bruno, Calif.) were used for sequence alignment and analysis.

Antibiotic sensitivity. S. mutans plaques were generated within the wells of hydroxyapatite-coated 96-well plates as described above. On the 4th day of growth, plaques were incubated with fresh CDM containing 0 or 100 µg of ampicillin (Sigma)/ml for 2 h while rotating within a 37°C CO₂ incubator. Following ampicillin challenge, the plaques were washed three times with 300 µl of CDM and incubated with 250 µl of CDM containing 5% sucrose and 1 µCi of [³H]thymidine/ml for 16 h while rotating at 37°C. Labeled plaques were subsequently rinsed twice with 300 µl of PBS, digested with 250 µl of 1 M NaOH-10 mM EDTA for 2 h at 37°C, and subjected to scintillation counting. The percentage of plaque organisms killed was calculated as follows: 1.0  (mean counts per minute of the challenged plaque organisms/mean counts per minute of the unchallenged plaque organisms of the respective genotype).

Statistical analysis. Data analysis and determination of significance were performed with the unpaired, two-tailed Student t test (data are presented as means ± standard deviations) or, if appropriate, the unpaired, two-tailed nonparametric Mann-Whitney test (data are presented as medians with upper and lower 95% confidence intervals). Differences were considered significant when a P value of 0.05 was obtained.

	RESULTS

Top Abstract Introduction Materials and Methods Results Discussion References

The contribution of GbpA and GtfBC to S. mutans plaque structure. We previously hypothesized that the enhanced virulence of gbpA S. mutans in the gnotobiotic rat model resulted from a change in plaque structure and that the accumulation of recombinant gtfBC genes by gbpA S. mutans attenuated virulence by restoring a wt-like plaque structure (11). To test the hypothesis that inactivation of gbpA and recombination of the gtfB and gtfC genes within a gbpA background reciprocally alter plaque structure, we used an in vitro plaque model in which S. mutans wt, gbpA, and gbpA/25%gtfBC plaques were grown within hydroxyapatite-coated wells of microtiter dishes and examined by light and confocal microscopy. The gbpA mutant mixture containing 25% gbpA gtfBC recombinant organisms was used to mimic the level of in vivo accumulation of gtfBC organisms (22.33%) by gbpA S. mutans in the gnotobiotic rat model (11).

View larger version (67K): [in this window] [in a new window]   FIG. 1.   S. mutans plaques deposited in hydroxyapatite-coated wells of 24-well plates. S. mutans strains were grown in hydroxyapatite-coated wells on a rotator for 4 days in CDM with 5% sucrose as described in the text. Supernatants were aspirated, and the plaques were photographed. (A) Unmagnified hydroxyapatite wells containing S. mutans plaques photographed against a black background. (B) S. mutans plaques at low magnification, viewed with an inverted microscope with a 4× objective. With the exception of the focal plane, light micrographs of S. mutans plaques were taken under identical photographic conditions (magnification, lighting, exposure time, etc.).

View larger version (46K): [in this window] [in a new window]   FIG. 2.   Tilted saggital solid renderings of S. mutans plaques acquired by CLSM. S. mutans strains were grown in hydroxyapatite-coated wells of a Nunc Lab-Tek Chamber slide on a rotator for 4 days in CDM with 5% sucrose as described in the text. Fluorescently stained plaques were optically sectioned at 1-µm increments by CLSM; saggital views of solid renderings were tilted (x = 75, y = 5, z = 0) by using the InterVision 3-D Analysis program, converted to gray scale by using Adobe Photoshop 3.0.4 (Adobe Systems Inc., Mountain View, Calif.), and assembled by using Canvas 5.02 (Deneba Software, Miami, Fla.). All parameters of data collection, analysis, and presentation were applied identically to each of the S. mutans plaques.

View larger version (33K): [in this window] [in a new window]   FIG. 3.   Quantitative analysis of structural and functional aspects of S. mutans plaques. Asterisks indicate significant differences between adjacent columns. (A) Median heights (in micrometers) with upper and lower 95% confidence intervals of aggregates comprising S. mutans plaques (P < 0.0001). (B) Sensitivity of S. mutans plaque organisms to ampicillin challenge. Four-day-old S. mutans plaques were treated for 2 h with fresh CDM medium containing 0 or 100 µg of ampicillin/ml, washed three times, and incubated with CDM containing 5% sucrose and 1 µCi of [3H]thymidine/ml. The percentage of plaque organisms killed was calculated as follows: 1.0  (mean counts per minute of the challenged plaque organisms/mean counts per minute unchallenged plaque organisms of the respective genotype) (P < 0.02). (C) Virulence of S. mutans in the gnotobiotic rat model, as previously reported in the form of tabular data (Table 3 in reference 11 [enamel involvement, buccal surfaces]), represented here in graphical form to facilitate comparison with results from the in vitro plaque model (P < 0.03).

Characterization of gtfBC recombinant organisms. It thus appears that the presence of gtfBC recombinants within a gbpA population can restore a wt-like plaque structure whether the gbpA gtfBC recombinants were obtained as spontaneous laboratory isolates or recovered from gbpA mutant-infected gnotobiotic rats. Since recombinants could potentially vary based on the point of recombination and the active site retained in the hybrid enzyme, the genotypic and phenotypic characteristics of several gbpA gtfBC recombinants were examined for insoluble GTF activity and the site(s) of recombination. An early analysis (11) provided evidence that the recombinants recovered from infected rats all recombined near the same region. There existed the possibility that selection for certain recombinants occurred even if multiple sites of recombination were possible.

View larger version (11K): [in this window] [in a new window]   FIG. 4.   GTF activity of S. mutans UA130 gbpA gtfBC, gbpA, and wt. Equivalent levels of cell-associated proteins were resolved by SDS-PAGE and incubated at 37°C in PBS (pH 6.5) containing sucrose and Triton X-100. Gels were photographed against a black background. The positions of SDS-PAGE molecular mass standards are indicated in the left margin. The positions of water-insoluble glucan and fructan are indicated in the right margin. Lanes 1 to 6: contain gbpA gtfBC isolates recovered from six individual gbpA mutant-infected gnotobiotic rats from two separate determinations of cariogenicity. Lanes: 1, B3-B; 2, D2-A; 3, C5-2; 4, C3-2; 5, A6-1; 6, A2-1; 7 to 9, laboratory strains (7, gbpA spontaneous gtfBC; 8, gbpA; 9, wt).

The contribution of GbpA and GtfBC to S. mutans plaque function. Dental plaque, being composed of adherent aggregates of cells imbedded in a matrix of extracellular polysaccharide surrounded by fluid-filled spaces, exhibits features common to biofilms (13). A characteristic of biofilm organisms is decreased susceptibility to biocide agents compared to that of their planktonic counterparts (17). It has recently been reported that Pseudomonas aeruginosa organisms within a thin, unstructured, mutant biofilm were more susceptible to a biocidal agent than were organisms within the wt biofilm (6). Since the plaque deposited by gbpA S. mutans was thinner and less structured than wt and gbpA/25%gtfBC plaques, we hypothesized that gbpA plaque organisms would be more susceptible to a biocidal agent. To test this hypothesis, 4-day-old S. mutans plaques were challenged for 2 h with a dose of ampicillin lethal to planktonic cells and incubated overnight in the presence of [³H]thymidine. As shown in Fig. 3B, gbpA plaque organisms were significantly (P < 0.02) more susceptible to ampicillin challenge than wt plaque organisms. As the percentage of gtfBC organisms within the gbpA inocula was increased, the sensitivity of plaque organisms to ampicillin decreased. No differences in ampicillin sensitivity were found among these strains when planktonic cultures were tested (data not shown). These results indicate that the observed changes in plaque structure have functional consequences.

	DISCUSSION

Top Abstract Introduction Materials and Methods Results Discussion References

Having observed that inactivation of the gbpA gene of S. mutans increased virulence and promoted accumulation of virulence-attenuating gtfBC recombinant organisms in vivo, we hypothesized that these findings might have resulted from changes in plaque structure (11). Here we report the results of experiments designed to test the hypothesis that the absence of GbpA alters plaque structure and that the presence of gtfBC recombinant organisms within a gbpA background compensates for this alteration. Our findings have implications for further understanding S. mutans cariogenicity as well as for the study of biofilms and the relationship between biofilm structure and virulence.

Several previous observations have suggested that the absence of GbpA may have altered the structure of S. mutans plaque. An analysis of virulence in the gnotobiotic rat model revealed that while levels of colonization of gbpA and wt S. mutans were not significantly different, gbpA S. mutans was hypercariogenic (11). In vitro, gbpA mutant plaque was more resistant to mechanical stress than wt plaque (11). Since levels of acid production in batch cultures of wt and gbpA S. mutans were not different (11), we hypothesized that the hypercariogenicity of gbpA S. mutans in vivo resulted from a change in plaque structure which either increased acid production or decreased the diffusion of acid away from the tooth enamel. We have subsequently found no differences in the cell numbers of (as was found in vivo) or in the rates of acid production by wt, gbpA, or gbpA/25%gtfBC S. mutans in our plaque model (unpublished data). In light of this and the finding that gbpA mutant plaque is composed of smaller aggregates which more completely coat the underlying substratum, we hypothesize that GbpA mediates aggregation and that gbpA S. mutans is hypercariogenic in vivo due to the altered plaque structure, which, we speculate, forms a tighter barrier between the tooth surface and the saliva. We propose that a tighter barrier would allow for sustained exposure of the tooth enamel to demineralizing conditions by decreasing both the influx of salivary buffering capacity and the efflux of bacterially derived acids. We are presently developing techniques to directly test this barrier hypothesis.

Several observations led us to believe that data derived from our in vitro plaque model are relevant to our previous findings concerning cariogenicity. First, in both the gnotobiotic rat model and our in vitro plaque model, wt and gbpA/25%gtfBC S. mutans strains gave results which were highly similar to each other yet distinct from those of gbpA S. mutans. In the rats, this pattern was observed in measurements of cariogenicity, and in our in vitro model, this pattern was repeated with respect to plaque structure, aggregate size, and ampicillin sensitivity (Fig. 3). Second, in our plaque model, clinical isolates (those recovered from gbpA mutant-infected rats) produced plaques which were grossly indistinguishable from their laboratory counterparts. This finding also supports the hypothesis that gtfBC recombination was the change (as opposed to some other in vivo-selected adaptation) which attenuated the hypercariogenicity of gbpA S. mutans in the gnotobiotic rat model.

The ability of gtfBC recombination to compensate for gbpA inactivation in terms of plaque structure, aggregate size, ampicillin sensitivity, and cariogenicity led us to consider the possibility that the ratio of glucan to glucan-binding protein may be an important parameter in S. mutans plaque development. This hypothesis predicts that inactivation of other GBP-encoding genes would impart both an altered plaque structure phenotype and a propensity toward in vivo accumulation of organisms with reduced GTF activity. Since GbpA is the quantitatively predominant S. mutans nonenzymatic glucan-binding protein (22), it is possible that these effects would be most marked in the gbpA background. Obviously, many questions would have to be addressed in order to validate the glucan-glucan-binding protein hypothesis, yet the fact that a 20% reduction in GTF activity within a gbpA background restored every parameter measured (cariogenicity, plaque structure, etc.) to near-wt levels suggests that this hypothesis warrants further investigation.

While the objective of this investigation was to elucidate the contribution of GbpA and gtfBC recombination to S. mutans plaque development and cariogenicity, we feel that our results have important implications to the study of biofilms. Biofilms are communities of bacteria which develop on solid surfaces as pillar-like structures separated by fluid-filled spaces (5). These structures are composed of bacteria embedded in a matrix of extracellular polysaccharide. While the universal characteristics of biofilm structurecopious extracellular polysaccharide production and decreased antibiotic susceptibilityhave been well documented, the analysis of specific gene products in biofilm formation has just recently begun (12). Davies et al. have shown that P. aeruginosa mutants defective in acylated homoserine lactone production form a thin, flat, unstructured biofilm (6). By screening a Pseudomonas fluorescens transposon mutagenesis library, O'Toole and Kolter isolated mutants defective in biofilm initiation. Of 24 mutants isolated, 21 contained transposon insertions in genes of unknown function (17). Burne et al. have found that S. mutans polysaccharide synthesis genes are differentially regulated in biofilms (4); Mack et al. have reported that defects in production of a unique polysaccharide (PIA) by Staphylococcus epidermidis impair biofilm formation (15). Given the association of biofilms with extracellular polysaccharides, it might seem elementary that inactivation of a gene encoding a nonenzymatic polysaccharide-binding protein would alter biofilm structure, yet to our knowledge this communication represents the first report to this effect and, in conjunction with our previous findings, presents the first experimental evidence that changes in biofilm structure influence virulence. It has been suggested that interfering with the ability to form mature biofilms by disrupting cell-to-cell communication may be a novel method for attenuating the negative impact of biofilms in medicine and industry (6, 7). Our findings suggest that disruption of mature biofilm structure can have unanticipated, undesirable ramifications.