Previous Article | Next Article 
Infection and Immunity, September 1999, p. 4801-4813, Vol. 67, No. 9
0019-9567/99/$04.00+0
Copyright © 1999, American Society for Microbiology. All rights reserved.
LcrV of Yersinia pestis Enters Infected
Eukaryotic Cells by a Virulence Plasmid-Independent Mechanism
Kenneth A.
Fields and
Susan C.
Straley*
Department of Microbiology and Immunology,
Chandler Medical Center, University of Kentucky, Lexington,
Kentucky 40536-0084
Received 18 February 1999/Returned for modification 2 April
1999/Accepted 28 May 1999
 |
ABSTRACT |
Yersinia pestis is the causative agent of bubonic
plague and possesses a set of plasmid-encoded, secretable virulence
proteins termed LcrV and Yops which are essential for survival in
mammalian hosts. Yops and LcrV are secreted by a type III mechanism
(Ysc), and Yops are unidirectionally targeted into the cytosol of
associated eukaryotic cells in a tissue culture infection model. LcrV
is required for Yops targeting, and recent findings have revealed that
it can localize to the bacterial surface; however, its fate in this
infection model has not been investigated in detail. In this study, we
compared the localization of LcrV to that of the targeted proteins YopE
and YopM by immunoblot analysis of fractions of
Yersinia-infected HeLa cultures or by laser-scanning
confocal microscopy of infected monolayers. Both LcrV and YopE were
secreted by contact-activated, extracellularly localized yersiniae and were targeted to the HeLa cell cytosol. Although a significant amount
of LcrV partitioned to the culture medium (unlike YopE), this
extracellular pool of LcrV was not the source of the LcrV that entered
HeLa cells. Unlike targeting of YopE and YopM, targeting of LcrV
occurred in the absence of a functional Ysc apparatus and other
virulence plasmid (pCD1)-expressed proteins. However, the Ysc is
necessary for LcrV to be released into the medium, and our recent work
has shown that localization of LcrV on the bacterial surface requires
the Ysc. These results indicate that two mechanisms exist for the
secretion of LcrV by Y. pestis, both of which are activated
by contact with eukaryotic cells. LcrV secreted by the Ysc reaches the
bacterial surface and the surrounding medium, whereas the second is a
novel, Ysc-independent pathway which results in localization of LcrV in
the cytosol of infected cells but not the surrounding medium.
 |
INTRODUCTION |
The genus Yersinia
contains three medically significant species: Y. pestis, the
etiologic agent of bubonic plague; and the enteropathogenic species
Y. pseudotuberculosis and Y. enterocolitica. The
ability of these facultative intracellular, gram-negative pathogens to
establish an infection in a mammalian host requires a set of antihost
proteins termed LcrV and Yops (6, 40) which are encoded on a
common ca. 70-kb virulence plasmid termed pCD1 in Y. pestis
(18, 42). LcrV and Yops are secreted by a Yop secretion
(Ysc) type III mechanism and function during an infection to prevent or
evade a host innate immune response (7). Delivery of these
proteins to host targets in vivo is most likely tightly regulated,
since strains that deploy excess Yops (17, 26) or LcrV
(60) are attenuated for virulence in a mouse model. Therefore, Yersinia have evolved an elaborate mechanism to
couple secretion to regulation of expression of LcrV and Yops.
Expression of LcrV and Yops is thermally induced by the transcriptional
activator LcrF (24). In vitro, in media containing sodium
and glutamate, maximal thermal induction is prevented by cultivation of
Yersinia in the presence of millimolar concentrations of
Ca2+ (12, 65). Under these conditions, LcrV and
Yops are minimally expressed and their secretion is blocked. Growth at
37°C in a Ca2+-deficient medium results in secretion of
maximally induced LcrV and Yops (29, 67, 73). This in vitro,
Ca2+-absence signal has been proposed to mimic an in vivo
signal manifested by intimate association with eukaryotic cells
(45, 53, 66). Y. pestis lacks several adhesin
proteins present in the enteropathogenic Yersinia, and it is
not known what promotes binding of Y. pestis to the surface
of infected cells (63). Contact induction results in
expression and secretion of LcrV and Yops, even when Ca2+
is present in the growth medium. According to a currently accepted model, Ca2+ in the absence of contact prevents thermal
induction by stabilizing a closed conformation of Ysc channels.
Blockage of channels mediated by outer-surface-bound LcrE (also called
YopN [11]) and TyeA (20) and cytoplasmic
LcrG (38) causes accumulation of LcrQ and YopD, two proteins
involved in negative feedback control of LcrF-mediated induction
(45, 72). The LcrE-, TyeA-, and LcrG-mediated block is
displaced during cultivation in the absence of Ca2+ or upon
contact with eukaryotic cells, resulting in secretion of LcrQ and YopD
and dissipation of negative feedback control.
At least six effector Yops (YopE, YopH, YopJ, YopM, YpkA, and YopT) are
delivered to the cytoplasm of infected eukaryotic cells, where they
function to disrupt cellular processes (reviewed in reference
6). Delivery entails secretion of Yops across both
membranes of extracellularly localized (51, 62),
cell-associated (44) Yersinia and subsequent
translocation or targeting across the eukaryotic plasma membrane.
Secretion from Yersinia is mediated by a Ysc secretion
system composed of at least 22 gene products (reviewed in references
6 and 40), including the inner
membrane protein YscV (formerly termed LcrD [46, 47])
and the outer membrane secretin YscC (21).
The translocator Yops (YopB and YopD) and LcrV, all of which are
encoded within the polycistronic lcrGVH-yopBD operon
(2, 33, 50), are indispensable for the targeting of Yops
(16, 37, 44, 53, 57) and may form a structure which mediates transfer of Yops from bacteria to an associated cell (5, 9). Although a Yersinia Yops targeting apparatus has not yet
been characterized, Cornelis (5) speculated that it may
resemble the needle-like structure discovered in Salmonella
typhimurium (22). Purified preparations of YopB have
membrane-disruptive activity, and YopB expressed by Yersinia
is hemolytic for sheep erythrocytes (16), indicating that
YopB probably forms part of a translocation pore in the eukaryotic cell
plasma membrane. The size of this pore is modulated by the accessory
protein YopK (17). YopD has also been suggested to be a pore
component, based on the presence of hydrophobic domains in the peptide
sequence (36), but is not essential for the hemolytic
activity of YopB (16). Although LcrV can interact with YopB
and YopD (57), there is no direct evidence that LcrV is a
pore component. Instead, findings described by Nilles et al.
(37) and Sarker et al. (57) suggest that LcrV is
required for assembly of the YopB-containing pore.
Yop secretion into eukaryotic cells is thought to occur only through
Ysc channels that make direct contact with the plasma membrane. Hence,
in tissue culture infection assays, secretion is unidirectional or
polarized, and effector Yops are targeted directly to eukaryotic cells
and not released into the medium in significant amounts. Targeting of
Yops has been demonstrated indirectly by assaying enzyme activity of
Yop-Cya reporter fusions (62) or by observing cytotoxicity
manifested as rounding up of the eukaryotic cells (7).
Direct assays for targeting have used confocal microscopy (3, 53,
58) and immunoblot analysis of fractionated cultures (25,
37).
One primary function of intracellular Yops is to impair the phagocytic
capabilities of host cells, including professional phagocytes such as
macrophages and neutrophils (56, 70). YopE (51,
52) and YopT (19) function independently to disrupt actin microfilaments, whereas YopH dephosphorylates structural components of focal adhesions (1, 43). YopJ interferes with host cell signal cascades, with resulting inhibition of tumor necrosis
factor alpha expression (39, 54, 55), and induces apoptosis
in infected macrophages (31, 32). Specific intracellular functions of YpkA and YopM have not yet been determined, but they localize to the inner face of the eukaryotic plasma membrane
(15) and nucleus (58), respectively.
LcrV is essential to virulence of Yersinia (49)
and, unlike the effector YopS, functions in multiple ways during
infection. Within yersiniae, LcrV indirectly induces Yops expression
and secretion by inactivating the inner-membrane, LcrG-mediated Ysc block (37, 38). LcrV is also essential for targeting of
secreted Yops (37, 57), and LcrV located on the
extracellular surface of Yersinia may act as a pilot for
assembly of a targeting apparatus or may function as part of a Yop
targeting complex (9). Once released from
Yersinia, LcrV may function as a diffusible modulator of
host immune responses. An LcrV-containing fusion protein was able to
prevent production of the proinflammatory cytokines tumor necrosis
factor alpha and gamma interferon (34). Preparations containing LcrV have also been shown to enhance production of the T
helper type 2-inducing cytokine interleukin-10 (35) and inhibit chemotaxis of neutrophils (70). In previous reports, we had noted that LcrV, like Yops, becomes associated with eukaryotic cells (37). Although a tissue culture infection model has
been used to characterize localization and function of Yops,
partitioning of LcrV among compartments in that model has not
previously been studied. In this study we investigated LcrV
localization and found that LcrV partitioned differently from the
vectorially targeted protein YopE. Unlike Yops, significant levels of
LcrV were detected in the medium fraction. We also demonstrate that the
HeLa cell-associated LcrV first reported by Nilles et al.
(37) corresponded to LcrV localized to the HeLa cell
cytoplasm, and LcrV did not require YopB or YopD to attain this
intracellular localization. Instead, LcrV enters eukaryotic cells by a
novel, virulence plasmid-independent pathway.
 |
MATERIALS AND METHODS |
Growth conditions, bacterial strains, and eukaryotic cell
lines.
Strains and plasmids used in this study are listed in Table
1. Unless otherwise noted,
Escherichia coli DH5
was grown in Luria-Bertani (LB)
(30) medium or on LB agar at 37°C. Y. pestis strains were cultivated in heart infusion broth (Difco Laboratories, Detroit, Mich.) at 26°C prior to infection of eukaryotic cells. Y. pestis was also cultivated at 26°C on tryptose blood
agar (Difco) during construction of the Y. pestis lcrE
strain KIM8-3233.1 and on tryptose blood agar supplemented as described
previously (28), with modifications by Nilles et al.
(37), during construction of the yopB strain
KIM8-3002.1. In an experiment not shown, LcrV, HT-VN68, and YopM were
expressed from plasmids and tested for their secretion from
pCD1
Y. pestis KIM8 growing in the defined
medium TMH (64) at 37°C without added Ca2+.
When appropriate, bacteria were grown in the presence of antibiotics used at 15 µg/ml for tetracycline, 50 µg/ml for kanamycin, or 100 µg/ml for ampicillin and streptomycin. The HeLa human epithelial cell
line was used in this study and was maintained at 37°C with 5%
CO2 in RPMI 1640 medium (RPMI; GIBCO-BRL, Grand Island,
N.Y.) supplemented with 10% (vol/vol) fetal bovine serum (FBS;
GIBCO-BRL). For experiments examining partitioning of LcrV and Yops
within infected eukaryotic cells, RPMI supplemented with FBS was
replaced with RPMI lacking FBS.
DNA methods and strain construction.
Plasmid DNA was
purified by midi or spin-prep columns (Qiagen, Inc., Studio City,
Calif.), and cloning was performed essentially as described elsewhere
(27). Selected DNA was amplified by PCR in a Perkin-Elmer
Cetus (Foster City, Calif.) GeneAmp model 2400 thermocycler using
Pfu DNA polymerase (Stratagene, La Jolla, Calif.) and
oligonucleotide primers synthesized by Genosys Biotechnologies (The
Woodlands, Tex.). Typical PCR conditions included a 10-min preincubation at 94°C followed by 30 amplification cycles.
Denaturation, annealing, and extension reactions were carried out for
30 s each at 94, 55, and 72°C, respectively. PCR fragments were
resolved on agarose gels and extracted by using a Qiaquick gel
extraction kit (Qiagen). E. coli and Y. pestis were transformed by the CaCl2 method
(27) and by electroporation (41),
respectively. p
yopB was generated by PCR amplification of
Y. pestis DNA from pAW161, using synthetic
oligonucleotides lcrH1SDA (5'
GCTAGAGCTCAGGAGGAACATATGCAACAAGAGACGACAGAC 3') and yopD921B
(5' GCTCTAGATCAGACAACACCAAAAGCGGC 3') constructed by
Williams and Straley (72). The PCR product contained the coding sequence for LcrH (also called SycD), the first 7 and last 11 residues of YopB, and YopD. The purified ca. 1.6-kb PCR fragment and
SmaI-digested pLD55 were ligated by using T4 DNA ligase
(Promega, Madison, Wis.) and used to transform E. coli
DH5
pir. p
yopB was used to create Y. pestis KIM8-3002.1 by allelic exchange of pCD1-encoded
yopB as described previously (37), and gene
replacement was confirmed by PCR. The resulting strain was confirmed to
have normal expression and secretion of YopD, which is encoded by the gene immediately downstream of yopB in the
lcrGVH-yopBD operon (data not shown). pUK4134.6, carrying an
in-frame deletion within lcrE (codons 48 to 197), was used
to replace the pCD1-encoded lcrE by allelic exchange in the
yopM insertion mutant KIM8-3233. Selection for homologous
recombination and subsequent gene replacement were done as described
elsewhere (59). Digestion of pCD1 with BamHI was
used to verify the correct deletion.
Infection assays.
Protein localization during infection of
HeLa cell monolayers was assayed essentially as described previously by
immunoblotting (9, 37) or laser-scanning confocal microscopy
(58). Briefly, HeLa cells were subcultured either into
six-well 35-mm-diameter tissue culture plates or on 12-mm-diameter
glass coverslips in 24-well cluster dishes (Costar, Cambridge, Mass.)
in RPMI with 10% (vol/vol) FBS. Monolayers were incubated at 37°C in
5% CO2 for roughly 72 h in 6-well dishes to a density
of 5 × 105 to 8 × 105 per well for
fractionation or 48 h in 24-well dishes to a density of ca.
105 for confocal analysis. Y. pestis strains
were cultivated at 26°C in heart infusion broth, harvested at an
optical density at 620 nm of ca. 1.0, and diluted directly into 37°C
RPMI lacking FBS. Isopropyl-
-D-thiogalactopyranoside
(IPTG) was added to 0.1 mM for treatments with Y. pestis
strains harboring constructs with inducible promoters. Some wells were
treated with 5 µg of cytochalasin D (Sigma) per ml 30 min before
infection and then throughout the infection period (58).
This treatment has been shown to have no effect on targeting of YopM or
YopE by Y. pestis (58) or on viability of the
bacteria for at least 1 h (8). It has been confirmed to
abolish invasion (to below detection) of HeLa cells (8).
Immediately before infection, HeLa cells were washed twice with RPMI
lacking FBS, and bacteria were added to wells at a multiplicity of
infection (MOI) of 10. Plates were then centrifuged at 200 × g for 5 min to achieve contact between bacteria and target
cells and incubated at 37°C in 5% CO2 for 4 h.
Gentamicin (GIBCO-BRL) was added to wells to 7.5 µg/ml 30 min
postinfection for experiments in which extracellular bacteria were
killed. After infection, cultures were either fractionated for
immunoblot analysis or fixed and stained for microscopic analysis. For
culture fractionation, one replicate per infecting strain was treated
for 5 min at 37°C in 5% CO2 with 100 µg of trypsin
(Sigma) per ml. The trypsin treatment was terminated by addition of a
protease inhibitor cocktail (Pefabloc, leupeptin, and aprotinin; all
from Boehringer Mannheim Corp., Indianapolis, Ind.) added to each well
such that each inhibitor was present at 20 µg/ml. Media were then
removed from wells and passed through 0.2-µm-pore-size filters into
tubes on ice, and proteins were precipitated by treatment with 10%
(vol/vol) (final concentration) trichloroacetic acid (TCA) on ice for
2 h to overnight. Infected monolayers were washed twice with
phosphate-buffered saline (PBS; 135 mM NaCl, 2.7 mM KCl, 10 mM
Na2HPO4, 1.8 mM KH2PO4 [pH 7.4]) and lysed by treatment as previously described with ice-cold H2O containing protease inhibitors at 2 µg/ml
each (58) or by disruption in RPMI with a Kontes homogenizer
(B pestle, 100 strokes). Lysed cell fractions were then centrifuged at
4°C at 20,800 × g for 15 min. The liquid
supernatant, corresponding to the eukaryotic cell cytoplasmic and
nuclear soluble fraction, was removed, and proteins were precipitated
by the addition of TCA to 10% (vol/vol). The 20,800 × g debris and precipitated proteins from media and cellular
soluble fractions were dissolved in polyacrylamide gel electrophoresis
(PAGE) sample buffer containing 2.3% (wt/vol) sodium dodecyl sulfate
(SDS), 5% (vol/vol)
-mercaptoethanol, 60 mM Tris (pH 6.8), and 25%
(vol/vol) glycerol.
To test for the extent of induction of Yops expression when the parent
Pla
Y. pestis KIM8-3002 infects HeLa
cells (contact induction), HeLa cells were infected as described above
except that the MOI was 5. Additional wells containing RPMI but no HeLa
cells received the same number of bacteria. After 2 h incubation
at 37°C in 5% CO2, the entire contents of each well was
harvested and the proteins were precipitated with TCA. Twofold serial
dilutions of samples representing equal fractions of the original well
contents were subjected to SDS-PAGE and analyzed by immunoblotting.
LcrV and YopE were assayed by specific antibodies, and the loading of
wells with Yersinia was compared by probing lanes with an
anti-Yersinia antibody.
For confocal analysis, media were removed, and infected monolayers were
washed with 1.0-ml volumes of Hanks' balanced salt solution
(GIBCO-BRL). Samples were then treated sequentially at room temperature
with 2% (wt/vol) paraformaldehyde pH 7.4 in PBS for 30 min to fix
proteins, with buffer containing 0.5% Triton X-100 for 20 min
(52) to permeabilize membranes, and with PBS supplemented
with 10% (vol/vol) FBS and 1% (vol/vol) mouse serum (Sigma) for 60 min to block nonspecific antigenic sites. Where appropriate, LcrV and
YopM were detected by probing with LcrV- or YopM-specific polyclonal
rabbit antibodies followed by incubation with Oregon green-coupled
anti-rabbit immunoglobulin G (IgG; Molecular Probes, Eugene, Oreg.) as
described elsewhere (58). Coverslips were mounted using
SlowFade mounting medium (Molecular Probes) and analyzed by
laser-scanning confocal microscopy using a Leica TSC NT confocal system
(Ar-Kr laser) and a 63× objective. Differential interference contrast
(DIC) images were generated by a Leica DM IRB/E inverted microscope
with Nomarski optics.
Protein purification.
A purified preparation of a
His6-tagged LcrV (HT-V) was used to test the ability of
exogenous LcrV to enter HeLa cells and the specificity of LcrV-specific
antibodies. Purification was performed essentially as described
elsewhere (10). Briefly, E. coli DH5
expressing pHT-V was cultivated at 37°C in LB to an optical density
at 620 nm of ca. 1.0. IPTG was added to 0.1 mM, and the culture was
incubated for an additional 3 h. Bacterial lysates were generated
by French press as described previously (10), and HT-V was
purified by passage of clarified lysates over a Talon (Clontech
Laboratories, Inc., Palo Alto, Calif.) metal affinity resin according
to the manufacturer's instructions. Pooled samples containing pure
HT-V were dialyzed into PBS, and protein concentration was quantitated
by the bicinchoninic acid assay (Pierce Chemical Co., Rockford, Ill.).
Protein electrophoresis and immunoblot analysis.
Proteins
from fractionated, infected HeLa cultures were resolved in 12%
(wt/vol) polyacrylamide gels by SDS-PAGE (23). Samples were
loaded so that lanes represented equivalent volume fractions of the
original cultures. Once resolved, proteins were transferred to
Immobilon-P (Millipore, Corp., Bedford, Mass.) in Tris-glycine buffer
(25 mM Tris, 192 mM glycine [pH 8.3] containing 10% [vol/vol] methanol) as described previously (67). Specific proteins
were detected by using polyclonal rabbit antibodies specific for
His-tagged LcrV (
-HTV) or His-tagged YopE (
-YopE; gift of G. Plano, University of Miami). In one experiment, the loading of wells
with Yersinia was compared by using a polyclonal rabbit
antibody raised against Y. pestis KIM6 whole cells grown at
26°C (anti-Yersinia). Proteins were visualized by
treatment of immunoblots with alkaline phosphatase- or horseradish
peroxidase-conjugated goat anti-rabbit IgG (Sigma), followed by
development with nitroblue
tetrazolium-5-bromo-4-chloro-3-indolylphosphate (NBT-BCIP; GIBCO-BRL)
or enhanced chemiluminescence (ECL) substrate (Pierce), respectively.
 |
RESULTS |
Contact-activated entry of LcrV into infected HeLa cells.
A
tissue culture infection model has been used to characterize the
localization and function of certain Yop proteins once they are
secreted by yersiniae. We have hypothesized that LcrV can function in
intimate association with infected eukaryotic cells to help mediate
transfer of Yops into the cell cytoplasm. The goal of this study was to
investigate the localization of LcrV in this model system. We had
previously found that unlike the vectorially targeted Yops, LcrV is
secreted into the medium and also becomes cell-associated in a tissue
culture infection model (37). The cell-associated LcrV was
intriguing, since LcrV is required for the targeting of Yops and may
function at the interface between a bacterium and associated eukaryotic
cell. Furthermore, YopD, an additional protein involved in Yops
targeting, may itself be targeted (13), raising the
possibility that LcrV localized in a translocation apparatus can also
gain access to the eukaryotic cell cytoplasm. We therefore tested
whether LcrV could enter infected cells. HeLa cell monolayers were
infected with our Pla
parent Y. pestis
KIM8-3002 for 4 h, and secreted proteins in one replicate culture
were tested for accessibility to proteolysis by exogenously added
trypsin as an indicator of extracellular localization. Cultures were
then fractionated into cell-free medium (containing proteins secreted
into the culture medium), cellular soluble (representing HeLa cell
cytoplasm and released nuclear proteins), and debris (containing
yersinia bound to cell membrane) fractions. We then compared the
localization of LcrV to that of the vectorially targeted YopE by
immunoblot analysis (Fig. 1). As
previously noted (37), LcrV, but not YopE, was released into the culture medium during infection (lane 2) and was completely susceptible to proteolysis by trypsin (lane 4). LcrV, like YopE, was
present in HeLa soluble fractions (lanes 1 and 3) and was protected
from digestion by trypsin (lane 3), suggesting an intracellular localization for LcrV. Interestingly, quantities of cell-associated LcrV were significant when compared to levels secreted into the medium
(lane 2). A similar distribution of LcrV was detected after infection
of the macrophage-like cell line J774 (data not shown). The
cell-associated LcrV did not arise from yersiniae internalized by the
HeLa cells, because separate gentamicin protection studies indicate
that less than 1% of Y. pestis KIM8-3002 enter HeLa cells in a 4-h infection (8). An alternative possibility for
cell-associated LcrV was that intracellular LcrV was an artifact of the
fractionation protocol. We have shown that LcrV can localize in
deposits on the extracellular surface of Y. pestis
(9), raising the possibility that the cold water lysis
treatment had dissociated surface LcrV, releasing it into the HeLa
cytoplasmic fraction. To test this possibility, we incubated equivalent
numbers of Y. pestis KIM8-3002 in the absence of HeLa cells
in a parallel assay. The bacteria were then subjected to the cold water
treatment used to lyse eukaryotic cells, and the cell-free medium (lane
6) and water-released fraction (lane 5) were analyzed by immunoblotting
with LcrV- and YopE-specific antibodies. As with YopE, LcrV was not
secreted by yersiniae in the absence of HeLa cell contact (lane 6). No
YopE and only a small amount of LcrV were released by the water
treatment (lane 5), indicating that the strong LcrV-specific signal
detected in lanes 1 and 3 was not derived from release of surface LcrV
into the cytoplasmic fraction.

View larger version (49K):
[in this window]
[in a new window]
|
FIG. 1.
LcrV partitions to the cell-free medium and HeLa soluble
fractions. Duplicate wells containing HeLa monolayers were infected
with Y. pestis KIM8-3002 at an MOI of 10 (lanes 1 to 4). As
a control, an equal dose of Y. pestis KIM8-3002 was also
added to a well lacking HeLa cells (lanes 5 and 6). After incubation at
37°C-5% CO2 for 4 h, trypsin was added to 100 µg/ml to one replicate of infected HeLa cells.
Yersinia-infected HeLa cultures were fractionated, and the
cell-free medium (M) and water-lysate soluble (S) fractions were
further analyzed. Cell-free medium (M; lane 6) from the
Yersinia-only well corresponded to the culture supernatant
after removal of bacteria by centrifugation. The bacteria were then
treated with cold water and pelleted, and the resulting supernatant
corresponding to the water-released (R; lane 5) fraction was removed.
Samples from each fraction representing 0.3% of the original
culture were resolved in a 12% polyacrylamide gel. LcrV and YopE were
detected by probing immunoblots with -HTV and -YopE followed by
secondary antibodies conjugated to horseradish peroxidase and
development with ECL reagent.
|
|
A concern was whether this control test of yersiniae in the absence of
HeLa cells might have been misleading if yersiniae not in the presence
of HeLa cells contained only basal amounts of LcrV and YopE. To address
this question, we infected HeLa cells or allowed an equal number of
Y. pestis KIM8-3002 bacteria to incubate in RPMI in a well
lacking HeLa cells. After 2 h, the entire contents of each well
was recovered, and the TCA-precipitated proteins were compared for
their relative contents of LcrV and YopE by analyzing serial dilutions
in an immunoblot (Fig. 2). Figure 2A
shows that whether HeLa cells were present or not, LcrV was present in
comparable amounts, and the same was true for YopE. A similar blot
probed with a polyclonal anti-Yersinia antibody (Fig. 2B)
showed that the samples from wells with and without HeLa cells had
contained equal amounts of bacteria (this had also been verified for
replicate wells by CFU determinations). These data show that incubation
of Y. pestis in a cluster dish at 37°C-5% CO2
in RPMI is sufficient to induce LcrV and YopE expression and that
contact with HeLa cells does not cause further induction, unlike the
situation for Y. pseudotuberculosis (45).
However, Y. pestis clearly is contact activated for Yops and
LcrV secretion and targeting, as these proteins are not secreted
without HeLa cells (Fig. 1).

View larger version (87K):
[in this window]
[in a new window]
|
FIG. 2.
Y. pestis is contact activated for secretion
and targeting but not contact induced for expression of LcrV and YopE.
HeLa cells were infected with Y. pestis KIM8-3002 for 2 h at an MOI of 5, or an equal number of yersiniae were incubated in
RPMI without HeLa cells. The total proteins harvested from each well
were recovered by TCA precipitation and analyzed in serial twofold
dilutions by immunoblotting. In panel A, the blot was probed with a
mixture of antibodies to LcrV and YopE; in panel B, a polyclonal
anti-Yersinia antibody was used. Proteins were visualized by
probing immunoblots with IgG coupled to horseradish peroxidase followed
by ECL detection (A) or with alkaline phosphatase-coupled IgG followed
by development with NBT-BCIP (B). Fold dilutions of the samples are
given above the lanes.
|
|
YopE has been demonstrated by multiple experimental techniques to
localize to the cytoplasm of infected cells (62). The observation that LcrV, like YopE, was trypsin resistant in our assay
suggested that LcrV also was cytoplasmic. We directly analyzed LcrV
localization in infected HeLa cells by laser-scanning confocal microscopy to formally test this prediction (Fig.
3). Infection with our parent strain
Y. pestis KIM8-3002 did not yield a signal detectable by
this assay (data not shown). We therefore chose to test localization of
LcrV expressed by an lcrE mutant of Y. pestis, a
strain that has been shown to hypersecrete LcrV (60). We
replaced wild-type lcrE in yopM Y. pestis
KIM8-3233 by allelic exchange with a subcloned lcrE lacking
codons 48 to 197 to create Y. pestis KIM8-3233.1. The
yopM mutation was present for a control test needed later
and was not expected to influence the targeting of LcrV, as there is
considerable precedent for use of strains lacking even multiple Yops in
targeting studies (e.g., references 15 and
19). HeLa cells were infected in the presence of
cytochalasin D with the lcrE yopM mutant or the lcrV
yopJ mutant KIM8-3241 expressing HT-VN68 (as a negative control).
HT-VN68 is an N-terminally truncated, His-tagged version of LcrV which
fails to be secreted by Y. pestis (9).
LcrV-specific staining of uninfected HeLa cells or HeLa cells infected
with Y. pestis expressing HT-VN68 did not yield a
significant immunofluorescence signal (Fig. 3B and C). Significant
staining, however, was detected in the cytoplasm of lcrE yopM Y. pestis-infected HeLa cells (Fig. 3A; compare immunofluorescence and DIC images). LcrV appeared to be localized throughout the cell
cytoplasm, and examination of multiple optical planes (data not shown)
revealed that intracellular LcrV may also be present in the cell
nucleus. The detected signal was LcrV specific, since it could be
competed by addition of excess, pure HT-V during staining of monolayers
with
-HTV (Fig. 3D). These results confirm that LcrV does gain
access to the cytoplasm of infected HeLa cells.

View larger version (59K):
[in this window]
[in a new window]
|
FIG. 3.
LcrV can localize to the cytoplasm of infected HeLa
cells. HeLa cell monolayers cultivated on glass coverslips in the
presence of cytochalasin D were uninfected (C), infected with Y. pestis KIM8-3233.1 (lcrE) (A), or infected with
Y. pestis KIM8-3241 expressing HT-VN68 as a negative control
(B) for 4 h at 37°C-5% CO2. Monolayers were then
fixed, permeabilized, and stained with -HTV. During staining of one
replicate (D), 10 µg of pure HT-V (representing a fivefold molar
excess over antigen-binding sites of -HTV) was added during
incubation with -HTV as an antibody specificity control. LcrV was
detected by secondary staining with Oregon green-conjugated anti-rabbit
IgG followed by visualization by confocal laser-scanning microscopy. A
63× objective was used; immunofluorescence (IF) and DIC images are
shown.
|
|
LcrV does not require components of the Yops targeting apparatus to
enter HeLa cells.
Although our results show that LcrV can enter
HeLa cells, it was unclear whether LcrV entry occurred by the Yops
targeting mechanism. Targeting of YopE and other Yops requires
secretion through a Ysc channel followed by YopB- and YopD-dependent
translocation across the eukaryotic plasma membrane (53,
54). Secretion of both LcrV and Yops is Ysc dependent (6,
40), and we predicted that LcrV may also require YopB and YopD to
gain access to the HeLa cell cytoplasm. To test this hypothesis, we
created Y. pestis KIM8-3002.1 (yopB) by allelic
exchange of parent yopB with a subcloned in-frame
yopB deletion carried on p
yopB, which removed essentially all of the 401-residue YopB coding sequence (codons 8 to 390). Consistent with the properties of a nonpolar yopB deletion
constructed by Håkansson et al. (16), our yopB
mutation did not affect regulation of Yop expression or secretion and
did not have a polar effect on the downstream gene for YopD (data not
shown). We infected HeLa monolayers with yopB Y. pestis
(lanes 1 to 4) or a previously constructed yopD (lanes 5 to
8) mutant KIM8-3002.2 (72) and assayed LcrV and YopE
localization in fractionated cultures by immunoblot analysis (Fig.
4). In these experiments, infection with
the yopD strain was carried out in the presence of
cytochalasin D to prevent any internalization of the yersiniae which
would be unable to target antiphagocytic Yops. This was important here, because yopD strains are constitutively strongly induced for
Yops and LcrV expression (72), and a few intracellular
yersiniae might give an artifactual signal for YopE in the HeLa soluble fraction. As expected, trypsin-inaccessible YopE was not detected in
the soluble fractions of HeLa cells infected by yopB (lane 3) or yopD (lane 7) Y. pestis, consistent with
the inability of these mutants to target Yops. Instead, YopE was
detected in the culture medium (lane 6) or in soluble fractions (lanes
1 and 5) of nontrypsinized cultures. Interestingly, partitioning of
LcrV in cultures was unchanged by either the yopB or
yopD mutation in Y. pestis: LcrV was detected in
the cell-free medium (lanes 2 and 6) as well as soluble fractions from
both trypsinized (lanes 3 and 7) and nontrypsinized cultures (lanes 1 and 5). These results indicate that unlike YopE, LcrV does not require
YopB or YopD to traverse the plasma membrane of infected HeLa cells.

View larger version (48K):
[in this window]
[in a new window]
|
FIG. 4.
Entry of LcrV into HeLa cells does not require the
translocator Yops, YopB and YopD. HeLa cell monolayers were infected,
in duplicate, for 4 h at 37°C-5% CO2 with Y. pestis KIM8-3002.1 (yopB) (lanes 1 to 4) or KIM8-3002.2
(yopD) (lanes 5 to 8) at an MOI of 10. Infection with
yopD Y. pestis was done in the presence of cytochalasin D at
5 µg/ml. One replicate of each treatment was treated with trypsin at
100 µg/ml prior to harvest. Fractionation of cultures was done as
previously described, and proteins in samples corresponding to 0.3% of
original culture volume were resolved in 12% polyacrylamide gels. LcrV
and YopE in cell-free medium (M) and soluble (S) HeLa cell water-lysate
fractions were detected by immunoblotting with -HTV and -YopE.
Proteins were visualized by probing with horseradish
peroxidase-conjugated anti-rabbit IgG followed by development with ECL
reagent.
|
|
Extracellular yersiniae directly target LcrV to the HeLa cytoplasm.
Yersinia can invade eukaryotic cells and survive even within
phagolysosomes of professional phagocytes (65). YopE and
other Yops, however, are targeted across the eukaryotic cell plasma membrane by extracellular, peripherally associated yersiniae and not by
intracellular bacteria (44, 51, 62). Since LcrV did not seem
to enter HeLa cells by the Yops targeting pathway, we began to
investigate the route of LcrV entry by testing the localization of
bacteria from which the intracellular pool of LcrV was derived. We
infected HeLa cells with Y. pestis KIM8-3002 and either
prevented bacterial internalization with cytochalasin D or killed
extracellular bacteria with gentamicin to test the source of LcrV
detected in these assays (Fig. 5). As
expected, YopE was trypsin nonsusceptible (lane 1) and, therefore,
targeted when extracellular localization of yersiniae was ensured by
the addition of cytochalasin D. In the presence of cytochalasin D
(lanes 1 to 4), LcrV was detected in the medium (lane 4), and
trypsin-resistant LcrV was detected in the soluble (lane 1) fraction.
Neither YopE nor LcrV was detected in samples from gentamicin-treated
infections (lanes 5 to 8). As a control, extracellular bacteria were
also killed with gentamicin after infection of cytochalasin-treated
HeLa cells (lanes 9 to 12) to verify that the amount of cytochalasin D
used was sufficient to prevent internalization of the bacteria. Under
these conditions, no YopE or LcrV was detected, indicating that
sufficient levels of cytochalasin D were used in this assay. Although
these results do not rule out low-level secretion of LcrV by
intracellular bacteria, these observations do indicate that the LcrV
detected in these assays originates from extracellular yersiniae.

View larger version (27K):
[in this window]
[in a new window]
|
FIG. 5.
Extracellular Y. pestis targets LcrV. Prior
to infection, HeLa monolayers were treated with 5 µg of cytochalasin
D per ml for 30 min (lanes 1 to 4 and 9 to 12). These monolayers were
then infected with Y. pestis KIM8-3002 in the presence of
cytochalasin D. Some wells (lanes 5 to 12) received 7.5 µg of
gentamicin per ml 30 min after infection to kill extracellular
bacteria. After treatment of replicate wells with trypsin,
cultures were harvested and fractionated, and samples of cell-free
medium (M) and HeLa soluble (S) fractions corresponding to 0.3% of the
original culture volume were resolved in 12% polyacrylamide gels.
Immunoblots were probed with -HTV and -YopE, and LcrV and YopE
were detected by incubating immunoblots with horseradish
peroxidase-conjugated anti-rabbit IgG followed by development with ECL
reagent.
|
|
Yersiniae are required to mediate entry of LcrV into HeLa
cells.
The significant amount of YopE detected in the culture
medium in Fig. 5 (lane 4) was not seen in repetitions of that
experiment. Secretion of LcrV in this tissue culture infection model,
however, consistently occurred; more than half of LcrV was released
into the culture medium during infection. Given that LcrV-containing fusion proteins have an immunomodulatory effect in the absence of
yersiniae, and since entry of LcrV into HeLa cells was YopB and YopD
independent, we wondered whether this pool of LcrV in the medium was
the source of intracellular LcrV. We have previously demonstrated that
HT-V can enter HeLa cells when expressed in Y. pestis
(9). We therefore tested whether HT-V added exogenously to
subconfluent monolayers could enter HeLa cells (Fig.
6). Uninfected and Y. pestis
KIM8-3002-infected HeLa monolayers were incubated for 4 h in the
presence of 1 µg of HT-V (500 ng/ml) purified from E. coli. In the test with infected cultures, we wanted to determine whether the interaction between Yersinia and HeLa cells in
some way caused or stimulated the internalization of exogenous LcrV. The HT-V migrated more slowly in SDS-PAGE than native,
Yersinia-derived LcrV (because of the extra mass in the
23-amino-acid His6-containing leader) and could be
distinguished from native LcrV in immunoblots. After incubation,
cultures were fractionated and analyzed as before. We did not detect
significant amounts of HT-V in HeLa soluble fractions when HT-V was
added to uninfected monolayers. Instead, essentially all of the fusion
protein was detected in the culture medium. Presence of HT-V during
infection of monolayers did not appreciably alter this distribution.
Although some HT-V was detected in the soluble fraction, it was
susceptible to digestion by trypsin prior to cell lysis, indicating an
extracellular localization. In contrast, native,
Yersinia-derived LcrV in the soluble fraction was not
susceptible to trypsin. According to these results, intracellular LcrV
must be delivered directly by Yersinia and does not result from entry of LcrV that is free in the medium.

View larger version (33K):
[in this window]
[in a new window]
|
FIG. 6.
Delivery by Y. pestis is required for LcrV to
gain access to the HeLa cell cytoplasm. Purified HT-V was added at 500 ng/ml to HeLa monolayers alone (left) or with Y. pestis
KIM8-3002 (right), and the cultures were incubated for 4 h at
37°C-5% CO2. After trypsin treatment and fractionation
of cultures, native LcrV and HT-V were detected in cell-free medium (M)
and HeLa soluble (S) fractions by immunoblot analysis using -HTV.
Proteins were visualized using horseradish peroxidase-conjugated
anti-rabbit IgG and development with ECL reagent.
|
|
A functional Ysc secretion apparatus is not required to mediate
entry of LcrV into HeLa cells.
Our data suggested that LcrV may
enter eukaryotic cells by an entirely novel pathway. It is well
established that in vitro secretion of LcrV and Yops requires the Ysc
apparatus, and we have recently shown that YscC is required for LcrV to
become deposited on the surface of Y. pestis (9).
We extended our analysis of the LcrV entry pathway by testing whether
Y. pestis lacking an essential component of the Ysc
apparatus could deliver LcrV to the cytoplasm of infected HeLa cells.
We used Y. pestis KIM5-3001.2.1, which lacks both
yscV and yopD. The absence of yopD
served to prevent any downregulation of expression of LcrV and Yops
that otherwise could result from the inactivation of the Ysc by the yscV mutation. (Recall that YopD is required to prevent
maximal thermal induction of the LCR, and yopD strains
express fully induced levels of both LcrV and Yops
[72].) HeLa monolayers were infected with Y. pestis KIM5-3001.2.1 as done previously (Fig.
7); as expected, infected cells were not
cytotoxic, because Yops could not be secreted and targeted (data not
shown). For this experiment, we chose to lyse the infected monolayers
by mechanical disruption in a Kontes homogenizer, because as shown in
Fig. 1 (lane 5), treatment of yersiniae with cold water released small
quantities of LcrV which could contaminate the HeLa soluble fractions.
Treatment with a Kontes homogenizer, however, seemed to limit this
effect (61). Indeed, immunoblot analysis of proteins
released from a Yersinia-only control revealed that
negligible amounts of LcrV and YopE were released from the bacteria by
this method (lane 8), even though easily detectable levels of LcrV and
YopE were found in the pelleted bacteria (lane 7). The
Yersinia-containing low-speed pellets from lysed, infected
HeLa cells were analyzed and found to contain readily detectable levels
of LcrV and YopE, showing that strong expression of LcrV and Yops had
occurred in the yscV yopD Y. pestis (lanes 5 and 6). As
expected, neither LcrV nor YopE was detected in the cell-free medium
fraction (lane 3). Surprisingly, LcrV was detected in the HeLa soluble
fraction (lanes 1 and 2) and was not susceptible to proteolysis by
trypsin (lane 2). This localization was specific for LcrV, since YopE
was not detected in either of these fractions. Although these results
do not rule out the possibility that other Ysc components are required
for LcrV to gain access to the HeLa cell cytoplasm, they do suggest
that different pathways mediate release of LcrV into the medium and
entry of LcrV into eukaryotic cells.

View larger version (39K):
[in this window]
[in a new window]
|
FIG. 7.
Entry of LcrV into the HeLa cell cytoplasm does not
require a functional Ysc secretion apparatus. Y. pestis
KIM5-3001.2.1 (yopD yscV) was incubated in RPMI for 4 h
in the presence (lanes 1 to 6) or absence (lanes 7 and 8) of HeLa cell
monolayers. Infected monolayers were treated with trypsin where
indicated, and the cell-free medium (M) fraction was harvested as
before. Infected HeLa monolayers were scraped, suspended in ice-cold
RPMI, and disrupted in a Kontes homogenizer (at least 100 strokes).
Disruption was confirmed by analysis of homogenates by phase-contrast
microscopy. Subsequent centrifugation resulted in the HeLa soluble (S)
fraction and a low-speed pellet (P) containing yersiniae and large HeLa
cell debris. Bacteria from the Yersinia-only culture were
pelleted by centrifugation, suspended in ice-cold RPMI, and subjected
to the Kontes homogenizer. Samples were centrifuged to yield the
bacterial pellet (B) and supernatant corresponding to Kontes-released
(R) proteins. Samples representing 0.5% of original culture volume
were resolved in 12% polyacrylamide gels, and immunoblots were
incubated with -HTV and -YopE. Proteins were visualized by
probing immunoblots with alkaline phosphatase-conjugated anti-rabbit
IgG and development with NBT-BCIP.
|
|
LcrV enters HeLa cells by a novel, pCD1-independent pathway.
All components of the Y. pestis Ysc secretion apparatus are
encoded, along with LcrV and Yops, on the virulence plasmid pCD1. We
tested for an alternative LcrV-specific export pathway by infecting HeLa cells with pCD1
Y. pestis KIM10
expressing LcrV under the control of an inducible promoter (Fig.
8A). In preliminary test, Y. pestis KIM10 expressing LcrV or YopM did not secrete either
protein into culture supernatant when cultivated in defined medium
under inductive conditions, even though both proteins were strongly
expressed within the bacteria (data not shown). For the experiments
with infected HeLa cells, we used YopM, expressed in Y. pestis KIM10 under control of the same promoter used for
lcrV, as a negative control Yop that is dependent on YopB
and YopD to be targeted (Fig. 8B). HeLa monolayers were also infected
with Y. pestis KIM8-3233.1 (lcrE yopM) or
Y. pestis KIM8-3233.1 expressing YopM, as positive controls
that cause cellular internalization of LcrV and targeting of YopM, respectively. Uninfected monolayers were used as a specificity control,
and HeLa cells infected with Y. pestis KIM10 expressing the
nonsecretable HT-VN68 served as an additional negative control. All
infections were done in the presence of cytochalasin D, since Y. pestis KIM10 lacks all Yop-mediated antiphagocytic properties; IPTG was used to induce expression of trans copies of
lcrV and yopM. To avoid any possible
fractionation artifacts, we directly assayed for cytoplasmic LcrV and
YopM by staining fixed, permeabilized monolayers with LcrV-specific
(Fig. 8A) or YopM-specific (Fig. 8B) antibodies, followed by
visualization using laser-scanning confocal microscopy. DIC
images showed the position of HeLa cells and associated
yersiniae. As expected, YopM was detected within HeLa cells infected
with Y. pestis KIM8-3233.1 expressing YopM (Fig. 8B, column
4) after staining with
-YopM. Conversely, no significant signal was
detected in HeLa cells infected with pCD1
Y. pestis KIM10 expressing YopM (Fig. 8B, column 3) or the
nonsecretable HT-VN68 (Fig. 8B, column 2). Some YopM-specific staining
of permeabilized bacteria was detected (Fig. 8B, column 3). When LcrV
was expressed in Y. pestis KIM10, LcrV-specific staining was
detected in the cytoplasm of infected HeLa cells (Fig. 8A, column 3),
although the staining was weaker than that detected in some cells of
the positive control culture infected with lcrE yopM Y. pestis. Although permeabilized bacteria were stained, the signal
detected in HeLa cells infected with Y. pestis
KIM10/pHT-VN68 (Fig. 8A, column 2) was comparable to that in an
uninfected negative control (Fig. 8, column 1). Taken together, these
results indicate that Y. pestis lacking the virulence
plasmid pCD1 can target LcrV but not YopM. LcrV, therefore, enters
eukaryotic cells by a novel, virulence plasmid-independent mechanism.

View larger version (63K):
[in this window]
[in a new window]
|
FIG. 8.
Entry of LcrV into the HeLa cell cytoplasm does not
require pCD1-encoded proteins. Cytochalasin D-treated (5 µg/ml) HeLa
cell monolayers were uninfected (A and B, column 1), infected with
Y. pestis KIM8-3233.1 (lcrE yopM) (A, column 4)
or KIM8-3233.1 expressing YopM from pTrcM.2 (B, column 4), and infected
with pCD1 Y. pestis KIM10 expressing HT-VN68
(A and B, column 2), LcrV (A, column 3), or YopM (B, column 3). IPTG
was added to 0.1 mM to cultures for activation of inducible promoters.
After 4 h, monolayers were fixed, permeabilized, and stained with
-HTV (A) or -YopM (B). Proteins were detected by secondary
staining with Oregon green-conjugated anti-rabbit IgG followed by
visualization by confocal laser-scanning microscopy. A 63× objective
was used; immunofluorescence (IF) and DIC images are shown.
|
|
 |
DISCUSSION |
In this study, we characterized the partitioning of LcrV in a
tissue culture infection model. We chose infection of HeLa cells as a
model system, since the deployment of Yops by Yersinia has been investigated using this model. Previous reports by this lab showed
that LcrV, like the Yops, was detected in culture fractions representing the cytoplasm of infected HeLa cells (37),
suggesting that LcrV may be targeted into infected eukaryotic cells by
the Yops targeting mechanism. In this report, we showed that LcrV does
enter infected HeLa cells, but by a mechanism distinct from that which
mediates Yops targeting. Our evidence also indicates that at least two
pathways exist for the export of LcrV from Y. pestis. The
first is manifested as Ysc-dependent secretion of LcrV into the tissue
culture medium and localization at the bacterial surface
(9), while the second, pCD1-independent pathway results in
delivery of LcrV directly into the cytoplasm of infected eukaryotic cells.
In vitro in defined medium, both LcrV and YopE are secreted by the Ysc
type III mechanism (40). In the tissue culture infection model, Ysc-dependent secretion of YopE and subsequent
unidirectional targeting is induced by contact with a target eukaryotic
cell (6, 45). In the case of Y. pseudotuberculosis, contact also concomitantly induces increased
Yops expression (45). This appears not to be the case for
Y. pestis at 37°C-5% CO2 in RPMI: thermal induction in the absence of cell contact in this culture condition is
sufficient to induce Yops and LcrV expression, and cell contact provides no further induction. However, cell contact clearly causes activation of the Ysc for secretion and targeting. Consistent with this
observation, we failed to detect YopE release into tissue culture
medium when Y. pestis was incubated in tissue culture medium
in the absence of HeLa cells. LcrV was also not detected, indicating
that its release is probably triggered by the same mechanism that
initiates delivery of Yop effectors. Conversely, LcrV was released when
Y. pestis was incubated in the presence of HeLa cells.
Consistent with previous observations (37), significant amounts of LcrV were detected in the tissue culture medium and HeLa
soluble fractions, in contrast to YopE, which was unidirectionally targeted into the HeLa cells and not released into the medium in
significant amounts. Secretion of LcrV into the medium and targeting of
YopE both require a functional Ysc apparatus, and LcrV, but not YopE,
can localize to the extracellular surface of Y. pestis
(9). This is true also for the Ysc outer-gate protein LcrE
(11), so there already was precedent prior to this study for
the surface localization of Ysc accessory proteins that themselves are
secreted by the Ysc. Moreover, these proteins are surface localized
under conditions that are not permissive for strong Yop expression or
secretion (i.e., absence of cell contact). These data suggest that
Yersinia has the ability to differentially sort proteins
secreted by the same pathway. Further investigation is needed to
determine how and where this differential sorting occurs.
Although we detected trypsin-resistant LcrV in the HeLa soluble
fraction, it was important to rule out several possible sources of
artifactual introduction of LcrV into this fraction. For instance, we
have shown that LcrV can exist on the extracellular surface of Y. pestis and have proposed that LcrV may be a component of a Yops
delivery apparatus (9). Accordingly, it is possible that
trypsin could not gain access to LcrV incorporated into a structure,
and as a result, LcrV would enter the HeLa soluble fraction and appear
to be trypsin resistant if some of the structures were released from
the bacteria and into the HeLa soluble fraction during the
fractionation procedure. Skzrypek et al. (58) have also
documented that the treatment with 0.1% Triton X-100 that often is
used to lyse eukaryotic cells results in release of Yops from Y. pestis. In our hands, even water lysis caused small amounts of
LcrV to be released from Y. pestis (Fig. 1, lane 5).
Similarly, our lab has found that treatment with 10 µg of digitonin
per ml results in nonspecific release of Yops from Y. pestis
(61). We therefore turned to confocal microscopy to directly
demonstrate intracellular LcrV, and we easily detected it when HeLa
cells were infected with Y. pestis lacking the Ysc
outer-gate protein LcrE (Fig. 3 and 8). However, we were unable to
detect LcrV targeted from parent Y. pestis by this method
(data not shown), even though we believe that it was present (Fig. 1
and 5). This difference between parent and lcrE yersiniae
may arise from a difference in the way LcrV is partitioned within the
bacteria for the two strains. Previous studies with Y. pestis grown in defined medium lacking Ca2+ have shown
that essentially all of the LcrV made by lcrE yersiniae is
released into the medium, whereas in parent Y. pestis about half of LcrV stays in the bacterial soluble fraction (60).
It may be that LcrE normally exerts a retentive effect on LcrV, which also has a cytoplasmic Ysc-related secretion-regulatory function (38, 60). In the absence of LcrE, this internal pool of LcrV may be freed from its association with the Ysc and be available for
targeting by the putative, novel Ysc-independent pathway. In the parent
Y. pestis, a much smaller amount of LcrV may be available to
that pathway, and this might be below the sensitivity of detection by
immunofluorescence. We found that the intracellular LcrV has a
diffuse distribution. Interestingly, LcrV appeared to be present
throughout the cell, including the interior of the nucleus, when Yops
also were being targeted (Fig. 3 and 8, KIM8-3233.1), whereas it
appeared to be mainly cytoplasmically located when it alone was being
targeted (Fig. 8A, KIM10 pTrcV). This could reflect a cellular response
to a targeted Yop, that allows LcrV to enter the nucleus, an idea that
will be important to test in the future.
We initially thought that LcrV gained access to the HeLa cytoplasm by a
mechanism similar to that used by Yops. YopE, for example, lacks the
intrinsic ability to enter eukaryotic cells and therefore must be
directly delivered by extracellularly associated yersiniae
(52). Y. pestis used in our experiments was
pregrown at 26°C and as a result lacked the thermally inducible,
antiphagocytic capsule (4). Such bacteria are readily
phagocytosed by macrophages (65), and in preliminary
experiments, there was significantly less LcrV within infected J774
macrophage-like cells unless cytochalasin D was present to prevent
phagocytosis (data not shown). A similar observation has previously
been reported for YopM targeting by Y. pestis
(58) as well as for Y. pseudotuberculosis
internalized into HeLa cells (44, 51). We therefore
predicted that the LcrV detected in our experiments was derived from
extracellular yersiniae. Indeed, we found that extracellular yersiniae
were the source of both cytoplasmic and medium-localized LcrV in
infected HeLa cells (Fig. 5). In addition, exogenously added pure LcrV (HT-V) could not enter HeLa cells (Fig. 6). One interpretation of these
results is that LcrV must be delivered directly to HeLa cells by
associated yersiniae and does not gain access to the cytoplasm by
diffusing to HeLa cells in a paracrine fashion from the medium.
However, we then found that unlike entry of YopE, entry of LcrV does
not require either YopB or YopD. These results indicate that a separate
mechanism must exist for the transfer of LcrV from Yersinia
to infected cells.
Our next test showed that this mechanism does not require a functional
Ysc apparatus, because LcrV still entered HeLa cells and became trypsin
resistant when the infecting strain was a yscV yopD double
mutant (Fig. 7). This Y. pestis lacked functional YscV, an
inner membrane Ysc component that is essential for secretion of LcrV
and Yops under inductive conditions in a defined medium (47). The yopD mutation counteracted any
downregulation that otherwise might have resulted from the inability to
secrete the negative regulator LcrQ (45), because YopD is
required for LcrQ to have its negative regulatory effect
(72). Accordingly, the double mutant expressed LcrV and Yops
strongly but failed to secrete either protein into the tissue culture
medium and failed to target YopE into the HeLa cells, whereas LcrV was
targeted by this strain. We believe that this targeting was real and
that it was not complicated by contamination of the HeLa soluble
fraction during the fractionation process. Surface localization of
LcrV, one potential source of contamination, would not have occurred,
because it requires a functional Ysc; second, treatment of bacteria in
a Kontes homogenizer did not induce release of LcrV or YopE from the
bacteria. Since all Ysc components are encoded on the virulence plasmid
pCD1 (18, 42), we tested whether strains lacking pCD1 could
mediate targeting of LcrV. LcrV, but not YopM, gained access to the
HeLa cytoplasm, indicating that a separate targeting mechanism may be
encoded elsewhere in the Y. pestis genome. One concern was
that because the virulence plasmid pCD1 possesses several insertion
sequence elements (42) and has been observed to integrate
into the Yersinia chromosome (40), it was
possible that Y. pestis KIM10 was not truly
pCD1
. We believe that this was not the case, because we
were unable to amplify any ysc-specific DNA by probing for
multiple pCD1-encoded genes by PCR of Y. pestis KIM10 DNA
(data not shown). Our findings have not proven that no LcrV enters HeLa
cells through the Ysc-associated targeting mechanism; in fact, there
appeared to be more LcrV targeted by the pCD1+ Y. pestis KIM8-3233.1 (for some cells in the population) than by the
pCD1
Y. pestis KIM10 pTrcV (Fig. 8A, columns 4 versus 3). However, our data do show that LcrV is targeted by a
Ysc-dependent mechanism that is contact activated (Fig. 4, 7, and
9).

View larger version (30K):
[in this window]
[in a new window]
|
FIG. 9.
Model for Ysc-dependent and independent secretion of
LcrV. LcrV, YopB, YopD, and possibly other proteins (X) are secreted by
contact-activated Ysc secretion channels and assemble into an apparatus
that mediates targeting of secreted Yops across the plasma membrane and
into the cytoplasm of eukaryotic cells. LcrV shed from these structures
diffuses into the surrounding medium. The LcrV-transporting
contact-activated translocator (VCAT) can also secrete LcrV from
Yersinia. Upon contact with the plasma membrane, LcrV not
involved in secretion or targeting of Yops is secreted across the inner
membrane (IM), periplasm (PP), and outer membrane (OM) of Y. pestis through the VCAT mechanism composed of non-pCD1-encoded
proteins. LcrV secreted in this manner is delivered directly to
associated eukaryotic cells.
|
|
This study raises many fascinating, unanswered questions. However,
there is some information available to refine our thinking about two of
these: how does this secondary mechanism mediate transfer of LcrV to
infected cells, and what is the function of intracellular LcrV. The
secondary pathway for LcrV targeting requires cell contact but not
secretion by the Ysc type III mechanism. We have recently shown that
LcrV truncated at the C terminus gains access to the HeLa cytosol but
is not secreted by the Ysc, as it is not detected in the tissue culture
medium and does not localize to the surface of Y. pestis
(9). LcrV's N-terminal 67 residues can be replaced by the
first 15 amino acids of YopE, and this protein enters HeLa cells even
though it also is not secreted by the Ysc (9). Perhaps the N
and C termini are required for Ysc-dependent secretion, while an
internal domain is required for the secondary pathway of LcrV
targeting. Sequence analysis predicted a Sec signal-like sequence 100 residues from the N terminus (50). However, this sequence is
not required for LcrV targeting, since an LcrV lacking this region
(LcrV
108-125 [60]) can gain access to the
cytoplasm of infected HeLa cells (data not shown). Further
investigation is needed to elucidate a novel export and delivery
mechanism that recognizes an internal domain in LcrV.
Although we have not identified a specific function for intracellular
LcrV, we propose that transfer of LcrV to eukaryotic cells is not a
spurious process. In a separate report, we suggest that LcrV may be
involved in Yops targeting by acting as an essential component of a
Yops targeting apparatus that is assembled at the interface between
yersiniae and associated eukaryotic cells (9). We propose
that intracellular LcrV is not related to this Yops targeting role,
because LcrV entry is independent of the Ysc, whereas Yops targeting,
including surface localization of LcrV, requires the Ysc. An
immunomodulatory role for free LcrV has also been proposed, based on
studies using pure LcrV-containing fusion proteins (34, 35,
71). The target and mechanism by which this occurs remain to be
determined. Our purified preparation of LcrV was unable to enter HeLa
cells, and although these data do not rule out a role in cytokine
regulation, they suggest that intracellular LcrV may not function in
the activities defined using LcrV-containing proteins. Finally, we did
not notice a cytotoxic effect of LcrV during infections with
yopB or yopD Y. pestis; HeLa cells remained flat
and adherent to plastic culture dishes. Future work, therefore, will
examine whether intracellular LcrV has a specific function in
interrupting cellular processes required to eliminate
Yersinia during an infection.
In this report, we have demonstrated that LcrV partitions differently
than the vectorially targeted Yops in a tissue culture infection assay
and is able to enter eukaryotic cells by a novel pathway. We propose a
model (Fig. 9) in which contact of Y. pestis with
eukaryotic cells can simultaneously activate two separate pathways in
Y. pestis for secretion of LcrV. Secretion by the previously
characterized Ysc mechanism results in deposition of LcrV on the
surface of yersiniae in structures that mediate Yops targeting. These
structures may be somewhat dynamic, promoting the release of LcrV into
the surrounding medium. We suggest that it is this released pool of
LcrV that is free to diffuse away and function as an immunomodulator.
The second pathway is a novel, Ysc-independent mechanism that mediates
direct targeting of LcrV to the cytosol of associated eukaryotic cells
without release into the surrounding medium. Future work will focus on
determining the composition of this novel LcrV-transporting
contact-activated translocator, assessing whether additional substrates
exist, and elucidating a function for intracellular LcrV.
 |
ACKNOWLEDGMENTS |
This study was supported by Public Health Service grant AI21017.
We gratefully thank Greta Fowler for providing the HT-V used in the
experiment of Fig. 3D and Gregory Plano (University of Miami) for the
kind gift of
-YopE.
 |
FOOTNOTES |
*
Corresponding author. Mailing address: Department of
Microbiology and Immunology, Chandler Medical Center, University of
Kentucky, Lexington, KY 40536-0084. Phone: (606) 323-6538. Fax: (606)
257-8994. E-mail: scstra01{at}pop.uky.edu.
Editor:
D. L. Burns
 |
REFERENCES |
| 1.
|
Black, D. S., and J. B. Bliska.
1997.
Identification of p130cas as a substrate of Yersinia YopH (Yop51), a bacterial protein tyrosine phosphatase that translocates into mammalian cells and targets focal adhesions.
EMBO J.
16:2730-2744[Medline].
|
| 2.
|
Bergman, T.,
S. Håkansson,
Å. Forsberg,
L. Norlander,
A. Macellaro,
A. Backman,
I. Bölin, and H. Wolf-Watz.
1991.
Analysis of the V antigen lcrGVH-yopBD operon of Yersinia pseudotuberculosis: evidence for a regulatory role of LcrH and LcrV.
J. Bacteriol.
173:1607-1616[Abstract/Free Full Text].
|
| 3.
|
Boland, A.,
M. P. Sory,
M. Iriarte,
C. Kerbourch,
P. Wattiau, and G. R. Cornelis.
1996.
Status of YopM and YopN in the Yersinia Yop virulon: YopM of Y. enterocolitica is internalized inside the cytosol of PU5-1.8 macrophages by the YopB, D, N delivery apparatus.
EMBO J.
15:5191-5201[Medline].
|
| 4.
|
Cavanaugh, D. C., and R. Randall.
1959.
The role of multiplication of Pasteurella pestis in mononuclear phagocytes in the pathogenesis of flea-borne plague.
J. Immunol.
83:348-363.
|
| 5.
|
Cornelis, G. R.
1998.
The Yersinia deadly kiss.
J. Bacteriol.
180:5495-5504[Free Full Text].
|
| 6.
|
Cornelis, G. R.,
A. Boland,
A. P. Boyd,
C. Geuijen,
M. Iriarte,
C. Neyt,
M. Sory, and I. Stainier.
1998.
The virulence plasmid of Yersinia, an antihost genome.
Microbiol. Mol. Biol. Rev.
62:1315-1352[Abstract/Free Full Text].
|
| 7.
|
Cornelis, G. R., and H. Wolf-Watz.
1997.
The Yersinia Yop virulon: a bacterial system for subverting eukaryotic cells.
Mol. Microbiol.
23:861-867[Medline].
|
| 8.
| Cowan, C., Y. Kaya, H. Jones, R. D. Perry, and
S. C. Straley. Unpublished data.
|
| 9.
| Fields, K. A., and S. C. Straley.
Virulence role of V antigen of Yersinia pestis at the
bacterial surface. Infect. Immun., in press.
|
| 10.
|
Fields, K. A.,
A. W. Williams, and S. C. Straley.
1997.
Failure to detect binding of LcrH to the V antigen of Yersinia pestis.
Infect. Immun.
65:3954-3957[Abstract].
|
| 11.
|
Forsberg, Å.,
A. M. Viitanen,
M. Skurnik, and H. Wolf-Watz.
1991.
The surface-located YopN protein is involved in calcium signal transduction in Yersinia pseudotuberculosis.
Mol. Microbiol.
5:977-986[Medline].
|
| 12.
|
Fowler, J. M., and R. R. Brubaker.
1994.
Physiological basis of the low calcium response in Yersinia pestis.
Infect. Immun.
62:5234-5241[Abstract/Free Full Text].
|
| 13.
|
Francis, M. S., and H. Wolf-Watz.
1998.
YopD of Yersinia pseudotuberculosis is translocated into the cytosol of HeLa epithelial cells: evidence of a structural domain necessary for translocation.
Mol. Microbiol.
29:799-813[Medline].
|
| 14.
|
Guzman, L.-M.,
D. Belin,
M. J. Carson, and J. Beckwith.
1995.
Tight regulation, modulation, and high-level expression by vectors containing the arabinose PBAD promoter.
J. Bacteriol.
177:4121-4130[Abstract/Free Full Text].
|
| 15.
|
Håkansson, S.,
E. E. Galyov,
R. Rosqvist, and H. Wolf-Watz.
1996.
The Yersinia YpkA Ser/Thr kinase is translocated and subsequently targeted to the inner surface of the HeLa cell plasma membrane.
Mol. Microbiol.
20:593-603[Medline].
|
| 16.
|
Håkansson, S.,
K. Schesser,
C. Persson,
E. E. Galyov,
R. Rosqvist,
F. Homble, and H. Wolf-Watz.
1996.
The YopB protein of Yersinia pseudotuberculosis is essential for the translocation of Yop effector proteins across the target cell plasma membrane and displays a contact dependent membrane disrupting activity.
EMBO J.
15:5812-5823[Medline].
|
| 17.
|
Holmström, A.,
J. Pettersson,
R. Rosqvist,
S. Håkansson,
F. Tafazoli,
M. Fallman,
K. E. Magnusson,
H. Wolf-Watz, and Å. Forsberg.
1997.
YopK of Yersinia pseudotuberculosis controls translocation of Yop effectors across the eukaryotic cell membrane.
Mol. Microbiol.
24:73-91[Medline].
|
| 18.
|
Hu, P.,
J. Elliott,
P. McCready,
E. Skowronski,
J. Garnes,
A. Kobayashi,
R. R. Brubaker, and E. Garcia.
1998.
Structural organization of the virulence-associated plasmids of Yersinia pestis.
J. Bacteriol.
180:5192-5202[Abstract/Free Full Text].
|
| 19.
|
Iriarte, M., and G. R. Cornelis.
1998.
YopT, a new Yersinia Yop effector protein, affects the cytoskeleton of host cells.
Mol. Microbiol.
29:915-929[Medline].
|
| 20.
|
Iriarte, M.,
M. P. Sory,
A. Boland,
A. P. Boyd,
S. D. Mills,
I. Lambermont, and G. R. Cornelis.
1998.
TyeA, a protein involved in control of Yop release and in translocation of Yersinia Yop effectors.
EMBO J.
17:1907-1918[Medline].
|
| 21.
|
Koster, M.,
W. Bitter,
H. Cock,
A. Allaoui,
G. R. Cornelis, and J. Tommassen.
1997.
The outer membrane component, YscC, of the Yop secretion machinery of Yersinia enterocolitica forms a ring-shaped multimeric complex.
Mol. Microbiol.
26:789-797[Medline].
|
| 22.
|
Kubori, T.,
Y. Matsushima,
J. Uralil,
M. Lara-Tejero,
A. Sukhan,
J. E. Galán, and S.-I. Aizawa.
1998.
Supramolecular structure of the Salmonella typhimurium type III secretion system.
Science
280:602-605[Abstract/Free Full Text].
|
| 23.
|
Laemmli, U. K.
1970.
Cleavage of structural proteins during the assembly of the head of bacteriophage T4.
Nature
227:680-685[Medline].
|
| 24.
|
Lambert de Rouvroit, C. L.,
C. Sluiters, and G. R. Cornelis.
1992.
Role of the transcriptional activator, VirF, and temperature in the expression of the pYV plasmid genes of Yersinia enterocolitica.
Mol. Microbiol.
6:395-409[Medline].
|
| 25.
|
Lee, V. T.,
M. Anderson, and O. Schneewind.
1998.
Targeting of Yersinia Yop proteins into the cytosol of HeLa cells: one-step translocation of YopE across bacterial and eukaryotic membranes is dependent on SycE chaperone.
Mol. Microbiol.
28:593-601[Medline].
|
| 26.
|
Leung, K. Y.,
B. S. Reisner, and S. C. Straley.
1990.
YopM inhibits platelet ag |