INTRODUCTION

Top Abstract Introduction Materials and Methods Results and Discussion References

The lytA-encoded major autolysin (N-acetylmuramoyl-L-alanine amidase) of Streptococcus pneumoniae is a member of a widely distributed group of cell wall-degrading enzymes located in the cell envelope and postulated to play roles in a variety of physiological functions associated with cell wall growth, wall turnover, and cell separation in microorganisms (27). The pneumococcal autolysin has a modular organization; the catalytic function is located in the N-terminal domain, and the C-terminal domain, composed of six repeat units and a short tail, acts as a binding arm attaching the enzyme to the choline residues of pneumococcal cell walls (5). Many bacteriophage infecting pneumococci also possess cell wall lytic enzymes which can show high similarity to either or both domains of the host lytA. In recent years it has become clear that these cell wall lytic enzymes provide one of the clearest examples among prokaryotic proteins of a two-domain structure whereby similarity between bacteriophage and bacterial DNA allows shuffling of domains by recombination restructuring both viral and bacterial genomes (9, 17).

Although there remains some controversy regarding the importance of autolysin in pathogenesis, both direct and indirect roles in the pathogenic process have been postulated. Autolysin may play a direct role in virulence by mediating the release of cell wall components shown to be highly inflammatory in animal models (29, 30). In addition, it has been suggested that autolysin plays an indirect role in pathogenesis by mediating cell lysis and the subsequent release of virulence factors, such as pneumolysin, not actively exported from the cell (12, 20). In support of a role for lytA in virulence, isogenic lytA mutants have been found to be significantly less virulent than the parent strain in some animal models (1, 2), and when inoculated into the mouse lung in a model of pneumonia, lytA mutants are cleared rapidly and do not invade the bloodstream (3). However, there are contradictory reports claiming no role for autolysin in virulence (28). Findings that mice immunized with autolysin survived significantly longer than control mice following intranasal challenge identified autolysin as a possible vaccine candidate (1, 15). However, the degree of protection was similar to that seen in those immunized with pneumolysin, with no increased protection apparent in animals immunized with both pneumolysin and autolysin. In association with data showing that survival time was not increased in animals challenged with a pneumolysin-negative strain, these findings indicate that at least in the mouse model, antibodies against autolysin appear to mediate their effects primarily by preventing the release of pneumolysin. In contrast, in a chinchilla otitis media model, autolysin induced release of cell wall components plays a key role in middle ear inflammation whereas pneumolysin appeared to have a limited role (26). A recent study using a signature-tagged mutagenesis approach to facilitate a large-scale identification of virulence-associated genes appeared to demonstrate an important role for autolysin in establishing pneumonia, while intraperitoneal inoculation of the same mutant demonstrated no role for autolysin in septicemia (23). Thus, there remains some controversy about the relevance of autolysin in pathogenesis, with the relative contribution of particular virulence factors appearing to vary between both different disease states and different animal models (22).

As part of a systematic study investigating the allelic variation of virulence determinants of S. pneumoniae (8) examining both the molecular evolution and the potential utility of these proteins as vaccine targets, we have performed a detailed analysis of the genetic diversity of lytA. Little is known about the allelic diversity of lytA in pneumococci, although the gene from an atypical clinical isolate (101/87) shows only 81% identity with lytA (6). However, recent studies in our laboratory, involving extensive sequencing of housekeeping genes, have shown that strain 101/87 is genetically distant from clinical isolates of typical pneumococci (31). A recent study, based on single-strand conformational polymorphism (SSCP) analysis of a small number of clinical isolates, suggested that lytA is a heterogeneous gene subject to continual variation (11). This was in contrast to preliminary data obtained by us which showed only five closely related alleles of lytA in a limited collection of strains (32). Here we confirm and extend our findings and report on both restriction fragment length polymorphism (RFLP) and nucleotide sequencing studies which demonstrate that in contrast to many other genes encoding virulence factors of S. pneumoniae, lytA is a rather highly conserved gene.

	MATERIALS AND METHODS

Top Abstract Introduction Materials and Methods Results and Discussion References

Purification of chromosomal DNA. Chromosomal DNA was purified as described previously (33) from 62 strains of S. pneumoniae selected to represent a diverse range of isolates in terms of serotype, clinical association, and time and place of isolation (Table 1).

PCR analysis. A lytA PCR product was amplified by using primers lytAup (5' GGAGTAGAATATGGAAATTGATGTGAGTAA 3' and lytAdn 5' TTTATTTTACTGTAATCAAGCCATCTGGCTC 3'), corresponding to the extreme 5' and 3' regions of the lytA coding sequence. PCR conditions used were 95°C for 1 min, 55°C for 1 min, and 72°C for 1 min, repeated for 30 cycles.

RFLP analysis. Approximately 5 µl of PCR product was digested with restriction enzymes according to the manufacturer's instructions in a total volume of 25 µl. Digests were then separated on 4 and 8% polyacrylamide gels and visualized under UV illumination following staining for 15 min in ethidium bromide (0.3 µg ml¹).

Direct sequencing of PCR products. A fraction of the PCR products used in RFLP analysis were purified by passage through QiaQuick PCR product purification columns and sequenced directly, using both primers lytAup and lytAdn and a series of internal primers. Sequencing was performed with an ABI 373 system.

Sequence analysis. Preliminary sequence analysis was performed with the DNAStar package. Comparisons of polymorphic sites and calculations of the ratio of synonymous to nonsynonymous change were constructed by using the MEGA package (14).

Nucleotide sequence accession numbers. The sequences of the lytA alleles have been submitted to GenBank and assigned accession no. AJ243399 to AJ43414.

	RESULTS AND DISCUSSION

Top Abstract Introduction Materials and Methods Results and Discussion References

Assessment of allelic diversity of lytA by RFLP. Chromosomal DNA was purified from 62 strains of S. pneumoniae selected to represent a diverse range of isolates in terms of serotype, clinical association, and time and place of isolation (Table 1). A PCR product representing the entire lytA gene was successfully amplified from each chromosomal DNA preparation. Allelic diversity of lytA was then assessed by digesting each PCR product independently with four frequently cutting restriction enzymes, RsaI, BsrI, AciI, and Hsp92II, resulting in coverage of at least 10% of the lytA sequence. The numbers of distinct alleles detected with each of these restriction enzymes were three, two, three, and five, respectively resulting in nine distinct overall allelic profiles of lytA (Table 1). The vast majority of isolates (85.5%) possessed one of the three most common alleles, lytA1, lytA2, or lytA5, with all other alleles present in no more than two isolates (Table 2). By applying the equation of Nei and Li (21) to the RFLP data, it is possible to obtain an estimate of the genetic diversity between alleles, which ranged from a minimum of 0.13% (between lytA5 and lytA8) to a maximum of 2.31% (between lytA4 and lytA6), indicating that genetic diversity in lytA is rather limited.

Sequencing of lytA RFLP allelic variants confirms limited genetic diversity. To confirm our understanding of the extent and nature of lytA genetic diversity, a PCR product representative of each of the nine RFLP allelic variants was sequenced directly. In addition, multiple representatives of the most common alleles (lytA1, lytA2, and lytA5) and lytA9 were sequenced to examine diversity within an allele as defined by RFLP analysis (Table 1). As illustrated in Fig. 1, sequencing directly confirmed the limited sequence diversity suggested by RFLP analysis. Sequence diversity ranges from a minimum of 0.11% (equivalent to one base difference) to a maximum of 3.20% between lytA4 and lytA6. The previously published lytA sequence from strain Rst7 (10) is also included in Fig. 1 for comparison; this sequence represents a distinct allele on the basis of one polymorphism not seen in any other sequence. Isolates which are largely geographically, temporally, and clinically distinct but found to possess the same RFLP allele are also closely related in terms of sequence. The lytA sequences of the three lytA5-, two lytA2-, and two lytA9-containing strains are identical, while a maximum of two base substitutions are seen between the four lytA1-containing strains sequenced. The extent of genetic diversity is broadly similar to that estimated by RFLP, and sequences are entirely consistent with the profiles obtained for each enzyme by RFLP analysis.

View larger version (22K): [in this window] [in a new window]   FIG. 1.   Percent nucleotide divergence of lytA sequences as determined by direct sequencing. The previously published sequence from strain Rst7 (10) is included for comparison. Where more than one strain is shown in a column, the lytA sequences of these strains were found to be identical. The allele designations refer to alleles identified by RFLP.

Mosaic structure of lytA resulting from localized recombination with pneumococcal bacteriophage. Comparison of only sites polymorphic between the sequences, shown in Fig. 2, reveals that genetic variation in lytA is not randomly distributed. Three apparent blocks of diversity can be seen at bases 441 to 465 in lytA2, lytA3, lytA6, and the previously published Rst7 sequence, bases 681 to 699 in lytA4, and bases 747 to 758 in lytA6. The remaining 19 (<50%) polymorphic sites are scattered throughout the remaining ca. 95% of the lytA sequence. The predicted amino acid sequences of each allelic variant, also shown in Fig. 2, illustrate that the vast majority of the nucleotide variation seen in lytA is synonymous. The proportion of synonymous changes per synonymous site (0.0347 ± 0.008) to nonsynonymous changes per nonsynonymous site (0.0036 ± 0.0012) calculated by using the Jukes-Cantor correction in the MEGA suite of programs (14) approaches 10:1, implying that purifying selection is preferentially eliminating amino acid changes.

View larger version (30K): [in this window] [in a new window]   FIG. 2.   Illustration of the diversity of lytA alleles showing only the polymorphic sites in both nucleotide and predicted amino acid sequence alignments. Numbering begins at the first residue of the ATG start codon, although residues 1 to 20 and 922 to 951 of lytA were not sequenced in this study since they correspond to the sequences of the PCR primers. Residues identical to those in strain 7751 are indicated by dots. Numbers below the nucleotide sequence represent codon positions of the changes. Allele designations refer to alleles identified by RFLP.

View larger version (52K): [in this window] [in a new window]   FIG. 3.   Alignment of polymorphic sites in lytA alleles with mosaic structure represented by strains CL18 and VA1 in comparison with an allele containing no blocks represented by 7751 and the amidase genes of pneumococcal bacteriophage HB-3 (hbl) and EJ-1 (ejl). Numbering begins at the first residue of the ATG start codon, although residues 1 to 20 and 922 to 951 of lytA were not sequenced in this study since they correspond to the sequences of the PCR primers.

Molecular evolution of lytA. In summary, our data show that lytA is essentially a rather conserved gene displaying limited genetic variation (0.11 to 3.2%). If the putative recombinant blocks are discounted from sequence comparisons, lytA genes from all strains except VA1 differ from that seen in strain 7751 by only one to three base changes. Even the maximal seven base changes seen in VA1 compared to 7751 (excluding recombinant blocks) is equivalent to variation of only 0.8%, which is similar to that reported for pneumococcal housekeeping genes (34). However, there is substantial evidence that localized recombination events with bacteriophage have occurred in the evolution of pneumococcal lytA. These findings confirm earlier reports that recombination with resident bacteriophage autolytic genes may play a role in driving the evolution of lytA. Shuffling of distinct C- and N-terminal domains is thought to have played a role in the evolution of this gene family (5, 9), and the potential for recombination to occur between bacteriophage DNA and lytA was demonstrated in the laboratory by the repair of a number of distinct point mutations following transformation with a plasmid containing the hbl gene (25). However, evidence for the occurrence of such small localized recombination events seen in clinical isolates of pneumococci not subject to laboratory manipulations has not been reported previously. It is also of interest that one of the mosaic blocks (identified in strain CL18) displays most similarity with the equivalent region of ejl from bacteriophage EJ-1. This bacteriophage was isolated from the atypical pneumococcal isolate (101/87) and reported to be unable to infect any of the typical pneumococcal strains tested (7).