Previous Article | Next Article 
Infection and Immunity, January 2000, p. 214-220, Vol. 68, No. 1
Department of TB Immunology, Statens Serum
Institut, Copenhagen,1 and Department
of Biochemistry and Nutrition, Technical University of Denmark,
Lyngby,2 Denmark
Received 15 June 1999/Returned for modification 29 July
1999/Accepted 4 October 1999
Culture filtrate from Mycobacterium tuberculosis
contains protective antigens of relevance for the generation of a new
antituberculosis vaccine. We have identified two previously
uncharacterized M. tuberculosis proteins (TB7.3 and
TB10.4) from the highly active low-mass fraction of culture filtrate.
The molecules were characterized, mapped in a two-dimensional
electrophoresis reference map of short-term culture filtrate, and
compared with another recently identified low-mass protein, CFP10
(F. X. Berthet, P. B. Rasmussen, I. Rosenkrands, P. Andersen,
and B. Gicquel. Microbiology 144:3195-3203, 1998), and the
well-described ESAT-6 antigen. Genetic
analyses demonstrated that TB10.4 as well as CFP10 belongs to the
ESAT-6 family of low-mass proteins, whereas TB7.3 is a
low-molecular-mass protein outside this family. The proteins were
expressed in Escherichia coli, and their immunogenicity was
tested in cultures of peripheral blood mononuclear cells from human
tuberculosis (TB) patients, Mycobacterium bovis
BCG-vaccinated donors, and nonvaccinated donors. The two ESAT-6 family
members, TB10.4 and CFP10, were very strongly recognized and induced
gamma interferon release at the same level (CFP10) as or at an even
higher level (TB10.4) than ESAT-6. The non-ESAT-6 family member, TB7.3,
for comparison, was recognized at a much lower level. CFP10 was found
to distinguish TB patients from BCG-vaccinated donors and is, together
with ESAT-6, an interesting candidate for the diagnosis of TB. The
striking immunodominance of antigens within the ESAT-6 family is
discussed, and hypotheses are presented to explain this targeting of
the immune response during TB infection.
For a number of years, a major
effort has been put into the development of a new vaccine against
tuberculosis (TB) and better methods for the diagnosis of the disease.
The search for candidate molecules has in the recent years focused on
proteins released from dividing bacteria based on the reasoning that
live bacteria generally induce higher levels of protection than killed
preparations (4, 23).
For a number of years, the components of culture filtrate have been
investigated by using narrow-molecular-mass fractions as a guide to
identify immunologically active single molecules (2, 3, 5).
Low-molecular-mass proteins between 6 and 12 kDa were, in this way,
demonstrated to be strongly recognized by T cells isolated from human
TB patients (10), as well as mice and cattle experimentally
infected with TB (2, 6, 25).
Until recently, only a few small Mycobacterium tuberculosis
proteins were known. The 10-kDa GroES molecule was the first antigen to
be identified in this region and was found to be present in both
M. tuberculosis (8) and Mycobacterium
leprae (19). This antigen is abundant and constitutes a
major component in culture filtrate as well as in cell wall
preparations (17). This molecule, in the native form, was
strongly recognized by TB patients and infected mice (8).
However, several studies have tested recombinant GroES and reported
only modest T-cell responses by TB patients and TB-infected mice
(10, 20, 27a, 29); I. Rosenkrands and P. Andersen, unpublished
data). The ESAT-6 antigen was identified in the
low-molecular-mass fraction of culture filtrate due to a strong T-cell
response with high levels of gamma interferon (IFN- The present study identifies two novel low-mass M. tuberculosis proteins, TB10.4 and TB7.3. One of these
proteins, TB10.4, was found to be a member of the ESAT-6 family,
whereas TB7.3 is a low-mass protein without the features characteristic
for this family. Our data demonstrate that the three members of
this family tested so far (TB10.4, CFP10, and ESAT-6) all share a
striking immunodominance in the human immune response against M. tuberculosis and are more strongly recognized than TB7.3. CFP10
distinguished TB patients from Mycobacterium bovis
BCG-vaccinated donors and is, together with ESAT-6, an interesting
candidate for the diagnosis of TB.
Bacterial strains.
The Escherichia coli strains
used for cloning and expression were One Shot (Invitrogen, Leek, The
Netherlands) and XL1 Blue (Stratagene, La Jolla, Calif.). Mycobacterial
strains used for the interspecies study are listed in Table
1.
0019-9567/0/$04.00+0
Copyright © 2000, American Society for Microbiology. All rights reserved.
Comparative Evaluation of Low-Molecular-Mass Proteins from
Mycobacterium tuberculosis Identifies Members of the
ESAT-6 Family as Immunodominant T-Cell Antigens
ABSTRACT
Top
Abstract
Introduction
Materials and Methods
Results
Discussion
References
INTRODUCTION
Top
Abstract
Introduction
Materials and Methods
Results
Discussion
References
) released
(2). This antigen has now, in a number of studies, been
demonstrated to have good stimulatory antigenic properties and is
recognized strongly by a high percentage of TB patients (21,
26, 33), as well as different animal species infected with TB
(11, 14, 25). Recently, a few other small proteins have been
identified from various mycobacterial extracts and evaluated for their
immunological relevance (13, 34). A recent development in
this field was the identification of a 10-kDa molecule (CFP10) encoded
in the same operon as ESAT-6 (9). The sequence of the
cfp10 gene is homologous (approximately 40%) to
esat-6, and both proteins are members of the ESAT-6 family of small proteins homologous to ESAT-6 and organized in operon-like structures on the mycobacterial genome (9, 12). However, so
far no immunological data on this molecule have been presented.
MATERIALS AND METHODS
Top
Abstract
Introduction
Materials and Methods
Results
Discussion
References
TABLE 1.
Mycobacterium interspecies distribution of
tb7.3, tb10.4, cfp10,
and esat-6
ST-CF and antibodies. Short-term culture filtrate (ST-CF) of M. tuberculosis H37Rv was produced as described previously (3, 31).
The monoclonal antibody (MAb) PV-2 was described previously (2). Polyclonal antisera were raised against recombinant (r) TB7.3 and CFP10 as follows. Rabbits were immunized five times with 50 µg of recombinant antigen adjuvanted with incomplete Freund's adjuvant at 2-week intervals. The animals were bled, and sera were tested for reactivity against the recombinant protein and ST-CF by Western blotting.Identification and characterization of low-mass proteins. TB7.3 was identified from ST-CF as described by Rosenkrands et al. (27). In brief, ST-CF proteins were separated by thiophilic adsorption chromatography on an Affi-T gel column (Kem-En-Tec, Copenhagen, Denmark), and the TB7.3-containing fractions were further purified by anion-exchange chromatography (HR 5/5 Mono Q connected to a fast protein liquid chromatography system; Pharmacia, Uppsala, Sweden). Proteins were eluted by a 0 to 1 M NaCl gradient, and fractions enriched in the band representing TB7.3, when analyzed by sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE), were collected. For the identification of TB10.4 from ST-CF, chromatofocusing on a PBE 94 column equilibrated with 25 mM piperazine-HCl, pH 5.5, and elution with 10% PB74-HCl, pH 4.0, was applied.
The native protein preparations of TB7.3 and TB10.4 were separated on a 10 to 20% Tricine-SDS-PAGE gel and blotted onto Problott polyvinylidene difluoride membranes (Applied Biosystems, Foster City, Calif.), from which the protein bands of interest were excised and subjected to N-terminal amino acid analysis by automated Edman degradation with a Procise 494 sequencer (Applied Biosystems). The gene encoding TB10.4 was identified by screening a
gt11 M. tuberculosis genome library constructed by R. Young et al. (36) with the MAb PV-2 as described previously (1,
2). A single positive clone (AA242) was found, and the
EcoRI M. tuberculosis fragment was subcloned into
the E. coli expression vector pBluescript II SK(+)
(Stratagene) (AA251) for subsequent sequencing. The obtained nucleotide
sequence was analyzed, and the open reading frame (ORF) (tb10.4) encoding the MAb PV-2 reactive protein (TB10.4) was identified.
Obtained sequences were used to search the SWISSPROT and the Sanger
sequence databases with the BLASTP and the BLASTN algorithms. DNA star
version 3.08b was used for molecular mass and pI calculations.
The proteins were mapped by two-dimensional electrophoresis (2-DE) as
described previously (35).
Cloning, expression, and purification of recombinant proteins. Primers were designed, based on the DNA sequences from the Sanger sequence database, and constructed to create unique restriction sites, up- and downstream of the start and stop codons, respectively, for use in the cloning procedure. The primers were synthesized at Statens Serum Institute by using a ABI-391 DNA synthesizer (Applied Biosystems). The primers used were as follows: tb7.3-sense, AAGAGTAGATCTATGATGGCCGAGGATGTTCGCG (creates a BglII site); tb7.3-antisense, CGGCGACGACGGATCCTACCGCGTCGG (creates a BamHI site); tb10.4-sense, GCAACACCCGGGATGTCGCAAATCATG (creates a SmaI site); and tb10.4-antisense, CTACTAAGCTTGGATCCCTAGCCGCCCCATTTGGCGG (creates a BamHI site). PCR was carried out in a thermal reactor (Rapid cycler; Idaho Technology, Salt Lake City, Utah) by using standard protocols (28). As template, M. tuberculosis H37Rv chromosomal DNA or plasmid DNA was used for the cloning of tb7.3 and tb10.4, respectively. The tb7.3 PCR product was cloned into the pCR2.1 cloning vector and transformed into One Shot cells (Invitrogen) as described by the manufacturer. Plasmid DNA (tb7.3) or PCR product (tb10.4) was digested with the appropriate restriction enzymes and cloned into either pMCT6 (16) (tb7.3) or pMST24 (32) (tb10.4) in frame with eight- or six-histidine residues, respectively. The correct insert was confirmed by sequencing of both DNA strands. DNA sequencing was performed at Statens Serum Institut by using the cycle sequencing system in combination with an automated gel reader (model 373A; Applied Biosystems).
The gene encoding CFP10 was cloned as described previously (9). The histidine-tagged recombinant proteins (rTB7.3, rTB10.4, and rCFP10) were expressed and purified by metal affinity chromatography by using a Talon column (Clontech, Palo Alto, Calif.) in the presence of 8 M urea, essentially as described by the manufacturer. Purification of the proteins to homogeneity was done by anion chromatography (35) with 1-ml Hitrap columns (Pharmacia). Protein concentrations were determined by the bicinchoninic acid test (Micro BCA Protein Assay Reagent kit; Pierce, Oud-Beijerland, The Netherlands). Lipopolysaccharide content in these preparations, measured by the Limulus amoebocyte lysate test (7), was always below 0.05 ng of lipopolysaccharide/µg of protein.Southern blotting. Genomic DNA from the different mycobacterial species listed in Table 1 was prepared as described previously (3). The Southern blotting was carried out as described elsewhere (22) with the following modifications: 2 µg of purified chromosomal DNA was digested to completion with PvuII and run on a 0.8% agarose gel. The gel was blotted onto a Hybond-N+ membrane (Amersham, Life Science, Buckinghamshire, Little Chalfont, England) in a vacuum transfer device (Milliblot-V system; Millipore).
The probe holding the whole ORF of the selected protein was amplified by PCR from plasmid DNA with the primers described above, and the probes were purified by a QIAquick PCR Purification kit (Qiagen, Hilden, Germany) and labeled by using the ECL direct nucleic acid labeling system (Amersham). Hybridization and detection were performed according to the instructions provided by the manufacturer.Human lymphocyte cultures. Seventeen Danish TB patients diagnosed and treated at the Department of Pulmonary Medicine, University Hospital of Copenhagen, Copenhagen Denmark, were asked to participate in the study. Blood samples were drawn between 0 and 6 months after diagnosis. Seven BCG-vaccinated and 7 nonvaccinated healthy individuals with no known history of exposure to patients with TB or laboratory exposure were recruited as controls. Blood samples were drawn 2 months to 40 years after BCG vaccination.
Separation, culture of peripheral blood mononuclear cells (PBMC), and measurement of IFN- in the supernatants were done as described
previously by Ravn et al. (26). A dose-response study of the
three recombinant proteins (rTB7.3, rTB10.4, and rCFP10) was carried
out by using 0.3 to 10 µg of antigen/ml of culture. ST-CF was used at
5 µg/ml. The detection limit of the IFN- assay was 50 pg/ml.
Positive responses were defined as delta values (IFN- release in the
antigen-stimulated well minus IFN- release in the unstimulated well)
above 200 pg/ml. IFN- release in unstimulated wells was generally
below 100 pg/ml. All IFN- analyses were done in duplicates on
supernatants pooled from three wells and were given as means. The
variation on duplicate wells was always less than 10% of the mean.
This part of the study was approved by the Local Ethical Committee for
Copenhagen and Frederiksberg (RH 01-282/96 and KF 01-369/98).
| |
RESULTS |
|---|
|
Top
Abstract
Introduction
Materials and Methods
Results
Discussion
References
|
|---|
Identification and recombinant expression of low-mass M. tuberculosis proteins. Despite the high biological activity of the low-mass fraction of culture filtrate, the components in this fraction have mostly remained elusive, as no distinct spots indicating significant quantities of protein can be detected in this region by 2-DE of culture filtrate preparations (30, 35).
We employed two different purification strategies to obtain fractions enriched in low-mass culture filtrate proteins. A 7-kDa protein was isolated by thiophilic adsorption chromatography, followed by anion-exchange chromatography. The 15 N-terminal amino acids of the purified protein were determined (AEDVRAEIVASVLEV) and used to search the Sanger sequence database (http://www.sanger.ac.uk). The search identified an ORF of 216 bp which encoded a protein (TB7.3) with a theoretical molecular mass of 7.3 kDa and a pI of 3.8 (Table 2). TB7.3 was similar to the C terminus of oxaloacetate decarboxylases and biotin carboxyl carrier proteins, and in agreement with this observation, TB7.3 was found to be biotinylated (I. Rosenkrands and P. Andersen, unpublished data).
|
gt11 M. tuberculosis genome library, and a phage clone with an insert
containing an ORF of 291 bp was identified. The ORF encoded a protein
of 96 amino acids (TB10.4) with a theoretical molecular mass of 10.4 kDa and a pI of 4.5. Searching the Sanger database, we identified two other deduced proteins (Rv3017c and Rv3019c) with homology to
TB10.4 (Table 2). To confirm the correct identification of TB10.4, we purified the protein recognized by the MAb PV-2 from culture
filtrate and obtained the N-terminal sequence (GHAGDMAGYAGTLQS). This sequence corresponds to residues 13 through 27 in TB10.4, and in addition to confirming our identification, it suggests an
alternative start site (the Leu [encoded by ttg] in
position 12 or the Met in position 11) or a partial cleavage of the
protein in culture filtrate. The sequences of TB7.3 and TB10.4
were analyzed by using the Signal P database
(http://www.cbs.dtu.dk/service/SignalP) and were not found to encode
conventional signal sequences. Interestingly, the database searches
identified both TB10.4 and the recently identified low-mass protein
CFP10 (9) as members of the ESAT-6 family, which consists of
small proteins homologous to ESAT-6 (Fig.
1) and organized in operon-like
structures on the mycobacterial genome (9, 12). TB7.3, on
the other hand, was found to be a low-molecular-mass antigen outside
the ESAT-6 family.
|
Characterization of low-mass M. tuberculosis
proteins.
CFP10 has not been characterized in detail, and we
therefore decided to investigate this molecule in comparison with TB7.3 and TB10.4. The molecules were mapped in a 2-DE reference map of
M. tuberculosis ST-CF components (35). This was
done by probing 2-DE immunoblots sequentially with MAb PV-2 and the
polyclonal antisera directed against TB7.3 (polyclonal antibody [PAb]
-TB7.3) and CFP10 (PAb -CFP10). The newly identified molecules
are present in low quantities in ST-CF, and in particular TB7.3 is
difficult to distinguish after silver staining. Western blotting
allowed mapping of the molecules to distinct positions around ESAT-6 in the region below 10 kDa. These positions were subsequently transferred to silver-stained duplicate gels and compared to the already
characterized proteins in this region (Fig.
2). No reaction was seen to
higher molecular mass components in ST-CF, indicating that
these molecules are mature proteins and not fragments of larger
molecules.
|
Immunological recognition of low-mass M. tuberculosis
proteins.
The immunological recognition of the purified low-mass
recombinant proteins was evaluated by stimulating PBMC isolated from TB
patients, BCG-vaccinated donors, and healthy nonvaccinated donors. A
dose-response investigation was conducted for TB7.3, TB10.4, and CFP10
with concentrations ranging from 0.3 to 10 µg/ml (Fig.
3). Figure 3 shows the IFN- levels in
lymphocyte cultures from two Danish TB patients and two healthy Danish
BCG-vaccinated donors stimulated with the antigens. The lymphocyte
response after stimulation with TB7.3 was moderate with IFN-
releases generally below 1,000 pg/ml (Fig. 3A). Neither IFN- nor
proliferative responses to this antigen (data not shown) reached more
than 20% of the responses seen with ST-CF. For the two ESAT-6 family
antigens (CFP10 and TB10.4), high levels of IFN- were induced with
increasing antigen concentrations (Fig. 3B and C). Optimal
concentrations of the antigens were between 1.25 and 10 µg/ml, and
these concentrations gave responses in the range of 1,000 to 4,000 pg
of IFN-/ml. The concentration of 5 µg of purified recombinant
antigen per ml was chosen for the subsequent comparative evaluation of
the three antigens and ESAT-6.
|
/ml versus 4,024 pg of IFN-/ml in the
same donors for ST-CF. The ESAT-6 family members were all recognized at
a much higher level. TB10.4 was recognized by both BCG-vaccinated donors (71% responders; median IFN- = 3,968 pg/ml versus 5,335 pg/ml in the same donors for ST-CF) and TB patients (88% responders; median IFN- = 3,298 pg/ml versus 4,707 pg/ml in the same donors for ST-CF). In the TB patients, CFP10 induced a pronounced release of
IFN- (median IFN- = 2,135 pg/ml versus 4,755 pg/ml in the same donors for ST-CF). As would be expected from the species distribution, reactivity to CFP10 and ESAT-6 was TB specific. These two
antigens were recognized only by individuals infected with M. tuberculosis and not by BCG-vaccinated and unvaccinated healthy Danes (Fig. 4).
|
in TB patients (P = 0.0017, Wilcoxon
signed-rank test), whereas T-cell responses to CFP10 and ESAT-6 were
similar (P = 0.121).
There was no correlation between the responses to the individual
antigens in responsive patients, and several patients recognized only
one or two of the three ESAT-6 family members.
| |
DISCUSSION |
|---|
|
Top
Abstract
Introduction
Materials and Methods
Results
Discussion
References
|
|---|
In the present study, three novel low-mass M. tuberculosis proteins were characterized and immune responses to
these molecules were evaluated. Two of these antigens, CFP10 and
TB10.4, were strongly recognized by >70% of the TB patients with
levels of IFN- comparable to or higher than that of ESAT-6, whereas
the third molecule, TB7.3, elicited only modest responses.
Interestingly, the two strong antigens, CFP10 and TB10.4, both have
several points in common with ESAT-6. They have almost identical size
and pI (10 kDa and 4.5, respectively), and both coding genes have
approximately 40% identity to esat-6. Together with a
number of other putative ORFs, these molecules constitute what has been
called the ESAT-6 family (9, 12). Our study clearly
demonstrates that the molecules from this gene family evaluated so far
also share a very striking immunological activity.
By searching different protein databases, it has not been possible from the primary structure of any of the proteins in the ESAT-6 family to provide clues as to the biological functions of these molecules. However, since there is no obvious homology to known proteins from other organisms, these proteins possibly have important mycobacterium-specific functions, which may be related to the intracellular habitat of the macrophage phagosome. In this regard, the apparent discrepancy between the low quantity of these molecules in vitro and the prominent role they play as targets in vivo may suggest that the expression of these molecules is highly upregulated during intracellular growth.
The homology of these molecules raises the question of whether
identical epitopes are being recognized on these different molecules.
The homology at the protein level is, however, relatively low (<20%),
and we found neither cross-reactivity between the two MAbs nor DNA
cross-hybridization between the three ESAT-6 family proteins (data not
shown). Furthermore, an alignment of the protein sequences (Fig. 1)
illustrates that the identical residues in these proteins are scattered
throughout the sequence with no stretches of epitope size. The strong
recognition of TB10.4 by BCG-vaccinated donors, which do not respond to
ESAT-6 and CFP10, and the fact that there is no correlation between the
responses to the individual antigens in responsive patients further
confirm that different epitopes are recognized on these different
molecules. Therefore, the explanation for the immunodominance of the
molecules within the ESAT-6 family should be sought elsewhere than in
their sequence homology. As alluded to above, we speculate that these molecules may have a role in bacterial virulence, and their synchronous upregulation during a particular phase of the infection may be part of
the explanation. Another common denominator is, of course, the small
size of these molecules, which may render them more susceptible to
proteolytic degradation, processing, and intracellular traffic.
However, the small size is on its own not enough, as illustrated by the
low activity found with TB7.3, which is not an ESAT-6 family member. Of
relevance in this regard, the immunological activity observed for TB7.3
is in agreement with the general picture which emerges from studies of
human T-cell recognition of mycobacterial antigens (10, 21, 33,
34). In a recent study by Mustafa and colleagues (21),
the majority of eight mycobacterial antigens were recognized by no more
than 25 to 50% of the TB patients tested and, in general, had IFN-
levels much below the responses to complex antigens, such as ST-CF and
purified protein derivative. Along the same line, a study by Ulrichs et
al. (33) recently reported that less than 20% of the TB
patients recognized the two mycobacterial antigens MPT64 and MPT63.
However, both of these studies, as well as other recent studies
(24, 26), have identified ESAT-6 as the target for an
extraordinary strong T-cell recognition and IFN- release in 65 to
95% of patients with TB from various geographical regions (21,
24, 26, 33).
The interspecies analysis demonstrated an identical distribution pattern of cfp10 and esat-6. The two genes are located in the same operon and are regulated by the same promoter (9). The cfp10-esat-6 operon is located in the RD-1 region, deleted in BCG (18), and in agreement with this, the genes were not found in any of the BCG strains tested.
The three ESAT-6 family proteins were all found in low concentrations in culture filtrate, although none of the proteins were found to have a conventional leader sequence for protein secretion (9, 31). In this regard, the increasing sensitivity of our identification and purification methods now allows the definition of molecules in ST-CF, which are present in very low quantities. This is exemplified by the difficulties in detecting the ESAT-6 family members in 2-DE gels by highly sensitive silver staining. Therefore, either a specific and yet undefined secretion mechanism may lead to the release of the ESAT-6 family members or these proteins represent cytoplasmic proteins which escape to the filtrate in trace amounts. With the lack of information on alternative translocation mechanisms in mycobacteria, this distinction is at present impossible.
Interestingly, CFP10 was found to induce strong IFN- responses in
PBMC from human TB patients, whereas low responses (<1,000 pg/ml) were
seen with PBMC from BCG-vaccinated healthy donors. This is in agreement
with recent data from the investigation of ESAT-6 responses in these
two groups of donors (26) and suggests that a combination of
CFP10 and ESAT-6 would have major potential as a diagnostic reagent.
The data from this study, taken together with other recent investigations of T-cell responses to ESAT-6, indicate a striking focusing of the host immune response toward members of the ESAT-6 family. Although further studies are needed to explain and fully understand the host pathogen interactions leading to this target selection, it is clear that the ESAT-6 family contains a number of immunodominant molecules of relevance for future TB vaccines and diagnostics.
| |
ACKNOWLEDGMENTS |
|---|
This investigation received financial support from the Danish National Association against Lung Diseases and The European Community (project no. BMH4-97-2134 and BMH4-97-2167).
We are grateful to Iben Nielsen and Vita Skov for excellent technical assistance and thank Laurens van Pinxteren for critical reading of the manuscript.
| |
FOOTNOTES |
|---|
* Corresponding author. Mailing address: Department of TB Immunology, Statens Serum Institut, Artillerivej 5, DK-2300 Copenhagen S, Denmark. Phone: 45 32 68 34 62. Fax: 45 32 68 30 35. E-mail: tbimm{at}ssi.dk.
Editor: S. H. E. Kaufmann
| |
REFERENCES |
|---|
|
Top
Abstract
Introduction
Materials and Methods
Results
Discussion
References
|
|---|
| 1. |
Andersen, A. B.,
A. Worsaae, and S. D. Chaparas.
1988.
Isolation and characterization of recombinant lambda gt11 bacteriophages expressing eight different mycobacterial antigens of potential immunological relevance.
Infect. Immun.
56:1344-1351 |
| 2. | Andersen, P., A. B. Andersen, A. L. Sorensen, and S. Nagai. 1995. Recall of long-lived immunity to Mycobacterium tuberculosis infection in mice. J. Immunol. 154:3359-3372[Abstract]. |
| 3. | Andersen, P., D. Askgaard, A. Gottschau, J. Bennedsen, S. Nagai, and I. Heron. 1992. Identification of immunodominant antigens during infection with Mycobacterium tuberculosis. Scand. J. Immunol. 36:823-831[CrossRef][Medline]. |
| 4. |
Andersen, P.,
D. Askgaard,
L. Ljungqvist,
J. Bennedsen, and I. Heron.
1991.
Proteins released from Mycobacterium tuberculosis during growth.
Infect. Immun.
59:1905-1910 |
| 5. | Andersen, P., and I. Heron. 1993. Simultaneous electroelution of whole SDS-polyacrylamide gels for the direct cellular analysis of complex protein mixtures. J. Immunol. Methods 161:29-39[CrossRef][Medline]. |
| 6. |
Andersen, P., and I. Heron.
1993.
Specificity of a protective memory immune response against Mycobacterium tuberculosis.
Infect. Immun.
61:844-851 |
| 7. |
Baek, L.
1983.
New, sensitive rocket immunoelectrophoretic assay for measurement of the reaction between endotoxin and Limulus amoebocyte lysate.
J. Clin. Microbiol.
17:1013-1020 |
| 8. | Barnes, P. F., V. Mehra, B. Rivoire, S. J. Fong, P. J. Brennan, M. S. Voegtline, P. Minden, R. A. Houghten, B. R. Bloom, and R. L. Modlin. 1992. Immunoreactivity of a 10-kDa antigen of Mycobacterium tuberculosis. J. Immunol. 148:1835-1840[Abstract]. |
| 9. |
Berthet, F. X.,
P. B. Rasmussen,
I. Rosenkrands,
P. Andersen, and B. Gicquel.
1998.
A Mycobacterium tuberculosis operon encoding ESAT-6 and a novel low-molecular-mass culture filtrate protein (CFP-10).
Microbiology
144:3195-3203 |
| 10. | Boesen, H., B. N. Jensen, T. Wilcke, and P. Andersen. 1995. Human T-cell responses to secreted antigen fractions of Mycobacterium tuberculosis. Infect. Immun. 63:1491-1497[Abstract]. |
| 11. | Brandt, L., T. Oettinger, A. Holm, and P. Andersen. 1996. Key epitopes on the ESAT-6 antigen recognized in mice during the recall of protective immunity to Mycobacterium tuberculosis. J. Immunol. 157:3527-3533[Abstract]. |
| 12. | Cole, S. T., R. Brosch, J. Parkhill, T. Garnier, C. Churcher, D. Harris, S. V. Gordon, K. Eiglmeier, S. Gas, C. E. Barry III, F. Tekaia, K. Badcock, D. Basham, D. Brown, T. Chillingworth, R. Connor, R. Davies, K. Devlin, T. Feltwell, and S. Gentles. 1998. Deciphering the biology of Mycobacterium tuberculosis from the complete genome sequence. Nature 393:537-544[CrossRef][Medline]. |
| 13. |
Coler, R. N.,
Y. A. Skeiky,
T. S. Vedvick,
T. Bement,
P. J. Ovendale,
A. Campos-Neto,
M. R. Alderson, and S. G. Reed.
1998.
Molecular cloning and immunologic reactivity of a novel low molecular mass antigen of Mycobacterium tuberculosis.
J. Immunol.
161:2356-2364 |
| 14. |
Elhay, M. J.,
T. Oettinger, and P. Andersen.
1998.
Delayed-type hypersensitivity responses to ESAT-6 and MPT64 from Mycobacterium tuberculosis in the guinea pig.
Infect. Immun.
66:3454-3456 |
| 15. | Harboe, M., T. Oettinger, H. G. Wiker, I. Rosenkrands, and P. Andersen. 1996. Evidence for occurrence of the ESAT-6 protein in Mycobacterium tuberculosis and virulent Mycobacterium bovis and for its absence in Mycobacterium bovis BCG. Infect. Immun. 64:16-22[Abstract]. |
| 16. |
Harboe, M.,
H. G. Wiker,
G. Ulvund,
A. S. Malin,
H. Dockrell,
A. Holm,
M. C. Jørgensen, and P. Andersen.
1998.
B-cell epitopes and quantification of the ESAT-6 protein of Mycobacterium tuberculosis.
Infect. Immun.
66:717-723 |
| 17. | Hunter, S. W., M. McNeil, R. L. Modlin, V. Mehra, B. R. Bloom, and P. J. Brennan. 1989. Isolation and characterization of the highly immunogenic cell wall-associated protein of Mycobacterium leprae. J. Immunol. 142:2864-2872[Abstract]. |
| 18. |
Mahairas, G. G.,
P. J. Sabo,
M. J. Hickey,
D. C. Singh, and C. K. Stover.
1996.
Molecular analysis of genetic differences between Mycobacterium bovis BCG and virulent M. bovis.
J. Bacteriol.
178:1274-1282 |
| 19. |
Mehra, V.,
B. R. Bloom,
A. C. Bajardi,
C. L. Grisso,
P. A. Sieling,
D. Alland,
J. Convit,
X. D. Fan,
S. W. Hunter, and P. J. Brennan.
1992.
A major T cell antigen of Mycobacterium leprae is a 10-kD heat-shock cognate protein.
J. Exp. Med.
175:275-284 |
| 20. | Mehra, V., J. H. Gong, D. Iyer, Y. Lin, C. T. Boylen, B. R. Bloom, and P. F. Barnes. 1996. Immune response to recombinant mycobacterial proteins in patients with tuberculosis infection and disease. J. Infect. Dis. 174:431-434[Medline]. |
| 21. | Mustafa, A. S., H. A. Amoudy, H. G. Wiker, A. T. Abal, P. Ravn, F. Oftung, and P. Andersen. 1998. Comparison of antigen specific T cell responses of tuberculosis patients using complex or single antigens of Mycobacterium tuberculosis. Scand. J. Immunol. 48:535-543[CrossRef][Medline]. |
| 22. |
Oettinger, T., and A. B. Andersen.
1994.
Cloning and B-cell-epitope mapping of MPT64 from Mycobacterium tuberculosis H37Rv.
Infect. Immun.
62:2058-2064 |
| 23. | Orme, I. M. 1988. Characteristics and specificity of acquired immunologic memory to Mycobacterium tuberculosis infection. J. Immunol. 140:3589-3593[Abstract]. |
| 24. | Pathan, A., R. Brookes, H. Pritchard, R. Wilkinson, G. Pasvol, A. Hill, and A. Lalvani. 1998. Human T cell responses to the antigen ESAT-6 characterize a vaccine candidate and potential diagnostic test for tuberculosis. Immun. Infect. 95:90. |
| 25. | Pollock, J. M., and P. Andersen. 1997. The potential of the ESAT-6 antigen secreted by virulent mycobacteria for specific diagnosis of tuberculosis. J. Infect. Dis. 175:1251-1254[Medline]. |
| 26. | Ravn, P., A. Demissie, T. Eguale, H. Wondwosson, D. Lein, H. Amoudy, A. S. Mustafa, A. K. Jensen, A. Holm, I. Rosenkrands, F. Oftung, J. Olobo, C. F. von-Reyn, and P. Andersen. 1999. Human T cell responses to the ESAT-6 antigen from Mycobacterium tuberculosis. J. Infect. Dis. 179:637-645[CrossRef][Medline]. |
| 27. |
Rosenkrands, I.,
P. B. Rasmussen,
M. Carnio,
S. Jacobsen,
M. Theisen, and P. Andersen.
1998.
Identification and characterization of a 29-kDa culture filtrate protein from Mycobacterium tuberculosis recognized in mice during the recall of immunity.
Infect. Immun.
66:2728-2735 |
| 27a. |
Rosenkrands, I.,
K. Weldingh,
P. Ravn,
L. Brandt,
P. Hojrup,
P. B. Rasmussen,
A. R. Coates,
M. Singh,
P. Mascagni, and P. Andersen.
1999.
Differential T-cell recognition of native and recombinant Mycobacterium tuberculosis GroES.
Infect. Immun.
67:5552-5558 |
| 28. | Sambrook, J., E. F. Fritsch, and T. Maniatis. 1989. Molecular cloning: a laboratory manual, 2nd ed. Cold Spring Harbor Laboratory, Cold Spring Harbor N.Y. |
| 29. | Silveira, H., D. Ordway, H. Dockrell, M. Jackson, and F. Ventura. 1997. Cell-mediated immune responses to mycobacterial antigens in patients with pulmonary tuberculosis and HIV infection. Clin. Exp. Immunol. 110:26-34[CrossRef][Medline]. |
| 30. | Sonnenberg, M. G., and J. T. Belisle. 1997. Definition of Mycobacterium tuberculosis culture filtrate proteins by two-dimensional polyacrylamide gel electrophoresis, N-terminal amino acid sequencing, and electrospray mass spectrometry. Infect. Immun. 65:4515-4524[Abstract]. |
| 31. | Sorensen, A. L., S. Nagai, G. Houen, P. Andersen, and A. B. Andersen. 1995. Purification and characterization of a low-molecular-mass T-cell antigen secreted by Mycobacterium tuberculosis. Infect. Immun. 63:1710-1717[Abstract]. |
| 32. | Theisen, M., J. Vuust, A. Gottschau, S. Jepsen, and B. Hogh. 1995. Antigenicity and immunogenicity of recombinant glutamate-rich protein of Plasmodium falciparum expressed in Escherichia coli. Clin. Diagn. Lab. Immunol. 2:30-34[Abstract]. |
| 33. | Ulrichs, T., M. E. Munk, H. Mollenkopf, S. Behr-Perst, R. Colangeli, M. L. Gennaro, and S. H. Kaufmann. 1998. Differential T cell responses to Mycobacterium tuberculosis ESAT-6 in tuberculosis patients and healthy donors. Eur. J. Immunol. 28:3949-3958[CrossRef][Medline]. |
| 34. |
Webb, J. R.,
T. S. Vedvick,
M. R. Aldersen,
J. A. Guderian,
S. S. Jen,
P. J. Ovendale,
S. M. Johnson,
S. G. Reed, and Y. A. Skeiky.
1998.
Molecular cloning, expression, and immunogenicity of MTB12, a novel low-molecular-weight antigen secreted by Mycobacterium tuberculosis.
Infect. Immun.
66:4208-4214 |
| 35. |
Weldingh, K.,
I. Rosenkrands,
S. Jacobsen,
P. B. Rasmussen,
M. J. Elhay, and P. Andersen.
1998.
Two-dimensional electrophoresis for analysis of Mycobacterium tuberculosis culture filtrate and purification and characterization of six novel proteins.
Infect. Immun.
66:3492-3500 |
| 36. |
Young, R. A.,
B. R. Bloom,
C. M. Grosskinsky,
J. Ivanyi,
D. Thomas, and R. W. Davis.
1985.
Dissection of Mycobacterium tuberculosis antigens using recombinant DNA.
Proc. Natl. Acad. Sci. USA
82:2583-2587 |
Infection and Immunity, January 2000, p. 214-220, Vol. 68, No. 1
0019-9567/0/$04.00+0
Copyright © 2000, American Society for Microbiology. All rights reserved.
This article has been cited by other articles:
-
Black, G. F., Thiel, B. A., Ota, M. O., Parida, S. K., Adegbola, R., Boom, W. H., Dockrell, H. M., Franken, K. L. M. C., Friggen, A. H., Hill, P. C., Klein, M. R., Lalor, M. K., Mayanja, H., Schoolnik, G., Stanley, K., Weldingh, K., Kaufmann, S. H. E., Walzl, G., Ottenhoff, T. H. M., and the GCGH Biomarkers for TB Consortium,
(2009). Immunogenicity of Novel DosR Regulon-Encoded Candidate Antigens of Mycobacterium tuberculosis in Three High-Burden Populations in Africa. CVI
16: 1203-1212
[Abstract] [Full Text] -
Abdallah, A. M., Savage, N. D. L., van Zon, M., Wilson, L., Vandenbroucke-Grauls, C. M. J. E., van der Wel, N. N., Ottenhoff, T. H. M., Bitter, W.
(2008). The ESX-5 Secretion System of Mycobacterium marinum Modulates the Macrophage Response. J. Immunol.
181: 7166-7175
[Abstract] [Full Text] -
Harrington, N. P., Surujballi, O. P., Prescott, J. F., Duncan, J. R., Waters, W. R., Lyashchenko, K., Greenwald, R.
(2008). Antibody Responses of Cervids (Cervus elaphus) following Experimental Mycobacterium bovis Infection and the Implications for Immunodiagnosis. CVI
15: 1650-1658
[Abstract] [Full Text] -
Lightbody, K. L., Ilghari, D., Waters, L. C., Carey, G., Bailey, M. A., Williamson, R. A., Renshaw, P. S., Carr, M. D.
(2008). Molecular Features Governing the Stability and Specificity of Functional Complex Formation by Mycobacterium tuberculosis CFP-10/ESAT-6 Family Proteins. J. Biol. Chem.
283: 17681-17690
[Abstract] [Full Text] -
Golby, P., Nunez, J., Cockle, P. J., Ewer, K., Logan, K., Hogarth, P., Vordermeier, H. M., Hinds, J., Hewinson, R. G., Gordon, S. V.
(2008). Characterization of two in vivo-expressed methyltransferases of the Mycobacterium tuberculosis complex: antigenicity and genetic regulation. Microbiology
154: 1059-1067
[Abstract] [Full Text] -
Billeskov, R., Vingsbo-Lundberg, C., Andersen, P., Dietrich, J.
(2007). Induction of CD8 T Cells against a Novel Epitope in TB10.4: Correlation with Mycobacterial Virulence and the Presence of a Functional Region of Difference-1. J. Immunol.
179: 3973-3981
[Abstract] [Full Text] -
Radosevic, K., Wieland, C. W., Rodriguez, A., Weverling, G. J., Mintardjo, R., Gillissen, G., Vogels, R., Skeiky, Y. A. W., Hone, D. M., Sadoff, J. C., van der Poll, T., Havenga, M., Goudsmit, J.
(2007). Protective Immune Responses to a Recombinant Adenovirus Type 35 Tuberculosis Vaccine in Two Mouse Strains: CD4 and CD8 T-Cell Epitope Mapping and Role of Gamma Interferon. Infect. Immun.
75: 4105-4115
[Abstract] [Full Text] -
Sable, S. B., Goyal, D., Verma, I., Behera, D., Khuller, G. K.
(2007). Lung and blood mononuclear cell responses of tuberculosis patients to mycobacterial proteins. Eur Respir J
29: 337-346
[Abstract] [Full Text] -
Sharma, A., Saha, A., Bhattacharjee, S., Majumdar, S., Das Gupta, S. K.
(2006). Specific and Randomly Derived Immunoactive Peptide Mimotopes of Mycobacterial Antigens. CVI
13: 1143-1154
[Abstract] [Full Text] -
Cockle, P. J., Gordon, S. V., Hewinson, R. G., Vordermeier, H. M.
(2006). Field Evaluation of a Novel Differential Diagnostic Reagent for Detection of Mycobacterium bovis in Cattle. CVI
13: 1119-1124
[Abstract] [Full Text] -
Sereinig, S., Stukova, M., Zabolotnyh, N., Ferko, B., Kittel, C., Romanova, J., Vinogradova, T., Katinger, H., Kiselev, O., Egorov, A.
(2006). Influenza Virus NS Vectors Expressing the Mycobacterium tuberculosis ESAT-6 Protein Induce CD4+ Th1 Immune Response and Protect Animals against Tuberculosis Challenge.. CVI
13: 898-904
[Abstract] [Full Text] -
Hervas-Stubbs, S., Majlessi, L., Simsova, M., Morova, J., Rojas, M.-J., Nouze, C., Brodin, P., Sebo, P., Leclerc, C.
(2006). High Frequency of CD4+ T Cells Specific for the TB10.4 Protein Correlates with Protection against Mycobacterium tuberculosis Infection.. Infect. Immun.
74: 3396-3407
[Abstract] [Full Text] -
Maue, A. C., Waters, W. R., Davis, W. C., Palmer, M. V., Minion, F. C., Estes, D. M.
(2005). Analysis of Immune Responses Directed toward a Recombinant Early Secretory Antigenic Target Six-Kilodalton Protein-Culture Filtrate Protein 10 Fusion Protein in Mycobacterium bovis-Infected Cattle. Infect. Immun.
73: 6659-6667
[Abstract] [Full Text] -
Koo, H. C., Park, Y. H., Ahn, J., Waters, W. R., Palmer, M. V., Hamilton, M. J., Barrington, G., Mosaad, A. A., Park, K. T., Jung, W. K., Hwang, I. Y., Cho, S.-N., Shin, S. J., Davis, W. C.
(2005). Use of rMPB70 Protein and ESAT-6 Peptide as Antigens for Comparison of the Enzyme-Linked Immunosorbent, Immunochromatographic, and Latex Bead Agglutination Assays for Serodiagnosis of Bovine Tuberculosis. J. Clin. Microbiol.
43: 4498-4506
[Abstract] [Full Text] -
Kang, Y. A., Lee, H. W., Yoon, H. I., Cho, B., Han, S. K., Shim, Y.-S., Yim, J.-J.
(2005). Discrepancy Between the Tuberculin Skin Test and the Whole-Blood Interferon {gamma} Assay for the Diagnosis of Latent Tuberculosis Infection in an Intermediate Tuberculosis-Burden Country. JAMA
293: 2756-2761
[Abstract] [Full Text] -
Sable, S. B., Kumar, R., Kalra, M., Verma, I., Khuller, G. K., Dobos, K., Belisle, J. T.
(2005). Peripheral Blood and Pleural Fluid Mononuclear Cell Responses to Low-Molecular-Mass Secretory Polypeptides of Mycobacterium tuberculosis in Human Models of Immunity to Tuberculosis. Infect. Immun.
73: 3547-3558
[Abstract] [Full Text] -
Dubnau, E., Chan, J., Mohan, V. P., Smith, I.
(2005). Responses of Mycobacterium tuberculosis to Growth in the Mouse Lung. Infect. Immun.
73: 3754-3757
[Abstract] [Full Text] -
Dietrich, J., Aagaard, C., Leah, R., Olsen, A. W., Stryhn, A., Doherty, T. M., Andersen, P.
(2005). Exchanging ESAT6 with TB10.4 in an Ag85B Fusion Molecule-Based Tuberculosis Subunit Vaccine: Efficient Protection and ESAT6-Based Sensitive Monitoring of Vaccine Efficacy. J. Immunol.
174: 6332-6339
[Abstract] [Full Text] -
Sable, S. B., Verma, I., Behera, D., Khuller, G. K.
(2005). Human immune recognition-based multicomponent subunit vaccines against tuberculosis. Eur Respir J
25: 902-910
[Abstract] [Full Text] -
Wilkinson, K. A., Stewart, G. R., Newton, S. M., Vordermeier, H. M., Wain, J. R., Murphy, H. N., Horner, K., Young, D. B., Wilkinson, R. J.
(2005). Infection Biology of a Novel {alpha}-Crystallin of Mycobacterium tuberculosis: Acr2. J. Immunol.
174: 4237-4243
[Abstract] [Full Text] -
Converse, S. E., Cox, J. S.
(2005). A Protein Secretion Pathway Critical for Mycobacterium tuberculosis Virulence Is Conserved and Functional in Mycobacterium smegmatis. J. Bacteriol.
187: 1238-1245
[Abstract] [Full Text] -
Weldingh, K., Rosenkrands, I., Okkels, L. M., Doherty, T. M., Andersen, P.
(2005). Assessing the Serodiagnostic Potential of 35 Mycobacterium tuberculosis Proteins and Identification of Four Novel Serological Antigens. J. Clin. Microbiol.
43: 57-65
[Abstract] [Full Text] -
Kamath, A. B., Woodworth, J., Xiong, X., Taylor, C., Weng, Y., Behar, S. M.
(2004). Cytolytic CD8+ T Cells Recognizing CFP10 Are Recruited to the Lung after Mycobacterium tuberculosis Infection. JEM
200: 1479-1489
[Abstract] [Full Text] -
Koo, H. C., Park, Y. H., Ahn, J., Waters, W. R., Hamilton, M. J., Barrington, G., Mosaad, A. A., Palmer, M. V., Shin, S., Davis, W. C.
(2004). New Latex Bead Agglutination Assay for Differential Diagnosis of Cattle Infected with Mycobacterium bovis and Mycobacterium avium subsp. paratuberculosis. CVI
11: 1070-1074
[Abstract] [Full Text] -
Scarpellini, P., Tasca, S., Galli, L., Beretta, A., Lazzarin, A., Fortis, C.
(2004). Selected Pool of Peptides from ESAT-6 and CFP-10 Proteins for Detection of Mycobacterium tuberculosis Infection. J. Clin. Microbiol.
42: 3469-3474
[Abstract] [Full Text] -
Shams, H., Klucar, P., Weis, S. E., Lalvani, A., Moonan, P. K., Safi, H., Wizel, B., Ewer, K., Nepom, G. T., Lewinsohn, D. M., Andersen, P., Barnes, P. F.
(2004). Characterization of a Mycobacterium tuberculosis Peptide That Is Recognized by Human CD4+ and CD8+ T Cells in the Context of Multiple HLA Alleles. J. Immunol.
173: 1966-1977
[Abstract] [Full Text] -
Spencer, J. S., Kim, H. J., Marques, A. M., Gonzalez-Juarerro, M., Lima, M. C. B. S., Vissa, V. D., Truman, R. W., Gennaro, M. L., Cho, S.-N., Cole, S. T., Brennan, P. J.
(2004). Comparative Analysis of B- and T-Cell Epitopes of Mycobacterium leprae and Mycobacterium tuberculosis Culture Filtrate Protein 10. Infect. Immun.
72: 3161-3170
[Abstract] [Full Text] -
Brock, I., Weldingh, K., Leyten, E. M. S., Arend, S. M., Ravn, P., Andersen, P.
(2004). Specific T-Cell Epitopes for Immunoassay-Based Diagnosis of Mycobacterium tuberculosis Infection. J. Clin. Microbiol.
42: 2379-2387
[Abstract] [Full Text] -
Okkels, L. M., Andersen, P.
(2004). Protein-Protein Interactions of Proteins from the ESAT-6 Family of Mycobacterium tuberculosis. J. Bacteriol.
186: 2487-2491
[Abstract] [Full Text] -
Majlessi, L., Rojas, M.-J., Brodin, P., Leclerc, C.
(2003). CD8+-T-Cell Responses of Mycobacterium-Infected Mice to a Newly Identified Major Histocompatibility Complex Class I-Restricted Epitope Shared by Proteins of the ESAT-6 Family. Infect. Immun.
71: 7173-7177
[Abstract] [Full Text] -
Okkels, L. M., Brock, I., Follmann, F., Agger, E. M., Arend, S. M., Ottenhoff, T. H. M., Oftung, F., Rosenkrands, I., Andersen, P.
(2003). PPE Protein (Rv3873) from DNA Segment RD1 of Mycobacterium tuberculosis: Strong Recognition of Both Specific T-Cell Epitopes and Epitopes Conserved within the PPE Family. Infect. Immun.
71: 6116-6123
[Abstract] [Full Text] -
Aagaard, C., Govaerts, M., Meng Okkels, L., Andersen, P., Pollock, J. M.
(2003). Genomic Approach to Identification of Mycobacterium bovis Diagnostic Antigens in Cattle. J. Clin. Microbiol.
41: 3719-3728
[Abstract] [Full Text] -
Smith, I.
(2003). Mycobacterium tuberculosis Pathogenesis and Molecular Determinants of Virulence. Clin. Microbiol. Rev.
16: 463-496
[Abstract] [Full Text] -
Black, G. F., Weir, R. E., Chaguluka, S. D., Warndorff, D., Crampin, A. C., Mwaungulu, L., Sichali, L., Floyd, S., Bliss, L., Jarman, E., Donovan, L., Andersen, P., Britton, W., Hewinson, G., Huygen, K., Paulsen, J., Singh, M., Prestidge, R., Fine, P. E. M., Dockrell, H. M.
(2003). Gamma Interferon Responses Induced by a Panel of Recombinant and Purified Mycobacterial Antigens in Healthy, Non-Mycobacterium bovis BCG-Vaccinated Malawian Young Adults. CVI
10: 602-611
[Abstract] [Full Text] -
Trajkovic, V., Singh, G., Singh, B., Singh, S., Sharma, P.
(2002). Effect of Mycobacterium tuberculosis-Specific 10-Kilodalton Antigen on Macrophage Release of Tumor Necrosis Factor Alpha and Nitric Oxide. Infect. Immun.
70: 6558-6566
[Abstract] [Full Text] -
Skjot, R. L. V., Brock, I., Arend, S. M., Munk, M. E., Theisen, M., Ottenhoff, T. H. M., Andersen, P.
(2002). Epitope Mapping of the Immunodominant Antigen TB10.4 and the Two Homologous Proteins TB10.3 and TB12.9, Which Constitute a Subfamily of the esat-6 Gene Family. Infect. Immun.
70: 5446-5453
[Abstract] [Full Text] -
Houghton, R. L., Lodes, M. J., Dillon, D. C., Reynolds, L. D., Day, C. H., McNeill, P. D., Hendrickson, R. C., Skeiky, Y. A. W., Sampaio, D. P., Badaro, R., Lyashchenko, K. P., Reed, S. G.
(2002). Use of Multiepitope Polyproteins in Serodiagnosis of Active Tuberculosis. CVI
9: 883-891
[Abstract] [Full Text] -
Cole, S.T.
(2002). Comparative mycobacterial genomics as a tool for drug target and antigen discovery. Eur Respir J
20: 78S-86s
[Abstract] [Full Text] -
Renshaw, P. S., Panagiotidou, P., Whelan, A., Gordon, S. V., Hewinson, R. G., Williamson, R. A., Carr, M. D.
(2002). Conclusive Evidence That the Major T-cell Antigens of the Mycobacterium tuberculosis Complex ESAT-6 and CFP-10 Form a Tight, 1:1 Complex and Characterization of the Structural Properties of ESAT-6, CFP-10, and the ESAT-6{middle dot}CFP-10 Complex. IMPLICATIONS FOR PATHOGENESIS AND VIRULENCE. J. Biol. Chem.
277: 21598-21603
[Abstract] [Full Text] -
Arend, S. M., Engelhard, A. C. F., Groot, G., de Boer, K., Andersen, P., Ottenhoff, T. H. M., van Dissel, J. T.
(2001). Tuberculin Skin Testing Compared with T-Cell Responses to Mycobacterium tuberculosis-Specific and Nonspecific Antigens for Detection of Latent Infection in Persons with Recent Tuberculosis Contact. CVI
8: 1089-1096
[Abstract] [Full Text] -
Vordermeier, H. M., Whelan, A., Cockle, P. J., Farrant, L., Palmer, N., Hewinson, R. G.
(2001). Use of Synthetic Peptides Derived from the Antigens ESAT-6 and CFP-10 for Differential Diagnosis of Bovine Tuberculosis in Cattle. CVI
8: 571-578
[Abstract] [Full Text] -
Olsen, A. W., van Pinxteren, L. A. H., Okkels, L. M., Rasmussen, P. B., Andersen, P.
(2001). Protection of Mice with a Tuberculosis Subunit Vaccine Based on a Fusion Protein of Antigen 85B and ESAT-6. Infect. Immun.
69: 2773-2778
[Abstract] [Full Text] -
Rook, G.A.W., Seah, G., Ustianowski, A.
(2001). M. tuberculosis: immunology and vaccination. Eur Respir J
17: 537-557
[Abstract] [Full Text] -
Betts, J. C., Dodson, P., Quan, S., Lewis, A. P., Thomas, P. J., Duncan, K., McAdam, R. A.
(2000). Comparison of the proteome of Mycobacterium tuberculosis strain H37Rv with clinical isolate CDC 1551. Microbiology
146: 3205-3216
[Abstract] [Full Text] -
Ulrichs, T., Anding, P., Porcelli, S., Kaufmann, S. H. E., Munk, M. E.
(2000). Increased Numbers of ESAT-6- and Purified Protein Derivative-Specific Gamma Interferon-Producing Cells in Subclinical and Active Tuberculosis Infection. Infect. Immun.
68: 6073-6076
[Abstract] [Full Text] -
Dillon, D. C., Alderson, M. R., Day, C. H., Bement, T., Campos-Neto, A., Skeiky, Y. A. W., Vedvick, T., Badaro, R., Reed, S. G., Houghton, R.
(2000). Molecular and Immunological Characterization of Mycobacterium tuberculosis CFP-10, an Immunodiagnostic Antigen Missing in Mycobacterium bovis BCG. J. Clin. Microbiol.
38: 3285-3290
[Abstract] [Full Text] -
Arend, S. M., Geluk, A., van Meijgaarden, K. E., van Dissel, J. T., Theisen, M., Andersen, P., Ottenhoff, T. H. M.
(2000). Antigenic Equivalence of Human T-Cell Responses to Mycobacterium tuberculosis-Specific RD1-Encoded Protein Antigens ESAT-6 and Culture Filtrate Protein 10 and to Mixtures of Synthetic Peptides. Infect. Immun.
68: 3314-3321
[Abstract] [Full Text] -
van Pinxteren, L. A. H., Ravn, P., Agger, E. M., Pollock, J., Andersen, P.
(2000). Diagnosis of Tuberculosis Based on the Two Specific Antigens ESAT-6 and CFP10. CVI
7: 155-160
[Abstract] [Full Text]
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Copyright © 2009 by the American Society for Microbiology. For an alternate route to Journals.ASM.org, visit: http://intl-journals.asm.org | More Info»