Previous Article | Next Article 
Infection and Immunity, January 2000, p. 328-334, Vol. 68, No. 1
0019-9567/0/$04.00+0
Copyright © 2000, American Society for Microbiology. All rights reserved.
Interleukin-8 Secretion of Cortical Tubular Epithelial Cells Is
Directed to the Basolateral Environment and Is Not Enhanced by
Apical Exposure to Escherichia coli
Sabine
Krüger,1
Ernst
Brandt,2
Matthias
Klinger,3
Stefan
Krüger,4 and
Burkhard
Kreft1,*
Department of Internal Medicine
I1 and Institutes of
Anatomy3 and
Pathology,4 Medical University of
Lübeck, D-23538 Lübeck, and Department of
Immunology and Cell Biology, Forschungszentrum
Borstel,2 D-23845 Borstel, Germany
Received 15 April 1999/Returned for modification 14 June
1999/Accepted 5 August 1999
 |
ABSTRACT |
In upper urinary tract infections, tubular epithelial cells (TEC)
may play a pivotal role in the initiation of the renal inflammatory response. They exert crucial immunological functions such as processing and presentation of foreign antigen, secretion of proinflammatory cytokines (interleukin-6 [IL-6] and tumor necrosis factor alpha) and
chemokines (IL-8, MCP-1, ENA-78, and RANTES). Since monolayer cultures
are a limited model for polarized tubular epithelial cells, we studied
the side-dependent IL-8 secretion of TEC by using cell culture inserts
as a basement membrane imitation. Primary cultures of proximal TEC were
stimulated with differently fimbriated mutants of Escherichia
coli, E. coli LPS, S-fimbria isolates, and IL-1
.
IL-8 protein was measured by enzyme-linked immunosorbent assay, and
IL-8-like biological activity was tested by measuring elastase release
from polymorphonuclear cells in supernatants of the upper and lower
compartments. IL-8 mRNA was compared by competitive PCR. IL-8 secretion
by TEC into the basolateral environment was significantly higher than
secretion into the apical compartment, representing the tubular lumen.
However, stimulation of IL-8 secretion by TEC was restricted to IL-1
and was not inducible by E. coli mutants, S fimbriae, or
lipopolysaccharide. With this in vitro model of polarized TEC, we show
that luminal contact of TEC with uropathogenic E. coli does
not result in enhanced IL-8 secretion. The basolaterally directed
production of the neutrophil chemotactic factor IL-8 by TEC after
stimulation with IL-1
might play an important role in the initiation
of inflammatory cell influx into the renal parenchyma.
 |
INTRODUCTION |
More than 80% of urinary tract
infections in adults are caused by Escherichia coli
(31). For E. coli, different factors of
virulence, e.g., lipopolysaccharides (LPS), hemolysins, or various
types of fimbriae, have been characterized (8). Multiple lines of evidence have emerged concerning the involvement of proximal tubular epithelial cells (TEC) in the renal immune response. These cells have been shown to express major histocompatibility complex (MHC)
class II antigens, which are essential for antigen presentation to
CD4+ lymphocytes (32) and cellular
adhesion molecules crucial for leukocyte migration, e.g.,
intercellular adhesion molecule-1 (16, 18) and VCAM-1
(6). They are capable of processing and presenting foreign
antigen (27) and, besides other cytokines, produce different chemokines, a group of low-molecular-weight cytokines with chemotactic functions. So far, the secretion of RANTES (14),
MCP-1 (10), ENA-78 (28), and interleukin-8 (IL-8)
(29) has been studied in TEC. Secretion of IL-8 is supposed
to be of major relevance for the influx of neutrophils after bacterial
contact. In earlier studies we showed that, in contrast to renal
carcinoma cells (3), the expression of MHC class II
molecules and intercellular adhesion molecule-1 by TEC could not be
significantly enhanced by S fimbriae, LPS, or E. coli
(21, 23). Furthermore, the secretion of IL-6, tumor necrosis
factor alpha, and IL-8 by TEC grown as monolayers could be stimulated
by cytokines, but not by S fimbriae, LPS, or E. coli
(23). Concerning signalling of TEC directed to the basolateral environment, the in vitro model of monolayer cultures grown
on a continuous surface has its limitations. Therefore, we tested
whether basolaterally directed IL-8 secretion by TEC differs from
luminal secretion and, if so, whether basolaterally directed IL-8
secretion can be stimulated by virulence factors of E. coli.
 |
MATERIALS AND METHODS |
Primary cell culture of TEC and electron microscopy.
Normal
renal tissue was obtained in the local Department of Urology from
nephrectomies due to tumors (23). Cells were grown from
1-mm3 pieces of renal cortex in Dulbecco's modified Eagle
medium-Ham's F-12 medium (BioWhittaker, Heidelberg, Germany)
supplemented with epidermal growth factor (10 ng/ml),
insulin-transferrin-sodium-selenite medium supplement (5 mg/liter),
hydrocortisone (37.4 µg/liter), 3,3-5-triiodo-L-thyronine
(40 mg/liter), penicillin (100 U/ml), streptomycin (100 µg/ml), and 1 M HEPES buffer (15 ml/liter of medium). All supplements were obtained
from Sigma, Deisenhofen, Germany, except for penicillin and
streptomycin (BioWhittaker). The purity and proximal tubular origin of
each cell culture were determined by immunohistochemistry by using
anti-cytokeratin (Dianova, Hamburg, Germany), anti-APM (kindly provided
by J. E. Scherberich, Frankfurt, Germany), anti-CD68, and
anti-factor VIII antibodies (both from Dako, Hamburg, Germany)
(21) and by electron microscopy. The ultrastructure of TEC
with a microvillus surface is presented in Fig.
1. For electron microscopy, small pieces
of the filter membrane covered with TEC were excised and fixed with
2.5% glutaraldehyde and 0.05% CaCl2 in 0.1 mol of
cacodylate buffer per liter (pH 7.4) for 2 h at 22°C. After a
washing and dehydration, the cells were embedded in araldite. Ultrathin
sections were cut on a Reichert Ultracut E and were stained with uranyl
acetate and lead citrate by using an ultrastainer (LKB, Bromma,
Sweden). Grids were examined with a Phillips EM400 at 60 kV. Only cells
in the second to fourth passages were used for this study.

View larger version (147K):
[in this window]
[in a new window]
|
FIG. 1.
Transmission electron micrograph of primary TEC in
culture demonstrates polarity and expression of microvilli on the cell
surface. Bar, 1 µm.
|
|
Mutants of E. coli.
Different mutants of the
uropathogenic O6:K15:H31 E. coli 536-21 wild type
(536-21wt), kindly provided by J. Hacker, Würzburg, Germany, have
been characterized according to their virulence properties
(12). The mutant 536-21del shows a spontaneous mutation with
lost in vivo virulence, including serum resistance and the production
of fimbriae and hemolysin. In order to study the influence of single
virulence factors, genes of wild-type fimbriae have been cloned and
introduced into the deletion mutant 536-21del as shown in Table
1. Before use, 108
bacteria/ml were fixed in 1.25% glutaraldehyde for 1 h at room temperature to ensure sterile cell culture conditions. In former studies, fixed E. coli has been shown to preserve
its stimulating properties (2). S fimbriae were
isolated and purified by gradient ultracentrifugation as
described recently (23).
Cell stimulation.
A total of 4 × 104 TEC
were cultured overnight in culture inserts (Falcon, Heidelberg,
Germany) with 0.4-µm pores (1.6 × 106
pores/cm2) and a 0.31-cm2 growth area. On the
following day, TEC were stimulated with E. coli mutants
(108/ml; fixated in 1.25% glutaraldehyde), IL-1
(1 ng/ml), LPS (1 µg/ml), or S fimbriae (1 µg/ml) on the apical side.
The total volume in the upper compartment of the culture was 200 µl
after stimulation, and in the lower compartment it was 800 µl. The
supernatants in the upper and lower compartments were harvested after
24 to 72 h. After 72 h the viability was >87.5%.
Permeability, determined by diffusion of phenol red as described
previously (25), was inhibited by a confluent monolayer
(4 × 104 cells/insert) by more than 75%.
Supernatants were stored at
80°C until examination for IL-8 protein
content and neutrophil-directed stimulating activity.
ELISA for IL-8.
For the measurement of IL-8 protein in the
cell culture supernatants, a sandwich-type enzyme-linked immunosorbent
assay (ELISA) with IL-8-specific antibodies, developed at the Research
Center Borstel (Borstel, Germany), was used. Briefly, wells of U-bottom microassay plates (Dynatech, Denkendorf, Germany) were coated with 10 µg of monoclonal antibody (MAb) 94.1 (raised in BALB/c-mice against
recombinant IL-8 [rIL-8] conjugated to myoglobin) per ml in 0.1 M
bicarbonate (pH 9) overnight at 4°C. After an extensive washing, all
subsequent incubation steps with antigen-containing samples and
immunoreagents were performed in dilution buffer (phosphate-buffered saline-Tween-1.5% bovine serum) at 37°C for 1 h. A polyclonal rabbit anti-IL-8 serum, induced by immunization with a synthetic peptide representing the C-terminal part of the IL-8 molecule (residues
54 to 72), was used as a detecting antibody. Peroxidase-conjugated goat
anti-rabbit immunoglobulin G (Dianova, Hamburg, Germany) served as a
secondary antibody, and development was performed by using
o-phenylenediamine-H2O2 as
previously described (4). For quantification, a standard of
recombinant monocytic IL-8 (rmIL-8; i.e., the 72-residue isoform),
produced at the Research Center Borstel, was run in parallel on each
assay plate. As determined by solid-phase ELISA and Western blotting,
neither MAb 94.1 nor the rabbit anti-IL-8 serum exhibited any
cross-reactivity to the IL-8-related chemokines NAP-2, CTAP-III, IP-10,
PF-4, and MGSA/GRO.
Neutrophil elastase release assay.
To estimate their
contents in IL-8-like biological activity, cell culture supernatants
were tested for their capacity to induce the release of lysosomal
elastase in suspended, cytochalasin B-pretreated polymorphonuclear
neutrophil granulocytes (PMN). The isolation of these granulocytes from
the freshly drawn blood of single healthy donors by gradient
centrifugation on Ficoll-Hypaque, cell stimulation, and the measurement
of released elastase enzymatic activity was performed as previously
described (5). A standard of rmIL-8 (see above) was run in
parallel to the cell culture samples, and results were expressed as
IL-8 activity equivalents. In some experiments, anti-IL-8 MAb (MAb
94.1) at a final concentration of 2 µg/ml, a level sufficient to
neutralize the activity of 100 ng of IL-8 per ml, was added to the
supernatants (final dilution, 1 in 2) in order to estimate the
proportion of IL-8-associated neutrophil-stimulating capacity in the supernatants.
Extraction and reverse transcription of mRNA.
For
quantification of IL-8 mRNA, tubular epithelial cells (106)
were stimulated with different mutants of E. coli
536-21 or IL-1
(1 ng/ml) for 24 h. Polyadenylated RNA was
purified by using a direct mRNA purification kit (Dynal, Hamburg,
Germany) according to the manufacturer's protocol. After the final
purification step the mRNA was resuspended in a volume of 30 µl. For
the reverse transcription, 10 µl of mRNA solution was incubated with
0.5 µg of Oligo-dT12-18-Primer (Pharmacia,
Freiburg, Germany) at 70°C for 10 min. Reverse transcription was
performed in MMLV-RT-(RNase H
)-Buffer (Gibco, Eggenstein,
Germany), 4× 0.5 mM deoxynucleoside triphosphate (dNTP;
Pharmacia), 2 mM dithiothreitol (Gibco), 12.5 mU of RNAguard
(Pharmacia), 200 U of MMLV-Superscript reverse transcriptase (Gibco),
and diethylpyrocarbonate-H2O. The total reaction mixture
(20 µl) was then incubated at 37°C for 1 h.
PCR.
As primers for glyceraldehyde-3-phosphate dehydrogenase
(GAPDH), we used 5'-d(AACAGCGACACCCACTCCTC)-3' (sense) and
5'-d(GGAGGGGAGATTCAGTGTG GT)-3' (antisense) at an annealing
temperature of 67°C, resulting in a 258-bp fragment. All cDNA was
normalized for GAPDH expression before competitive PCR. As
intron-spanning IL-8 cDNA primers, 5'-d(TGCCAAGGAGTGCTAAAG)-3'
(sense) and 5'-d(TCTCAGCCCTCTTCAA AA)-3' (antisense)
were used at an annealing temperature of 52°C, yielding a product of
219 bp. For quantification of IL-8 cDNA, a competitive segment was
generated according to the method of Schmouder et al. (28);
it consisted of the same priming sites and base composition as the IL-8
template but was shortened by 119 bp. PCR was performed in a reaction
volume of 25 µl. Then, 1.0 µl of cDNA (1:10) was added to a
Taq-buffer solution (Gibco) in H2O containing
1.5 mM MgCl2, 1 µM specific primer, 2.5 mM concentrations of each dNTP, and 0.625 U of Taq polymerase (Gibco). For the
competitive PCR, 1 µl of the competitive segment in a known dilution
was coamplified with 1 µl of IL-8 cDNA. The dilution that yielded the
same amount of cDNA as for IL-8 was recorded. Subsequently, 25 (GAPDH)
or 30 (IL-8) cycles of PCR were completed (94°C for 1 min, annealing temperature for 1 min, and 72°C for 1 min and 30 s extended by 2 s per cycle and followed by 10 min of elongation at 72°C) in a
Biometra thermal cycler. The PCR product was visualized on 2.0% agarose gels in Tris-borate-EDTA buffer stained with ethidium bromide.
Immunohistochemistry.
Serial 6-µm cryostat sections of
renal tissue with histopathological diagnosis of acute pyelonephritis
were prepared for APAAP staining as described earlier (9).
One month before, E. coli (106/ml) was found in
the urine culture of this patient. Briefly, sections were fixed with
acetone for 10 min and then incubated with polyclonal anti-IL-8
antibody (see above) for 1 h, an intermediate mouse anti-rabbit
antibody for 30 min, and rabbit anti-mouse antibody for 30 min. A
complex of alkaline phosphatase and monoclonal anti-alkaline phosphatase antibody was added for 30 min. Finally, the sections were
stained with new fuchsin and counterstained with Meyer's hematoxylin.
The stains were reviewed by a pathologist (S.K.) from the Institute of
Pathology, Medical University, Lübeck, Germany.
 |
RESULTS |
Time-dependent stimulation of IL-8 secretion by TEC.
For the
detection of IL-8 by ELISA, as well as of IL-8-like biological activity
by the neutrophil elastase release assay, the same supernatants,
derived from the TEC of three different donors, were used. Stimulation
of TEC with IL-1
(1 ng/ml) over a period of 0 to 72 h resulted
in increased secretion of IL-8 and IL-8-like activity. Secretion,
higher than backround levels, was first detected in the upper
compartment, where from 4 h of stimulation on, IL-8 protein and
activity levels increased with time, reaching maximal values
after 24 h (Fig. 2A and B,
respectively). The onset of secretion in the lower compartment,
representing the basolateral environment, occurred at 24 h, after
which time relatively high IL-8 protein levels, as well as activity
levels, were present. Maximal values were obtained after 72 h of
stimulation. As measured by ELISA, after the initial luminal IL-8
release the secretion of the chemokine was mainly directed to the
basolateral side (Fig. 2A). In contrast, IL-8-like biological activity,
as measured by the neutrophil elastase release assay, was at all time
points higher in the upper compartment, representing the luminal
environment (Fig. 2B). This result suggested that additional neutrophil-directed stimuli, other than IL-8, were also secreted by
stimulated TEC. Inhibition studies of neutrophil elastase release with a neutralizing anti-IL-8 MAb revealed that stimulation with upper-compartment supernatants was only partially (the maximum value was 50.1% after 48 h) blocked by anti-IL-8 MAb, whereas stimulation with lower-compartment supernatants could be completely blocked (data not shown). This indicates that the proportion of IL-8 in
upper-compartment supernatants is lower than was suggested by elastase
release assay.

View larger version (27K):
[in this window]
[in a new window]
|
FIG. 2.
Time kinetics of IL-8 secretion by stimulated TEC. A
total of 104 TEC/well were stimulated with IL-1 (1 ng/ml) in cell culture inserts over a period of 2 to 72 h.
Secretion toward the upper and lower compartments was recorded. For
each time point, supernatants of four wells were pooled and the IL-8
secretion was measured by ELISA (Fig. 2A). The functional activity of
IL-8 production was determined by the neutrophil elastase release assay
(Fig. 2B). The median of three experiments is shown. Data are given as
nanograms of IL-8 protein (ELISA) and IL-8-like biological activity in
nanogram IL-8 equivalents (release assay) contained in the total volume
of supernatants.
|
|
IL-8 secretion after incubation with different strains
of E. coli.
For the E. coli mutants
used for this study the adherence modalities have been characterized.
As recently published (21), S-fimbria-bearing strains showed
the strongest adhesion, while the deletion mutant bound the least to
primary TEC. In the present study we investigated the influence of
E. coli mutants on IL-8 secretion. Stimulation of TEC
by the different mutants of E. coli for 24 or 48 h did
not result in a significant increase of IL-8 secretion compared to
unstimulated controls, as determined by both ELISA and neutrophil
elastase release assay (Table 2).
Nevertheless, after the stimulation of TEC with IL-1
, IL-8 secretion
increased and was preferably directed to the basolateral environment.
Furthermore, the IL-8 secretion of peripheral blood mononuclear cells
(PBMC) could not be enhanced by E. coli mutants (data not
shown).
View this table:
[in this window]
[in a new window]
|
TABLE 2.
IL-8 production by TEC after stimulation with differently
fimbriated mutants of E. coli (108/ml) and
IL-1 (1 ng/ml) in cell culture insertsa
|
|
IL-8 secretion after incubation with E. coli S fimbriae
and LPS.
S fimbriae were isolated from E. coli
HB101(pANN801-4) (23). In previous studies, S
fimbriae have been shown to adhere to primary TEC (21) and
to induce IL-6 production and ICAM-1 expression by renal carcinoma
cells (20). By the same protocol as was used with the
E. coli mutants, TEC were incubated with isolates of S
fimbriae (1 µg/ml), E. coli LPS (1 µg/ml), and
IL-1
(1 ng/ml) for 24 and 48 h. S fimbriae and LPS did not
increase IL-8 secretion to either the luminal or the basolateral
surface. IL-1
-stimulated IL-8 secretion after 24 and 48 h was
again higher in the lower compartment (data not shown). However,
incubation of PBMC with S fimbriae and LPS resulted in higher IL-8
production than stimulation with IL-1
(Fig.
3).

View larger version (20K):
[in this window]
[in a new window]
|
FIG. 3.
IL-8 secretion of PBMC (2 × 107/well)
either unstimulated or after incubation with IL-1 (1 ng/ml),
E. coli LPS (1 µg/ml), or S fimbriae (1 µg/ml) for 24 and 48 h. Cytokine production was determined in duplicate by
sandwich ELISA.
|
|
Expression of IL-8 mRNA by TEC stimulated with E. coli
mutants.
As previously reported by Schmouder et al.
(28), we generated a competitive segment for IL-8 cDNA.
Unstimulated TEC showed basal expression of IL-8 mRNA (0.1 ng/ml).
Incubation of TEC, derived from three different patients, with E. coli mutants did not result in an increase in IL-8 mRNA. However,
stimulation with IL-1
enhanced IL-8 mRNA expression of all TEC
significantly (Fig. 4).

View larger version (24K):
[in this window]
[in a new window]
|
FIG. 4.
Expression of IL-8 mRNA by TEC after stimulation with
E. coli mutants and IL-1 was determined by competitive
PCR as described in Materials and Methods. To exclude DNA
contamination, negative controls were run without cDNA template. One
representative experiment of three is shown.
|
|
In vivo detection of IL-8 in pyelonephritis.
To investigate in
vivo IL-8 production in bacterial inflammation, we performed
immunohistochemical staining with a polyclonal anti-IL-8
antibody on cryostat sections of active pyelonephritis from a
patient with clinically significant bacteriuria. As shown in Fig.
5A, IL-8 was found in the tubular
epithelium at the site of inflammation. Stains from normal kidney
(Fig. 5B), as well as the control without primary antibody, remained
negative for IL-8.

View larger version (128K):
[in this window]
[in a new window]
|
FIG. 5.
Immunohistochemical detection of IL-8 on cryostat
sections of renal tissue from active pyelonephritis (A) and normal
kidney (B). Tubular epithelium in inflammatory areas of the kidney with
interstitial nephritis showed a positive reaction with polyclonal
anti-IL-8 antibody. The slides were stained with APAAP complex and
counterstained with hematoxylin as described in Materials and Methods.
Magnification, ×600.
|
|
 |
DISCUSSION |
The chemoattractant protein IL-8 has been shown to be of major
relevance for the influx and transendothelial migration of neutrophils
to sites of inflammation (15). In experimental LPS-induced dermatitis and arthritis, as well as in lung reperfusion injury and
acute immune complex glomerulonephritis, the administration of
anti-IL-8 antibody prevented neutrophil infiltration and subsequent neutrophil-dependent tissue damage (13). Patients with
sepsis caused by gram-negative and gram-positive organisms showed
elevated serum IL-8 levels, and a correlation between the initial serum IL-8 and fatal outcome was found (11). Furthermore, in
patients with acute E. coli pyelonephritis, IL-8 levels were
elevated in serum and urine (17).
Besides infiltrating cells of the immune system, e.g.,
polymorphonuclear cells (7) or macrophages (24),
renal mesangial (1, 22) and cortical epithelial
(29) cells produce IL-8. In an earlier study we demonstrated
that primary cultures of proximal tubular epithelial cells
constitutively produce low levels of IL-8 mRNA and protein and can be
stimulated with IL-1
for IL-8 secretion. No stimulation after
exposure to differently fimbriated E. coli was seen
(23). Other investigators described a polarity of renal
tubular epithelium cultured on microporous cell culture inserts
(26, 30). Recently, Phillips et al. reported that proximal
tubular cells secrete transforming growth factor
1 equally into the
apical and basolateral compartments only after basolateral exposure to
platelet-derived growth factor in combination with
D-glucose (25). Against this background, we
stimulated primary tubular epithelial cells on cell culture inserts on
the apical side, representing the tubular lumen, with mutants of
E. coli, S-fimbria isolates, LPS, and IL-1
. After
incubation with IL-1
, an increase of IL-8 production on both the
mRNA and protein levels was detected. After initial luminal secretion
of IL-8, which might contribute to detection of IL-8 in the urine of
patients with pyelonephritis (17), the secretion of IL-8 was
preferably directed to the basolateral environment. No increase of IL-8
production was seen after the exposure of TEC to E. coli
mutants, S fimbriae, or LPS. However, in mononuclear cells, IL-8
secretion was induceable by LPS and S fimbriae. This result can
partially be explained by our recent findings that TEC do not express
CD14, the receptor for LPS (23). We conclude that, in vitro,
renal proximal TEC secrete IL-8 directed to the basolateral environment
after stimulation with IL-1
. In a rat model of acute obstructive
pyelonephritis induced by E. coli, increased IL-8 production
by the tubular epithelium has recently been demonstrated
(19). Accordingly, in human renal tissue from
pyelonephritis, TEC at the site of inflammation were also stained by
anti-IL-8 antibody, while in cryostat sections of normal kidney no IL-8
was found. However, further investigations will need to elucidate the
initiation factors of the immune response after contact of bacteria
with the tubular epithelium.
 |
ACKNOWLEDGMENTS |
This study was supported by the Deutsche
Forschungsgemeinschaft, Sonderforschungsbereich 367, B3, and C4.
We also acknowledge the expert technical assistance of C. Pongratz and
F. Müller.
 |
FOOTNOTES |
*
Corresponding author. Mailing address: Medizinische
Klinik I, Medizinische Universität zu Lübeck, Ratzeburger
Allee 160, 23538 Lübeck, Germany. Phone: 49-451-500-2336. Fax:
49-451-500-3380. E-mail: sskrueger{at}aol.com.
Editor:
J. R. McGhee
 |
REFERENCES |
| 1.
|
Abbott, F.,
J. J. Ryan,
M. Ceska,
K. Matsushima,
C. E. Sarraf, and A. J. Rees.
1991.
Interleukin-1 stimulates human mesangial cells to synthesize and release interleukin-6 and -8.
Kidney Int.
40:597-605[Medline].
|
| 2.
|
Agace, W.,
S. Hedges,
U. Anderson,
J. Anderson,
M. Ceska, and C. Svanborg.
1993.
Selective cytokine production by epithelial cells following exposure to Escherichia coli.
Infect. Immun.
61:602-609[Abstract/Free Full Text].
|
| 3.
|
Agace, W. W.,
M. Patarroyo,
M. Svensson,
E. Carlemalm, and C. Svanborg.
1995.
Escherichia coli induces transuroepithelial neutrophil migration by an intercellular adhesion molecule-1-dependent mechanism.
Infect. Immun.
63:4054-4062[Abstract].
|
| 4.
|
Brandt, E.,
F. Petersen, and H.-D. Flad.
1993.
A novel molecular variant of the neutrophil-activating peptide NAP-2 with enhanced biological activity is truncated at the C-terminus: identification by antibodies with defined epitope specificity.
Mol. Immunol.
30:979-991[CrossRef][Medline].
|
| 5.
|
Brandt, E.,
J. Van Damme, and H.-D. Flad.
1991.
Neutrophils can generate their activator neutrophil-activating peptide 2 by proteolytic cleavage of platelet-derived connective tissue-activating peptide III.
Cytokine
3:311-321[CrossRef][Medline].
|
| 6.
|
Brockmeyer, C.,
M. Ulbrecht,
D. Schendel,
E. H. Weiss,
D. Hillebrand,
K. Burckhardt,
W. Land,
M. J. Gokel,
G. Riethmüller, and H. E. Feucht.
1993.
Distribution of cell adhesion molecules (ICAM-1, VCAM-1, ELAM-1) in renal tissue during allograft rejection.
Transplantation
55:610-615[Medline].
|
| 7.
|
Cassatella, M. A.,
F. Bazzoni,
M. Ceska,
I. Ferro,
M. Baggiolini, and G. Berton.
1992.
IL-8 production by human polymorphonuclear leukocytes: the chemoattractant formyl-methionyl-leucyl-phenylalanine induces the gene expression and release of IL-8 through a pertussis toxin-sensitive pathway.
J. Immunol.
148:3216-3220[Abstract].
|
| 8.
|
Donnenberg, M. S., and R. A. Welch.
1996.
Virulence determinants of uropathogenic Escherichia coli, p. 136-174.
In
H. L. T. Mobley, and J. W. Warren (ed.), Virulence determinants of uropathogenic Escherichia coli. American Society for Microbiology, Washington, D.C.
|
| 9.
|
Erber, W. N.,
A. J. Pinching, and D. Y. Mason.
1984.
Immunocytochemical detection of T and B cell populations in routine blood smears.
Lancet
i:1042-1046.
|
| 10.
|
Gesualdo, L.,
G. Grandaliano,
E. Ranieri,
R. Monno,
V. Montinaro,
C. Manno, and R. P. Schena.
1997.
Monocyte recruitment in cryoglobulinemic membranoproliferative glomerulonephritis: a pathogenetic role for monocyte chemotactic peptide-1.
Kidney Int.
51:155-163[Medline].
|
| 11.
|
Hack, C. E.,
M. Hart,
R. J. M. Strack van Schijndel,
A. J. M. Eerenberg,
J. H. Nuijens,
L. G. Thijs, and L. A. Aarden.
1992.
Interleukin-8 in sepsis: relation to shock and inflammatory mediators.
Infect. Immun.
60:2835-2842[Abstract/Free Full Text].
|
| 12.
|
Hacker, J.,
G. Schmidt,
C. Hughes,
S. Knapp,
M. Marget, and W. Goebel.
1985.
Cloning and characterization of genes involved in production of mannose-resistant, neuraminidase-susceptible (X) fimbriae from a uropathogenic O6:K15:H31 Escherichia coli strain.
Infect. Immun.
47:434-440[Abstract/Free Full Text].
|
| 13.
|
Harada, A.,
N. Sekido,
T. Akahoshi,
T. Wada,
N. Mukaida, and K. Matsushima.
1994.
Essential involvement of interleukin-8 (IL-8) in acute inflammation.
J. Leukoc. Biol.
56:559-564[Abstract].
|
| 14.
|
Heeger, P.,
G. Wolf,
C. Neyers,
M. J. Sun,
S. O'Farrell,
M. Krensky, and E. G. Neilson.
1992.
Isolation and characterization of cDNA from renal tubular epithelium encoding murine RANTES.
Kidney Int.
41:220[Medline].
|
| 15.
|
Huber, A. R.,
S. L. Kunkel,
R. T. Todd, and S. J. Weiss.
1991.
Regulation of transendothelial neutrophil migration by endogenous interleukin-8.
Science
254:99-102[Abstract/Free Full Text].
|
| 16.
|
Ishikura, H.,
C. Takahashi,
K. Kanagawa,
H. Hirata,
K. Imai, and T. Yoshiki.
1991.
Cytokine regulation of ICAM-1 expression on human renal tubular epithelial cells in vitro.
Transplantation
51:1272-1275[Medline].
|
| 17.
|
Jacobson, S. H.,
B. Hylander,
B. Wretlind, and A. Brauner.
1994.
Interleukin-6 and interleukin-8 in serum and urine in patients with acute pyelonephritis in relation to bacterial-virulence-associated traits and renal function.
Nephron
67:172-179[Medline].
|
| 18.
|
Jevnikar, A. M.,
R. P. Wuthrich,
F. Takei,
H.-W. Xu,
D. C. Brennan,
L. H. Glimcher, and V. E. Rubin-Kelley.
1990.
Differing regulation and function of ICAM-1 and class II antigens on renal tubular cells.
Kidney Int.
38:417-425[Medline].
|
| 19.
|
Kaboré, A. F.,
M. Simard, and M. G. Bergeron.
1999.
Local production of inflammatory mediators in an experimental model of acute obstructive pyelonephritis.
J. Infect. Dis.
179:1162-1172[CrossRef][Medline].
|
| 20.
|
Kreft, B.,
S. Bohnet,
O. Carstensen,
J. Hacker, and R. Marre.
1993.
Differential expression of interleukin-6, intercellular adhesion molecule 1, and major histocompatibility complex class II molecules in renal carcinoma cells stimulated with S fimbriae of uropathogenic Escherichia coli.
Infect. Immun.
61:3060-3063[Abstract/Free Full Text].
|
| 21.
|
Kreft, B.,
M. Placzek,
C. Doehn,
J. Hacker,
G. Schmidt,
G. Wasenauer,
M. R. Daha,
F. J. van der Woude, and K. Sack.
1995.
S fimbriae of uropathogenic Escherichia coli bind to primary human renal proximal tubular epithelial cells but do not induce expression of intercellular adhesion molecule 1.
Infect. Immun.
63:3235-3238[Abstract].
|
| 22.
|
Kusner, D. J.,
E. L. Luebbers,
R. J. Nowinski,
M. Konieczkowski, and J. R. Sedor.
1991.
Cytokine and LPS-induced synthesis of interleukin-8 from human mesangial cells.
Kidney Int.
39:1240-1248[Medline].
|
| 23.
| Leeker, A., M. Ernst, S. Krüger, K. Sack, and B. Kreft. Lack of cytokine response in human tubular epithelial cells
following exposure to Escherichia coli. Submitted for
publication.
|
| 24.
|
Lin, C.-Y., and T.-P. Huang.
1994.
Gene expression and release of interleukin-8 by peritoneal macrophages and polymorphonuclear leukocytes during peritonitis in uremic patients on continuous ambulatory peritoneal dialysis.
Nephron
68:437-441[Medline].
|
| 25.
|
Phillips, A. O.,
R. Steadman,
K. Morrisey, and J. D. Williams.
1997.
Polarity of stimulation and secretion of transforming growth factor-beta 1 by cultured proximal tubular cells.
Am. J. Pathol.
150:1101-1111[Abstract].
|
| 26.
|
Prozialeck, W. C., and P. C. Lamar.
1993.
Surface binding and uptake of cadmium (Cd2+) by LLC-PK1 cells on permeable membrane supports.
Arch. Toxicol.
67:113-119[CrossRef][Medline].
|
| 27.
|
Rubin-Kelley, V., and G. G. Singer.
1993.
The antigen presentation function of renal tubular epithelial cells.
Exp. Nephrol.
1:102-111[Medline].
|
| 28.
|
Schmouder, R. L.,
R. M. Strieter,
A. Walz, and S. L. Kunkel.
1995.
Epithelial-derived neutrophil-activating factor-78 production in human renal tubule epithelial cells and in renal allograft rejection.
Transplantation
59:118-124[Medline].
|
| 29.
|
Schmouder, R. L.,
R. M. Strieter,
R. C. Wiggins,
S. W. Chensue, and S. L. Kunkel.
1992.
In vitro and in vivo interleukin-8 production in human renal cortical epithelia.
Kidney Int.
41:191-198[Medline].
|
| 30.
|
Schramek, H.,
G. Gstraunthaler,
C. C. Willinger, and W. Pfaller.
1993.
Hyperosmolality regulates endothelin release by Madin-Darby canine kidney cells.
J. Am. Soc. Nephrol.
4:206-213[Abstract].
|
| 31.
|
Warren, J. W.
1996.
Clinical presentation and epidemiology of urinary tract infections, p. 3-27.
In
H. L. T. Mobley, and J. W. Warren (ed.), Urinary tract infections. Molecular pathogenesis and clinical management. American Society for Microbiology, Washington, D.C.
|
| 32.
|
Wuthrich, R. P.,
L. H. Glimcher,
M. A. Yui,
A. M. Jevnikar,
S. E. Dumas, and V. E. Kelley.
1990.
MHC class II, antigen presentation and tumor necrosis factor in renal tubular epithelial cells.
Kidney Int.
37:783-792[Medline].
|
Infection and Immunity, January 2000, p. 328-334, Vol. 68, No. 1
0019-9567/0/$04.00+0
Copyright © 2000, American Society for Microbiology. All rights reserved.
This article has been cited by other articles:
-
Kreft, B., Jabs, W. J., Laskay, T., Klinger, M., Solbach, W., Kumar, S., van Zandbergen, G.
(2002). Polarized Expression of Tamm-Horsfall Protein by Renal Tubular Epithelial Cells Activates Human Granulocytes. Infect. Immun.
70: 2650-2656
[Abstract]
[Full Text]