Previous Article | Next Article ![]()
Infection and Immunity, September 1999, p. 4637-4645, Vol. 67, No. 9
Departments of Microbiology & Molecular
Genetics and Medicine, University of California
Received 25 February 1999/Returned for modification 13 April
1999/Accepted 7 June 1999
Serotypes A and B of the relapsing fever spirochete Borrelia
turicatae produce different disease manifestations in infected mice. Whereas serotype B causes more severe arthritis and reaches higher densities in the blood of mice than serotype A, serotype A
invades the central nervous system earlier than serotype B during infection. These differences between serotypes A and B in mice are
associated with the expression of different surface proteins, VspA and
VspB, respectively, in the culture medium. To determine whether these
proteins, in particular, VspB, are also expressed in vivo,
scid mice infected with B. turicatae were
studied. The expression of VspB by spirochetes in the blood was
demonstrated in Coomassie blue-stained polyacrylamide gels and Western
blots with a specific monoclonal antibody. Indirect immunofluorescence and immunoperoxidase studies confirmed the expression of VspB in the
blood and also demonstrated VspB expression in the joints and heart.
The gene for VspB was next identified and cloned by using partial amino
acid sequencing, reverse transcriptase PCR, and a specific monoclonal
antibody. The vspB gene encodes a protein of 216 amino
acids that is 68% identical to VspA of B. turicatae and 44 to 56% identical to representative Vsp and OspC lipoproteins of other
Borrelia spp. The processed VspB protein was distinguished from 26 other Vsp and OspC proteins by a high predicted isoelectric point at 9.39. The promoter region for vspB was similar to
the promoter region for the vsp33 gene of Borrelia
hermsii and for the ospC gene of Borrelia
burgdorferi, two genes known to be environmentally regulated.
These studies established that the virulence-associated VspB protein is
expressed by spirochetes in the mouse and that VspB is a novel member
of the Vsp-OspC family of proteins.
Relapsing fever occurs in a
louse-borne form that is often epidemic and a tick-borne form that is
usually sporadic in occurrence (reviewed in reference
7). In North America relapsing fever is caused by
the tick-borne species Borrelia turicatae and Borrelia hermsii. In comparison to B. hermsii and most other
species of relapsing fever Borrelia, B. turicatae
is more neurotropic in experimental infections and humans
(16). In addition, mice infected with B. turicatae have manifestations that resemble those of disseminated Lyme disease (19, 37).
In infected animals the successive relapse populations, or serotypes,
of spirochetes are antigenically distinct from both the infecting
serotype and from serotype populations that will follow them
(7). This fundamental feature of relapsing fever was
demonstrated by several investigators using immune sera and some form
of in vitro assay, e.g., immunofluorescence of blood smears, before any
Borrelia species was cultivated (reviewed in reference
2). Once in vitro cultivation from single cells was achieved (48), the different serotypes of this species were found to be distinguishable by a single abundant outer membrane protein, originally called a variable major protein (10).
These serotype-specific proteins were characterized by their migration in polyacrylamide gels, their reactivity with serotype-specific antibodies, and their primary sequence (4, 10, 11, 15, 42,
43).
The serotype-specific proteins of relapsing fever Borrelia
spp. have recently been divided into two groups on the basis of size
and primary sequence: the variable small proteins (Vsp), which are 20 to 23 kDa, and the variable large proteins (Vlp), which are 36 to 40 kDa (18, 25, 43). Both sets of proteins have signal
peptidase II sites, are processed to lipoproteins at a cysteine, and,
by an unknown mechanism, are transported to the outer membrane and the
spirochete's surface (15, 18, 20). Within each group,
processed Vsp and Vlp proteins are similar to one another at their N
and C termini and are more variable in their central regions. There are
two possible copies of the genes for Vsp and Vlp proteins in B. hermsii: a silent form which is found in all serotypes and an
extra expression-linked copy in cells producing the given Vsp or Vlp
(27, 28, 33, 40-43).
The genetic basis of antigenic variation has been most extensively
studied with B. hermsii, but another important aspect of relapsing fever pathogenesis was first observed with experimental B. turicatae infections. Cadavid et al. (19) and
Pennington et al. (37), using the scid mouse
model of B. turicatae infection, showed that variation
between two serotypes, A and B, was associated not only with immune
evasion but also with differential tissue localization and disease
manifestations. While serotype A of the Oz1 strain of B. turicatae invades and persistently infects the brain, serotype B
causes more severe arthritis in adult mice and higher mortality in
infant mice. The greater arthritogenicity and overall greater virulence
of serotype B appeared to be the consequence of 10-fold higher levels
of serotype B spirochetes in the blood and joints than those for
serotype A infections (37). Paradoxically, in the culture
medium the opposite is observed: serotype A grows to higher cell
densities than serotype B (39).
B. turicatae serotype A expresses VspA, and serotype B
expresses VspB; these proteins differ in electrophoretic migration and
reactivity with monoclonal antibodies (18, 19). The
expression-linked copy of vspA, the gene for VspA, has been
cloned and sequenced (18). VspA is part of a larger family
of proteins that includes not only the Vsp of B. hermsii and
Borrelia miyamotoi, a related species isolated from ixodid
ticks in Japan, but also the OspC proteins of the Lyme disease agents
Borrelia burgdorferi, Borrelia afzelii, and
Borrelia garinii (18, 20, 30, 31). Another member
of the Vsp-OspC family, Vsp33 of B. hermsii, is expressed from a different expression site than the expression-linked locus for
other vsp and vlp genes in that species
(20).
Although these past studies provided the insights into the molecular
mechanisms of serotype switching and an extensive catalog of the
vsp-vlp genes, Vsp and Vlp function is not well understood. These polymorphic proteins are associated with immune evasion (10,
17, 48), and our studies with B. turicatae further suggest that they determine infection outcome (19, 37).
Nevertheless, there has been to date only indirect evidence that Vsp or
Vlp proteins are expressed in vivo (17, 38, 45, 48). Given the environmental determinants of OspA (12, 22, 34), OspC (34, 46), and OspF (1) expression in B. burgdorferi, one cannot assume that phenotypes in the culture
medium or in ticks accurately represent spirochete expression in the
mammalian host.
The present study had two major goals. The first was to determine
whether the virulence-associated VspB protein was actually expressed
during infections of a mammalian host. We did this by using infected
mice and directly examining spirochetes in their blood and tissues for
VspB expression. The second goal was to identify the expressed gene for
VspB from the several paralogous Vsp genes in the B. turicatae genome and then clone it. The sequence of the expressed
VspB gene confirmed that it was member of the Vsp-OspC family, and it
revealed distinctive features as well.
Strains and culture conditions.
The clonal populations of
serotypes A and B of the Oz1 strain of B. turicatae were
described previously (19). Serotype identity was confirmed
by polyacrylamide gel electrophoresis (PAGE), reactivity with
monoclonal antibodies in Western blots, and indirect immunofluorescence assay (10, 43). Spirochetes in the blood were cultured at 34°C in BSK II medium supplemented with 12% rabbit serum
(3) and counted in a Petroff-Hauser counting chamber under
phase contrast microscopy (48). Culture harvests were
prepared and frozen as concentrated cell suspensions at Mouse infections.
Four- to six-week-old male or female CB-17
scid mice (Charles River Laboratories, Wilmington, Mass.)
were inoculated intraperitoneally with 0.1 ml of phosphate-buffered
saline (PBS), pH 7.4, alone or containing 103 spirochetes.
Tissues were obtained after euthanization with methoxyflurane and whole
body perfusion with PBS (37) and processed as described below. Blood was terminally collected from anesthetized mice by cardiac
puncture, the citrated blood was centrifuged for 2 s at 12,000 × g, and the plasma supernatant was stored in
aliquots with 10% dimethyl sulfoxide at Immunofluorescence and immunohistochemistry.
The origins of
VspA- and VspB-specific murine monoclonal antibodies 1H12 and 5F12
(18) and Borrelia spp. flagellin-specific monoclonal antibody H9724 (8) have been described. Plasma
aliquots or culture aliquots were thawed and centrifuged
(12,000 × g for 3 min). The cell pellet was
immediately resuspended with an equal volume of packed, washed rat
erythrocytes in 50% fetal calf serum in PBS. Thin smears of the
spirochete and blood suspension were fixed with methanol for 15 min
(10). Tibiotarsal joints of mice were obtained after 15 days
of infection and were decalcified, fixed with formaldehyde, embedded in
paraffin, cut as 5-µm sections with a microtome, deparaffinized, and
prepared for antibody incubations as described previously
(37). Blood smears and joint tissue sections were incubated
with hybridoma supernatant diluted 1:10 in 1% bovine serum albumin
(BSA) in PBS for 20 min or in 1% ovalbumin in 3% Brij35-0.1 M Tris
(pH 7.3) for 1 h, respectively. The specimens were then washed
with PBS, incubated with fluorescein-conjugated F(ab')2
fragment of goat anti-mouse immunoglobulin (Kirkegaard & Perry) that
was diluted 1:15 in BSA-PBS or 1:50 in ovalbumin-Tris, and then washed
again with PBS.
0019-9567/99/$04.00+0
Copyright © 1999, American Society for Microbiology. All rights reserved.
Characterization of VspB of Borrelia
turicatae, a Major Outer Membrane Protein Expressed in Blood and
Tissues of Mice

Irvine, Irvine,
California 926971; Department of
Microbiology, University of Texas Health Science Center at San Antonio,
San Antonio, Texas 782842; and
Department of Neuropathology, Armed Forces Institute of Pathology,
Washington, D.C. 203063
![]()
ABSTRACT
Top
Abstract
Introduction
Materials and Methods
Results
Discussion
References
![]()
INTRODUCTION
Top
Abstract
Introduction
Materials and Methods
Results
Discussion
References
![]()
MATERIALS AND METHODS
Top
Abstract
Introduction
Materials and Methods
Results
Discussion
References
80°C with
10% (vol/vol) dimethyl sulfoxide as previously described
(37). Escherichia coli strains were grown in
Luria-Bertani medium (Difco, Detroit, Mich.).
80°C.
20°C, rapidly frozen with Ultrafreeze spray
(Fisher Scientific), and stored at
80°C until sectioning. Frozen
hearts were embedded in OCT (optimum cutting temperature) compound
(Tissue-Tek) at
20°C, sectioned (15 µm) in a Reichert-Jung cryostat, mounted on glass slides precoated with gelatin, and stored at
4°C until use. All slides were fixed with 100% methanol for 10 min
prior to immunostaining by using a three-step streptavidin-peroxidase technique at room temperature with a Biogenex kit and reagents (San
Ramon, Calif.). Nonspecific binding was reduced by blocking slides with
10% mouse serum in 1× blocking solution for 1 h, and endogenous
peroxidase activity was reduced by preincubation with 3%
H2O2 for 30 min. Monoclonal antibody in ascites
fluids and diluted 1:500 in Biogenex diluent buffer was the primary
reagent. The secondary reagent was a biotinylated goat anti-mouse
polyclonal antibody, and the tertiary reagent was streptavidin labeled
with horseradish peroxidase. The primary reagent was incubated for 1 h, and the secondary and tertiary reagents were incubated for 30 min. The slides were then incubated in chromogen solution
(3,3-diaminobenzidine tetrahydrochloride in 0.24%
H2O2) for 5 min and Mayer's hematoxylin counterstain for 2 min. Each incubation was separated by three washes
with 1× OptiMax wash buffer (Biogenex).
PAGE and Western blot analysis. Cell aliquots were thawed, centrifuged at 12,000 × g at 4°C for 3 min, resuspended in PBS with 5 mM MgCl2, and centrifuged again. The whole cell pellets were immediately resuspended in a sample buffer with 50 mM dithiothreitol and subjected to PAGE with 12% acrylamide as described previously (10). The gel was stained with Coomassie blue. For Western blot analysis, proteins were transferred onto 0.45-µm Immobilon membranes (Millipore Corp., Bedford, Mass.), and the membranes were blocked in 3% milk in 10 mM Tris (pH 7.4)-150 mM NaCl (TS). After washing in 0.3% milk-TS, the membranes were incubated with a 1:100 dilution of monoclonal antibody in ascites fluid in 0.3% milk-TS. Alkaline phosphatase-conjugated protein A/G (Pierce) at a 1:5,000 dilution was used as a second ligand, and the binding was detected with tetrazolium chloride-5-bromo-4-chloro-3-indolylphosphatase p-toluidine salt (Pierce).
Protein purification, digestion, and amino acid sequencing. A Vsp-enriched extract was obtained by differential solubilization in the detergent octyl-glucopyranoside and subjected to high-performance liquid chromatography (HPLC) with a C-4 column essentially as described previously (11). Purified VspB was digested with endoproteinase Glu-C (Boehringer Mannheim, Indianapolis, Ind.) in 25 mM ammonium bicarbonate-0.05% sodium dodecyl phosphate (SDS). Proteolytic products were separated either (i) by PAGE (20% acrylamide) followed by electrophoretic transfer to polyvinyl difluoride membranes (Millipore) as described previously (18) or (ii) by HPLC as described (11). N-terminal amino acid sequences of purified peptides were determined by Richard Cook at the Protein Chemistry Core Facility, Baylor College of Medicine.
Nucleic acid methods.
Total DNA or total RNA were prepared
from spirochetes as described previously (33). Plasmid DNA
from E. coli was extracted with a plasmid extraction kit
(Qiagen, Chatsworth, Calif.). Oligonucleotides for probes and primers
were synthesized on an Applied Biosystems DNA synthesizer. Restriction
enzymes were from Boehringer Mannheim. DNA restriction fragments were
isolated from Pure Elute agarose (Invitrogen, San Diego, Calif.) with
an electroelution instrument (International Biotechnologies, Inc., New
Haven, Conn.). Oligonucleotides were 5' end labeled with
[
-32P]ATP by using polynucleotide T4 kinase
(Boehringer Mannheim) and purified in Nensorb-20 columns (DuPont,
Boston, Mass.). Alternatively, oligonucleotides were 3' end labeled by
using dUTP-digoxigenin and deoxyterminal transferase with the Genius
kit (Boehringer Mannheim). Southern and Northern blots were performed
as described before (33). Nucleotides were transferred onto
0.45-µm-pore-size Nytran membranes (Schleicher & Schuell).
Hybridizations were done in 6× SSC (1× SSC is 0.15 M NaCl plus 0.015 M sodium citrate), and washes were done in 0.1× SSC-0.1% SDS-1 mM
EDTA. A plasmid containing the flaB gene of B. turicatae has been described previously (37).
RT-PCR. Total RNA was treated with RNase-free DNase I (Boehringer Mannheim) at 1 U of RNA per µg for 15 min at 23°C. Reverse transcriptase (RT) PCR was performed with the rTth reverse transcriptase RNA PCR kit (Perkin-Elmer) with the following conditions for a Perkin-Elmer thermal cycler: 30 cycles of 94°C for 1 min, 50°C for 1 min, and 72°C for 2 min, with a final extension of 7 min at 72°C. As controls, RT-PCR was performed on RNA in the absence of Mg2+ and on RNA that had been treated with DNase-free RNase (Boehringer Mannheim).
DNA cloning and sequencing.
Eluted DNA was ligated into
pUC19 digested with EcoRI and PstI, pUC18
digested with SmaI, or pBR322 digested with PstI.
The ligation products were transformed into E. coli SURE or
XL-1 MRF' Blue-Kan cells (Stratagene). RT-PCR products were ligated
into the pCRII vector and transformed into E. coli INV
F'
cells (Invitrogen). Transformants were identified by hybridization with
oligonucleotides. Sequences of both strands of the inserts were
determined by the dideoxy chain termination method on double-stranded
templates with Sequenase (United States Biochemical, Cleveland, Ohio)
and custom primers. The vspB gene was cloned into the
pET-15b (Novagen, Madison, Wis.) plasmid vector in E. coli
BL21(DE3), and recombinant VspB was expressed as a fusion protein after
induction with isopropyl-
-D-thiogalactopyranoside as
described previously (18).
Sequence analysis. Sequences were analyzed with Genetics Computer Group Sequence Analysis software, version 7.3 (24a), MacDNASIS (Hitachi, San Bruno, Calif.), and PHYLIP, version 3.5c (23, 49). Overall hydrophobicity values were determined by the Kyte-Doolittle procedure (29).
Nucleotide sequence accession numbers. The sequence of vspB and its 5' and 3' flanking sequences has been assigned GenBank accession no. AF049852. vspD, a gene that is nearly identical to vspB in its first 200 nucleotides, has been assigned GenBank accession no. AF129737 (38). For the comparison of protein sequences, the following Borrelia sp. sequences (with accession numbers in parentheses) were used: B. burgdorferi sensu stricto OspC proteins from strains B31 (X69596), 297 (U08284), DN127 (U04280), 25015 (U04282), 2591 (U01892), and CA11 (L25413); B. afzelii OspC proteins from strains PKo (X62162) and ACA1 (L42892); B. garinii OspC proteins from strains PHei (X83553), Ip90 (L42886), SL14 (X84784), and HT37 (D49381); B. hermsii Vmp proteins 1 (L33870), 11 (L33900), 13 (L33901), 2 (L33897), 26 (L26497), 27 (L33903), 3 (L04789), 33 (L24911), and 8 (L33899); B. turicatae VspA (U85413); and B. miyamotoi Vmp protein (D78201).
| |
RESULTS |
|---|
|
|
|---|
VspB is expressed in vivo. B. turicatae produced abundant amounts of VspB while growing in the culture medium (19, 37), but it was not known whether this protein was expressed by spirochetes inside their mammalian hosts. To determine this, we directly examined spirochetes in the blood and in tissues and compared the results with those of spirochetes grown in vitro.
(i) PAGE and Western blot analysis. Mice in groups of five were inoculated on day 0 with 103 serotype B cells or with PBS alone as a control. By day 5 the infected mice had approximately 4 × 107 spirochetes per milliliter of blood, and at this time infected and control mice were euthanized and exsanguinated. A brief centrifugation of the citrated blood from infected mice yielded a supernatant rich in spirochetes as well as platelets. Equal volumes of blood from uninfected mice yielded plasma with platelets alone. After further centrifugation at a higher speed, the spirochetes and platelets in the pellets were washed with PBS and resuspended in a sample buffer. Cultured bacteria were prepared by inoculating BSK II medium with serotype B-infected mouse blood; after two serial passages, or approximately 15 generations, cells were harvested by the same procedures. Equivalent numbers of spirochetes in each sample were subjected to PAGE and Western blot analysis.
Figure 1 shows Coomassie blue-stained proteins of samples of uninfected plasma, infected plasma, and culture medium. The lane of infected plasma is overloaded in comparison to the lane of uninfected plasma in this experiment. Several of the proteins with apparent sizes of greater than 43 kDa were present in noninfected plasma as well as in the plasma of infected mice; these proteins are most likely derived from platelets. Present only in the samples containing spirochetes in the plasma or the broth medium was a protein with an apparent size of 21 kDa. Western blotting with the monoclonal antibody showed that this protein was VspB. In a separate experiment, a comparably overloaded lane of uninfected plasma did not reveal an immunoreactive protein of 21 kDa by Western blotting (data not shown).
|
(ii) Immunofluorescence and immunohistochemistry. In a previous study of mice infected with serotype B, spirochetes in joints were identified by direct immunofluorescence with a conjugated Borrelia genus-specific polyclonal antiserum (37), which is evidence of the spirochetes' presence in tissue but not of Vsp expression. For the present study we used indirect immunofluorescence with a monoclonal antibody directed against VspB of serotype B cells. The positive control was an antibody to the flagellin of borrelias; this antibody had been shown to identify spirochetes in fixed smears and sections (8, 36). The negative control was the antibody to VspA of B. turicatae (18).
On day 15 of infection of serotype B, four scid mice were bled and euthanized; their joints were taken after perfusion. Smears of blood spirochetes and the joint tissue sections were examined by indirect immunofluorescence with the monoclonal antibodies. The results of these studies are summarized in Table 1. Figure 2 shows the binding of blood spirochetes and cultured spirochetes by monoclonal antibodies to VspB (Fig. 2A) and to flagellin (Fig. 2B). The anti-VspB and anti-flagellin monoclonal antibodies were applied to fixed, paraffin-embedded joint tissue sections of the mice infected with serotype A or B. The antibodies gave the same results as what had previously been obtained with the more broadly reactive polyclonal antiserum (37; Table 1). The monoclonal antibody to VspA did not bind to the spirochetes in the blood or joints of the serotype B-infected mice but did bind to spirochetes in tissues of mice infected with serotype A.
|
|
Characterization of VspB and expressed vspB. Having demonstrated the expression of VspB in the blood, joints, and hearts of infected mice, we next sought the gene coding for this protein. Given the large number of paralogous vsp genes in B. hermsii and, thus, the possibility of mistaken identification, we used three independent means to confirm that the cloned gene was vspB. The first was partial peptide sequencing of purified native VspB. The second strategy was to use RT-PCR to identify transcribed vsp sequences. The third method was to confirm the antigenic identity of the cloned gene with the VspB-specific monoclonal antibody.
(i) Amino acid sequencing. Glu-C endoproteinase fragments of purified VspB were separated by electrophoresis or HPLC, and these sequences were obtained from three peptides: peptide 1, LAKAIKKKIQAGGLQDDTDN; peptide 2, TAFLNKLKSE; and peptide 3, NATLGAASAAVS. Peptide 1 at its start was nearly identical to a smaller peptide that was previously shown to be common to VspA and VspB (18). Peptides 2 and 3 conjoined were found to be highly similar to Vsp27 of B. hermsii (GenBank accession no. L33903; AFIIKLKNQHATLGAADGAAT) and to an OspC protein of B. afzelii (accession no. AF098942; AFTNKLKNSHAELGAANHATT).
(ii) Identification of a serotype B-specific transcript. Given the similarity of VspB to known Vsp and OspC proteins, we used sequences common to several different vsp genes to amplify the vsp transcript in serotype B cells by RT-PCR. The reverse primer (5'CCGATAGCTTTAGCAAGC3') was based on an internal sequence that is about 210 bp downstream of several vsp start sites in B. hermsii (43) and in vspA of B. turicatae (positions 273 to 290 of GenBank accession no. U85413). The forward primer (5'AAGTGCGATAATAATGACTTTATT3') represented the conserved signal peptide sequence of Vsp proteins (positions 76 to 99 of GenBank accession no. LO4789). By using these primers a 210-bp product was obtained by RT-PCR and cloned. Sequence analysis revealed that it was similar to but distinct from the 5' end of vspA (not shown).
The differences between vspA and the RT-PCR product from serotype B cells allowed the design of probes specific for VspA-expressing cells (A1; 5'AACAGCATCGGTAATGTTTTTAGT3') and VspB-expressing cells (B1; 5'CAAAAGCAACAGTGTCTTTTATGT3'). Northern blots of RNA from serotype A and B cells were probed with these two oligonucleotides (Fig. 3). The flagellin transcript was probed as a positive control with the B. turicatae flagellin gene under the same hybridization and washing conditions described previously (37). The blot showed that the RT-PCR-derived sequence was specific for a transcript in serotype B cells. Opposite results were obtained with the vspA-specific probe. To verify that the serotype B-specific transcript was vspB, we designed an oligonucleotide probe based on the sequence of peptide 1 (B2; 5'CATTCTTGAAGACCACCTGCTTGAA3'). Probe B2 hybridized to the same-sized transcript as probe B1 in serotype B RNA (Fig. 3) but not serotype A RNA (not shown).
|
(iii) Expression of vspB is associated with a unique restriction fragment. Probes B1 and B2 were next used to probe Southern blots of restriction enzyme digests of total DNA of serotypes A and B. Probe B1 hybridized to a 1.7-kb RsaI fragment in serotype B DNA but not serotype A DNA (Fig. 4). The probe hybridized to seven other RsaI fragments that were common to both serotypes, an indication that identical or near-identical sequences were at several locations in the genome. Probe B2 hybridized to fewer fragments of an EcoRI-PstI digest: serotypes A and B both had hybridizing fragments of 0.7 and 3 kb, and serotype B had a unique 2.7-kb fragment (Fig. 4). This latter fragment, as well as the overlapping 1.7-kb RsaI expression-linked fragment of serotype B, was cloned and sequenced.
|
(iv) Sequence of the expressed vspB expression site. Figure 5 shows the sequence of an open reading frame (ORF) of 664 nucleotides (positions +21 to 667) and it 5' and 3' flanking regions. This would encode a protein of 216 amino acids. The evidence that this ORF encoded VspB was the following: (i) the deduced protein encoded by the ORF contained all of the partial peptide sequences obtained from VspB; (ii) the genomic clone matched in sequence the partial sequence obtained by RT-PCR (not shown); (iii) when the gene was subcloned into an expression vector the fusion protein was bound by a monoclonal antibody specific for VspB but not by antibody to VspA (Fig. 6). The fusion partner for the vspB gene accounts for the larger size of the recombinant protein (18).
|
|
10 (TAAAAT) and
35 sequences (TTGAAA),
which are consistent with a
70 promoter and which
were found upstream of expressed vspA (18). The
N-terminal amino acid sequence of the ORF is highly similar to the
signal peptide of Borrelia sp. lipoproteins (13-15,
20). Following the stop codon at position +668 were another stop
codon and two potential rho-independent terminators.
Comparison of the vspB expression site with other
Borrelia promoters.
Figure 5 shows an additional 0.4 kb of sequence upstream of the expressed vspB gene. In the
previous study of the expressed vspA gene, the 5' sequence
obtained extended only to the
35 element of the promoter
(18). With the additional upstream sequence obtained in the
present study, we compared the vspB promoter region with
known promoters for two orthologous proteins: OspC of B. burgdorferi and Vsp33 of B. hermsii (Fig.
7). The sequences around the
35 and
10 elements of the three
70-type promoters are very
similar. The spacing between the promoter elements, the ribosomal
binding sequence, and start codons are the same or nearly identical
among the sequences. Upstream of the
35 elements the three sequences
are highly AT-rich. The major difference between the promoter regions
is the presence of two inverted repeats upstream of the ospC
promoter but not either the vsp33 or vspB
promoter.
|
Comparison of VspB with other Vsp-OspC proteins. Overall, VspB and VspA of B. turicatae were 68% identical in amino acid sequence; the vspA and vspB genes were 76% identical in nucleotide sequence. The predicted VspB protein was found to be highly similar in overall sequence to the following selected Vsp and OspC proteins (with the percent identity in amino acid sequence): Vsp33 (56%), Vsp13 (55%), Vsp1 (54%), Vsp2 (52%), Vsp26 (50%), and Vsp11 (48%) of strain HS1 of B. hermsii; OspC (47%) of strain B31 of B. burgdorferi; OspC (46%) of strain PKo of B. afzelii; and OspC (44%) of strain Ip90 of B. garinii.
As expected, VspA and VspB were most similar at their N and C termini (18, 20). The more variable central regions observed in VspB, VspA, and other Vsp-OspC proteins confer different properties on these proteins; among these are hydrophobicity and protein charge. For the hydrophobicity and isoelectric point predictions, we omitted the signal peptide sequence which is highly hydrophobic and is posttranslationally removed. By the Kyte-Doolittle algorithm, processed VspB, with an average hydrophobicity value of
0.2, was less
hydrophobic than VspA, which has a predicted hydrophobicity value of
0.1 (18). In this respect VspB resembled other Vsp and
OspC proteins. VspB stood apart from other Vsp-OspC proteins in another
characteristic. Table 2 shows the
predicted isoelectric points of 25 known Vsp and selected OspC
proteins. With a predicted pI of 9.39, VspB is more positively charged
than the Vsp-OspC proteins of other Borrelia spp. Vsp-OspC
proteins, which ranged in pI from 5.12 to 9.12 and had a mean pI of
6.68.
|
| |
DISCUSSION |
|---|
|
|
|---|
Immunodeficient mice infected with B. turicatae serotype B have a persistent spirochetemia accompanied by severe arthritis and carditis, as well as cranial neuritis and eye disease (19, 37). Serotype B infections are also fatal for newborn immunocompetent mice (37). The greater virulence of serotype B in comparison to serotype A is associated with expression by the spirochetes of VspB instead of VspA. But this conclusion was based on phenotypes of spirochetes under in vitro growth conditions. It was possible that what appeared to be a key determinant of virulence was not expressed in the mouse environment. Accordingly, we first investigated whether VspB was produced by spirochetes in infected mice. The PAGE and Western blot experiments indicated that VspB was an abundant in spirochetes in the blood as it was in cells grown in culture medium. Although we used scid mice to minimize immune selection of other serotypes in these studies, there is evidence that VspB is also expressed in more immunocompetent mice: BALB/c and CBA/N mice produced antibodies to VspB in response to infection and spirochetes in the blood of infant C3H/HeN mice were identified as VspB positive by indirect immunofluorescence (18, 39).
The study further showed that VspB was expressed in two tissues with particularly marked involvement during the infection: the joints and heart. Although a vspA gene was present in serotype B cells (18), there was no evidence that vspA was expressed by the serotype B cells in either the culture medium or the mouse. Although we cannot rule out the action of another protein besides VspB in affecting the virulence of serotype B, the direct demonstration of in vivo expression justifies further study of VspB structure and function.
As has been the case in other studies of Vsp-OspC and Vlp proteins of Borrelia spp., the identification of the gene that encodes the protein of interest is not straightforward. This is primarily because there are numerous vsp and vlp genes in the genome, and two or more genes can share short regions of sequence over their lengths (18, 20, 43). Thus, probes may hybridize to more than one fragment or cloned sequence (33). In the present study, an oligonucleotide probe for the vspB sequence hybridized to several RsaI fragments. The extra hybridizing fragment unique to serotype B cells in Southern blots allowed the identification of the expressed gene. One of the hybridizing bands in both serotype A and B DNA is probably the silent or archived form of the vspB gene, as has been found for vlp and vsp genes of B. hermsii (5, 42). The identification and characterization of the archived versions of vspA and vspB are the object of another study. The other hybridizing bands may represent genes or pseudogenes that have a sequence similar to the probe. The encoded product of the vspD gene was distinguished from VspB by the amino acid sequences obtained by peptide sequencing of the VspB protein.
The present study also allowed a more extensive comparison of the
promoter region for the vspA and vspB genes of
B. turicatae to other well-defined Borrelia sp.
promoters. The promoter region for vspB was not like the
vlp-vsp promoter at the telomeric expression site of 28- to
32-kb linear plasmids B. hermsii (5, 6) or the
promoter for the ospAB operon of B. burgdorferi
(26, 47). One notable difference was the lack in B. turicatae of a T-rich region, which characterizes the latter two
promoter regions, upstream of the
35 element (5, 6, 47).
The B. turicatae vsp promoter resembled instead the
promoters for the ospC gene of B. burgdorferi and
vsp33 gene of B. hermsii (Fig. 6). From the
35
element to the start codon the vspB, vsp33, and
ospC promoters are highly similar in sequence.
The ospC gene is located on a circular plasmid in B. burgdorferi (24, 35, 44), and the vsp33 gene is located on an approximately 50-kb linear plasmid of B. hermsii (9, 20). The ospC gene is expressed in ticks after blood feeding begins and in mammalian hosts during infection (21, 34, 46). OspC is expressed in vitro but only above a certain temperature or when other plasmids are missing (44, 46). The expression of vsp33 occurs in vitro; indeed, its original designation (VmpC) derives from its identification first as a "culture serotype" (10, 20, 48). More recently, Schwan and Hinnebusch have shown that the Vsp33 protein of infectious B. hermsii is produced in the salivary glands of the tick vector but not in the mouse host (45). In contrast, VspB of B. turicatae is expressed in vivo in the mouse, as well as in vitro. It is not known whether VspB or VspA is expressed by B. turicatae in the tick. Although VspB is expressed in vivo as well as in vitro, the similarity in promoter regions suggests that there may be environmental determinants of vsp expression in B. turicatae as well.
Finally, the predicted sequence of VspB provides some insights for the design of structure-function studies of Vsp and OspC proteins. The differences between serotypes A and B in tissue localization and virulence indicate an important role of Vsp proteins in interactions with the host. At an early stage of these studies, we saw that the neurotropism of serotype A is associated with a particularly hydrophobic Vsp protein (18). Serotype A appears to be more suited for leaving the vascular space than serotype B (19). This migration may be aided by the greater hydrophobicity of VspA in comparison to VspB. In contrast, VspB is notable for its exceptionally basic pI (Table 2). This higher charge may serve the pathogen population because of the retention of spirochetes circulating in the blood or by an association with endothelial cells, thus increasing the probability of transmission by a blood-feeding vector. According to this hypothesis, the serotype A phenotype represents an alternative strategy for survival through the persistence of the pathogen in the brain and other immunoprivileged sites of a host.
| |
ACKNOWLEDGMENTS |
|---|
We thank Lynda Bonewald for performing chromatography, Tatiana Kerentseva for assistance in producing recombinant proteins, and Carol Carter for technical assistance and advice.
This work was supported by grant AI24424 from the National Institutes of Health and a grant from the Arthritis Foundation.
| |
FOOTNOTES |
|---|
*
Corresponding author. Mailing address: Department of
Microbiology & Molecular Genetics, B240 Med Sci I, University of
California
Irvine, Irvine, CA 92697-4025. Phone: (949) 824-5626. Fax:
(949) 824-8598. E-mail: abarbour{at}uci.edu.
Present address: Medical Entomology Research and Training
Unit/Guatemala, Division of Parasitic Diseases/NCID, Centers for Disease Control and Prevention, Chamblee, GA 30341.
Editor: D. L. Burns
| |
REFERENCES |
|---|
|
|
|---|
| 1. | Akins, D. R., S. F. Porcella, T. G. Popova, D. Shevchenko, S. I. Baker, M. Li, M. V. Norgard, and J. D. Radolf. 1995. Evidence for in vivo but not in vitro expression of a Borrelia burgdorferi outer surface protein F (OspF) homologue. Mol. Microbiol. 18:507-520[Medline]. |
| 2. | Barbour, A. G. 1987. Immunobiology of relapsing fever. Contrib. Microbiol. Immunol. 8:125-137[Medline]. |
| 3. | Barbour, A. G. 1984. Isolation and cultivation of Lyme disease spirochetes. Yale J. Biol. Med. 57:521-525[Medline]. |
| 4. |
Barbour, A. G.,
O. Barrera, and R. C. Judd.
1983.
Structural analysis of the variable major proteins of Borrelia hermsii.
J. Exp. Med.
158:2127-2140 |
| 5. | Barbour, A. G., N. Burman, C. J. Carter, T. Kitten, and S. Bergström. 1991. Variable antigen genes of the relapsing fever agent Borrelia hermsii are activated by promoter addition. Mol. Microbiol. 5:489-493[Medline]. |
| 6. |
Barbour, A. G.,
C. J. Carter,
N. Burman,
C. S. Freitag,
C. F. Garon, and S. Bergström.
1991.
Tandem insertion sequence-like elements define the expression site for variable antigen genes of Borrelia hermsii.
Infect. Immun.
59:390-397 |
| 7. |
Barbour, A. G., and S. F. Hayes.
1986.
Biology of Borrelia species.
Microbiol. Rev.
50:381-400 |
| 8. |
Barbour, A. G.,
S. F. Hayes,
R. A. Heiland,
M. E. Schrumpf, and S. L. Tessier.
1986.
A Borrelia-specific monoclonal antibody binds to a flagellar epitope.
Infect. Immun.
52:549-554 |
| 9. | Barbour, A. G., M. Schrumpf, and C. Sohaskey. Antigenic variation by expression site switching in the relapsing fever agent Borrelia hermsii. Submitted for publication. |
| 10. |
Barbour, A. G.,
S. L. Tessier, and H. G. Stoenner.
1982.
Variable major proteins of Borrelia hermsii.
J. Exp. Med.
156:1312-1324 |
| 11. |
Barstad, P. A.,
J. E. Coligan,
M. G. Raum, and A. G. Barbour.
1985.
Variable major proteins of Borrelia hermsii. Epitope mapping and partial sequence analysis of CNBr peptides.
J. Exp. Med.
161:1302-1314 |
| 12. | Barthold, S. W., E. Fikrig, L. K. Bockenstedt, and D. H. Persing. 1995. Circumvention of outer surface protein A immunity by host-adapted Borrelia burgdorferi. Infect. Immun. 63:2255-2261[Abstract]. |
| 13. | Bergström, S., V. G. Bundoc, and A. G. Barbour. 1989. Molecular analysis of linear plasmid-encoded major surface proteins, OspA and OspB, of the Lyme disease spirochaete Borrelia burgdorferi. Mol. Microbiol. 3:479-486[Medline]. |
| 14. |
Brandt, M. E.,
B. S. Riley,
J. D. Radolf, and M. V. Norgard.
1990.
Immunogenic integral membrane proteins of Borrelia burgdorferi are lipoproteins.
Infect. Immun.
58:983-991 |
| 15. | Burman, N., S. Bergström, B. I. Restrepo, and A. G. Barbour. 1990. The variable antigens Vmp7 and Vmp21 of the relapsing fever bacterium Borrelia hermsii are structurally analogous to the VSG proteins of the African trypanosome. Mol. Microbiol. 4:1715-1726[Medline]. |
| 16. | Cadavid, D., and A. G. Barbour. 1998. Neuroborreliosis during relapsing fever: review of the clinical manifestations, pathology, and treatment of infections in humans and experimental animals. Clin. Infect. Dis. 26:151-164[Medline]. |
| 17. | Cadavid, D., V. Bundoc, and A. Barbour. 1993. Experimental infection of the mouse brain by a relapsing fever Borrelia species: a molecular analysis. J. Infect. Dis. 168:143-151[Medline]. |
| 18. | Cadavid, D., P. M. Pennington, T. A. Kerentseva, S. Bergström, and A. G. Barbour. 1997. Immunologic and genetic analyses of VmpA of a neurotropic strain of Borrelia turicatae. Infect. Immun. 65:3352-3360[Abstract]. |
| 19. |
Cadavid, D.,
D. D. Thomas,
R. Crawley, and A. G. Barbour.
1994.
Variability of a bacterial surface protein and disease expression in a possible mouse model of systemic Lyme borreliosis.
J. Exp. Med.
179:631-642 |
| 20. |
Carter, C. J.,
S. Bergström,
S. J. Norris, and A. G. Barbour.
1994.
A family of surface-exposed proteins of 20 kilodaltons in the genus Borrelia.
Infect. Immun.
62:2792-2799 |
| 21. | de Silva, A. M., and E. Fikrig. 1997. Arthropod- and host-specific gene expression by Borrelia burgdorferi. J. Clin. Investig. 99:377-379[Medline]. |
| 22. |
de Silva, A. M.,
S. R. Telford,
L. R. Brunet,
S. W. Barthold, and E. Fikrig.
1996.
Borrelia burgdorferi OspA is an arthropod-specific transmission-blocking Lyme disease vaccine.
J. Exp. Med.
183:271-275 |
| 23. | Felsentein, J. 1996. Inferring phylogenies from protein sequences by parsimony, distance, and likelihood methods. Methods Enzymol. 266:418-427[Medline]. |
| 24. | Fraser, C. M., S. Casjens, W. M. Huang, G. G. Sutton, R. Clayton, R. Lathigra, O. White, K. A. Ketchum, R. Dodson, E. K. Hickey, M. Gwinn, B. Dougherty, J. F. Tomb, R. D. Fleischmann, D. Richardson, J. Peterson, A. R. Kerlavage, J. Quackenbush, S. Salzberg, M. Hanson, R. van Vugt, N. Palmer, M. D. Adams, J. Gocayne, and J. C. Venter. 1997. Genomic sequence of a Lyme disease spirochaete, Borrelia burgdorferi. Nature 390:580-586[Medline]. |
| 24a. | Genetics Computer Group. 1991. Sequence analysis software, version 7.3. Genetics Computer Group, Madison, Wis. |
| 25. |
Hinnebusch, B. J.,
A. G. Barbour,
B. I. Restrepo, and T. G. Schwan.
1998.
Population structure of the relapsing fever spirochete Borrelia hermsii as indicated by polymorphism of two multigene families that encode immunogenic outer surface lipoproteins.
Infect. Immun.
66:432-440 |
| 26. |
Jonsson, M.,
L. Noppa,
A. G. Barbour, and S. Bergström.
1992.
Heterogeneity of outer membrane proteins in Borrelia burgdorferi: comparison of osp operons of three isolates of different geographic origins.
Infect. Immun.
60:1845-1853 |
| 27. |
Kitten, T., and A. G. Barbour.
1990.
Juxtaposition of expressed variable antigen genes with a conserved telomere in the bacterium Borrelia hermsii.
Proc. Natl. Acad. Sci. USA
87:6077-6081 |
| 28. |
Kitten, T.,
A. V. Barrera, and A. G. Barbour.
1993.
Intragenic recombination and a chimeric outer membrane protein in the relapsing fever agent Borrelia hermsii.
J. Bacteriol.
175:2516-2522 |
| 29. | Kyte, J., and R. F. Doolittle. 1982. A simple method for displaying the hydropathic character of a protein. J. Mol. Biol. 157:105-132[Medline]. |
| 30. |
Marconi, R. T.,
D. S. Samuels,
T. G. Schwan, and C. F. Garon.
1993.
Identification of a protein in several Borrelia species which is related to OspC of the Lyme disease spirochetes.
J. Clin. Microbiol.
31:2577-2583 |
| 31. | Margolis, N., D. Hogan, W. Cieplak, T. Schwan, and P. Rosa. 1994. Homology between Borrelia burgdorferi OspC and members of the family of Borrelia hermsii variable major proteins. Gene 143:105-110[Medline]. |
| 32. |
Margolis, N.,
D. Hogan,
K. Tilly, and P. A. Rosa.
1994.
Plasmid location of Borrelia purine biosynthesis gene homologs.
J. Bacteriol.
176:6427-6432 |
| 33. | Meier, J., M. Simon, and A. G. Barbour. 1985. Antigenic variation is associated with DNA rearrangement in a relapsing fever borrelia. Cell 41:403-407[Medline]. |
| 34. |
Montgomery, R. R.,
S. E. Malawista,
K. J. Feen, and L. K. Bockenstedt.
1996.
Direct demonstration of antigenic substitution of Borrelia burgdorferi ex vivo: exploration of the paradox of the early immune response to outer surface proteins A and C in Lyme disease.
J. Exp. Med.
183:261-269 |
| 35. |
Padula, S. J.,
A. Sampieri,
F. Dias,
A. Szczepanski, and R. W. Ryan.
1993.
Molecular characterization and expression of p23 (OspC) from a North American strain of Borrelia burgdorferi.
Infect. Immun.
61:5097-5105 |
| 36. | Park, H. K., B. E. Jones, and A. G. Barbour. 1986. Erythema chronicum migrans of Lyme disease: diagnosis by monoclonal antibodies. J. Am. Acad. Dermatol. 15:406-410[Medline]. |
| 37. | Pennington, P. M., C. D. Allred, C. S. West, R. Alvarez, and A. G. Barbour. 1997. Arthritis severity and spirochete burden are determined by serotype in the Borrelia turicatae-mouse model of Lyme disease. Infect. Immun. 65:285-292[Abstract]. |
| 38. | Pennington, P. M. 1998. Ph.D. thesis. University of Texas Health Science Center at San Antonio, San Antonio. |
| 39. | Pennington, P. M., D. Cadavid, and A. G. Barbour. 1997. Unpublished observations. |
| 40. | Plasterk, R. H., M. I. Simon, and A. G. Barbour. 1985. Transposition of structural genes to an expression sequence on a linear plasmid causes antigenic variation in the bacterium Borrelia hermsii. Nature 318:257-263[Medline]. |
| 41. | Restrepo, B. I., and A. G. Barbour. 1994. Antigen diversity in the bacterium Borrelia hermsii through "somatic" mutations in rearranged vmp genes. Cell 78:867-876[Medline]. |
| 42. | Restrepo, B. I., C. J. Carter, and A. G. Barbour. 1994. Activation of a vmp pseudogene in Borrelia hermsii: an alternate mechanism of antigenic variation during relapsing fever. Mol. Microbiol. 13:287-299[Medline]. |
| 43. | Restrepo, B. I., C. J. Carter, T. Kitten, and A. G. Barbour. 1992. Subtelomeric expression regions of Borrelia hermsii linear plasmids are highly polymorphic. Mol. Microbiol. 6:3299-3311[Medline]. |
| 44. |
ad iene, A.,
B. Wilske,
M. S. Ferdows, and A. G. Barbour.
1993.
The cryptic ospC gene of Borrelia burgdorferi B31 is located on a circular plasmid.
Infect. Immun.
61:2192-2195 |
| 45. |
Schwan, T. G., and B. J. Hinnebusch.
1998.
Bloodstream- versus tick-associated variants of a relapsing fever bacterium.
Science
280:1938-1940 |
| 46. |
Schwan, T. G.,
J. Piesman,
W. T. Golde,
M. C. Dolan, and P. A. Rosa.
1995.
Induction of an outer surface protein on Borrelia burgdorferi during tick feeding.
Proc. Natl. Acad. Sci. USA
92:2909-2913 |
| 47. |
Sohaskey, C. D.,
C. Arnold, and A. G. Barbour.
1997.
Analysis of promoters in Borrelia burgdorferi by use of a transiently expressed reporter gene.
J. Bacteriol.
179:6837-6842 |
| 48. |
Stoenner, H. G.,
T. Dodd, and C. Larsen.
1982.
Antigenic variation of Borrelia hermsii.
J. Exp. Med.
156:1297-1311 |
| 49. | Department of Genetics, University of Washington. 1993. PHYLIP, version 3.5c. Department of Genetics, University of Washington, Seattle. |
This article has been cited by other articles:
| ||||||||||||||||||||||||||||||||||