Previous Article | Next Article 
Infection and Immunity, October 2000, p. 5928-5932, Vol. 68, No. 10
0019-9567/00/$04.00+0
Copyright © 2000, American Society for Microbiology. All rights reserved.
Phase Variation in H Type I and Lewis a Epitopes of
Helicobacter pylori Lipopolysaccharide
Ben J.
Appelmelk,1,*
M. Celeste
Martino,2
Eveline
Veenhof,1
Mario A.
Monteiro,3
Janneke J.
Maaskant,1
Riccardo
Negrini,4
Frank
Lindh,5
Malcolm
Perry,3
Giuseppe
Del
Giudice,2 and
Christina M. J. E.
Vandenbroucke-Grauls1
Department of Medical Microbiology, Vrije
Universiteit, Medical School, 1081 BT Amsterdam, The
Netherlands1; IRIS Research Center,
Chiron SpA, Siena,2 and Laboratory Unit,
City Hospital, Brescia,4 Italy;
National Research Council, Ottawa,
Canada3; and Isosep, Tullinge,
Sweden5
Received 21 April 2000/Returned for modification 7 July
2000/Accepted 21 July 2000
 |
ABSTRACT |
Helicobacter pylori NCTC 11637 lipopolysaccharide (LPS)
expresses the human blood group antigens Lewis x (Lex),
Ley, and H type I. In this report, we demonstrate that the
H type I epitope displays high-frequency phase variation. One variant expressed Lex and Ley and no H type I as
determined by serology; this switch was reversible. Insertional
mutagenesis in NCTC 11637 of JHP563 (a poly(C) tract containing an open
reading frame homologous to glycosyltransferases) yielded a
transformant with a serotype similar to the phase variant. Structural
analysis of the NCTC 11637 LPS confirmed the loss of the H type I
epitope. Sequencing of JHP563 in strains NCTC 11637, an H type
I-negative variant, and an H type I-positive switchback variant showed
a C14 (gene on), C13 (gene off), and C14 tract, respectively.
Inactivation of strain G27, which expresses Lex,
Ley, H type I, and Lea, yielded a transformant
that expressed Lex and Ley. We conclude that
JHP563 encodes a
3-galactosyltransferase involved in the
biosynthesis of H type I and Lea and that phase variation
in H type I is due to C-tract changes in this gene. A second H type
I-negative variant (variant 3a) expressed Lex and
Lea and had lost both H type I and Ley
expression. Inactivation of HP093-HP094 resulted in a transformant expressing Lex and lacking Ley and H type I. Structural analysis of a mutant LPS confirmed the serological data. We
conclude that the HP093-HP094
2-fucosyltransferase (
2-FucT) gene
product is involved in the biosynthesis of both Ley and
Lex. Finally, we inactivated HP0379 in strain 3a. The
transformant had lost both Lex and Lea
expression, which demonstrates that the HP0379 gene product is both an
3- and an
4-FucT. Our data provide understanding at the molecular
level of how H. pylori is able to diversify in the host, a
requirement likely essential for successful colonization and transmission.
 |
INTRODUCTION |
The human gastric pathogen
Helicobacter pylori displays molecular mimicry with the
gastric epithelial cells of the human host (3). Often,
H. pylori lipopolysaccharide (LPS) expresses both Lewis x
(Lex) (see Fig. 1) and Ley human blood group
antigens, but strains expressing sialyl-Lex, H type I,
Lea, Leb, and the nonfucosylated
polylactosamine chain (i-antigen) have been described (16,
17); strains expressing H type 2 have not been found yet. For
biosynthesis of Lex/y antigens, the activity of a variety
of glycosyltransferases is required:
2- and
3-fucosyltransferases
(
2- and
3-FucT),
4-galactosyltransferases (
4-GalT) and
3-N-acetylglucosaminyltransferases (
3-GlcNAcT). Two
3-fucT genes, homologues of HP0379 and HP0651 of H. pylori strain 26695, have been identified (13, 15). The
products of these genes have different fine specificities
(5). For this reason, the homologues of HP0379 and HP0651
are designated futA and futB, respectively;
2-fucT (the homologue of gene HP093-HP094 in strain
26695) is designated futC (21, 22). A
4-galT gene has recently been identified in H. pylori (the homologue of HP0826 in strain 26695 [14]). It is unknown which gene codes for
3-GalT and
3-GlcNAcT. In vitro, the recombinant futC gene
product is able to form H type I from a synthetic Gal
1.3GlcNAc
acceptor (22), but formal proof of the involvement of this
gene in biosynthesis of H type I in H. pylori LPS is lacking.
A striking feature of H. pylori Lewis antigens is their
ability to phase vary (4, 5). Phase variation is defined as the high-frequency, reversible switching of phenotype. For instance, a
strain expressing Lex may yield phase variants expressing
Ley or the i-antigen. Phase variation in other bacteria
like Haemophilus influenzae and Neisseria spp.
has been shown to contribute to bacterial virulence and host adaptation
(13). We have shown that populations of H. pylori
LPS phase variants can be isolated from the human stomach, which
provides evidence that LPS phase variation contributes to strain
diversity in the human host (6). The molecular mechanism of
phase variation in Lex/y has been investigated recently
(5). Long homopolymeric C tracts present in the open reading
frames of futA, futB, and futC may change length during replication due to DNA slippage ("slipped-strand mispairing"). The result is a reversible (translational) frame switch
that leads to either a full-length active gene product (fucosyltransferase enzyme) or an inactive truncated form.
Phase variation in H type I or Lea has not been documented
yet. In this paper, we show that the H type I and Lea
epitopes are also phase variable, and we identify a hitherto unrecognized gene (
3-galT) required for biosynthesis of
these epitopes. We also demonstrate that phase variation in this gene is due to length changes in a C tract. We also show that the
futA gene product is capable of acting as an
4-FucT,
which is required for Lea biosynthesis, and that the
futC gene product is essential for biosynthesis of H type I.
 |
MATERIALS AND METHODS |
Bacterial strains and LPSs.
Strains NCTC 11637, G27, and
phase variant 3a have been described before (4, 8, 11). The
LPSs of strains J223 (expresses H type I [16]) and
UA948 (expresses Lea [16]) were purified
as described previously (16).
MAbs, synthetic glycoconjugates, and serological procedures.
The monoclonal antibodies (MAbs) used in this study and their
specificities are shown in Table 1.
Determination of the epitope fine specificity of MAbs 4D2 and 218/2B3
was done by enzyme-linked immunosorbent assay (ELISA) by testing their
reactivity with synthetic glycoconjugates as described before
(2) (Table 2). Two types of
conjugates were used, linked to polyacrylamide (PAA; Syntesome, Moscow,
Russia) or linked to protein, i.e., either human serum albumin (HSA),
bovine serum albumin, or keyhole limpet hemocyanin (KLH) (all three
prepared at Isosep, Tullinge, Sweden). LPS phase variants were isolated
by colony blot and serotyped by ELISA as previously described
(4). The frequency of phase variation is defined as the
percentage of colonies expressing a given variant serotype
(4).
Insertional mutagenesis of glycosyltransferase genes.
Plasmids for inactivation of glycosyltransferase genes were constructed
as follows. A DNA fragment containing futA (the homologue of
HP0379 of strain 26695) was amplified from H. pylori 26695 genomic DNA by PCR with primers SM119704 (TTCTAAAGTGGATCCTGAAAT) and SM119706 (GAGTGGGCGAAAGAGAGATTG), positioned
approximately 1 kb from the 5' and 3' ends of HP0379, respectively. The
construction of plasmid pHP0379::Kmr, carrying
the futA gene interrupted with a kanamycin cassette, has
been described before (5, 15). This plasmid was used to
inactivate futA in strain 3a by natural transformation.
A plasmid for inactivation of
futC (the homologue of
HP093-HP094 of strain 26695) was constructed as follows. A DNA fragment
containing
futC was amplified with primers FT

1-2F
(TCTAATACGCCTGTGCTGTT)
and FT

1-2R
(CCAATACGCCTCTTCTTCTT) and ligated into pGEM-T, cut
out with
SacII-
SpeI, and ligated into
SacII-
SpeI-opened plasmid
pBC

3, carrying a
kanamycin cassette (
9). This plasmid was
used to inactivate
futC in strain NCTC 11637 by natural
transformation.
A plasmid for the inactivation of
3-galT (the homologue
of JHP563 in strain J99 and HP619 in strain 26695, respectively)
was
constructed as follows. Primers J563-F1
(CGGGGTACCAGCTCGTTTCAGAATCCAATGAG),
J563-F2
(TCGACTGCAGCCAAAGAACTACCTGAGTCTTGC), J563-R1
(TCGACTGCAGTCTTGTTGCGTTTCTTGTGTGGG),
and J563-R2
(ATTTGCGGCCGCTTAAAGGAGCGTATCGTCTGCTG), containing
5'
restriction sites for
KpnI,
PstI,
PstI, and
NotI, respectively,
were used to
amplify two DNA fragments, CM1 and CM2, of the
3-galT gene (calculated length, 540 and 627 bp, respectively) that were
cloned
separately into plasmid pSK to yield pCM1 and pCM2; these
were digested
with
KpnI-
PstI and
PstI-
NotI, respectively. The
gel-purified
fragments were cloned together into linearized pSK
containing
compatible ends (
KpnI and
NotI) to yield pCM12. A
PstI-restricted
kanamycin cassette was cloned into the
unique
PstI site of pCM12.
The resulting plasmid was used to
mutate
3-galT in strains NCTC
11637 and G27; the
H. pylori transformants were selected by kanamycin
resistance.
PCR analysis of transformants.
H. pylori transformants
were analyzed by PCR to confirm that the recombination had occurred at
the intended location. For each of the three inactivated
glycosyltransferase genes, one primer was located outside the DNA
fragment cloned and the other primer was located in the kanamycin
cassette. For futA in strain 3a, KO379 primer N-379
(AGCAGCCCCAATAAAGAAAT, located upstream from SM119704 in
HP0378) was used in combination with KanaR-Gl
(TTTAGACATCTAAATCTAGG); the calculated product length is
3,097 bp. For futC, primer N2-93/94 (GAACGCTTGCTAGAACACTC, located upstream from FT
1.2F in
HP093-HP094) was used in combination with KanInvF
(TTACCTATCACCTCAAATGG); the calculated product length is 873 bp. For
3-galT, primer N-619 (AAGTCAAAGGCGTTTGGATA,
located upstream from J563F-1 in JHP563) was used in combination
with KanInvF; the calculated product length is 601 bp.
DNA sequencing.
C-tract sequencing of
3-fucT
genes HP0379 and HP0651 was performed as previously described
(5). C-tract sequencing of JHP563 was carried out on
chromosomal DNA purified by cesium chloride centrifugation and on gene
fragments amplified by PCR with primers F1 and R2 (1,215 bp). The
sequencing of both the PCR products containing the C tract and of
genomic DNA was performed with primer CM4F
(ATGCAAGCCTTAGAAGATTGCTTG); likewise, G tracts in the
opposite strand were sequenced with primer CM3R
(TCCTACGATATTCTTATACACTTC). Sequencing of both C and G
tracts was carried out thrice: twice with template DNA from separate
PCR amplifications and once with chromosomal DNA.
Structural analysis of LPS.
LPSs of NCTC 11637-derived
mutants in futC and
3-galT were methylated and
subjected to fast atom bombardment-mass spectrometry (FAB-MS) as
previously described (5).
 |
RESULTS AND DISCUSSION |
Characterization of MAbs 4D2 (anti-H type I) and 218/2B3
(anti-Lea).
MAb 4D2 reacted with H type I linked to
KLH or HSA but not with H type I linked to PAA; it did not react with
any of the other glycoconjugates tested. In addition, this MAb reacted
strongly (optical density at 492 nm [OD492] > 2.5) with
LPS of strain J223, which by structural analysis has been shown to
contain H type I (16). MAb 218/2B3 reacted with HSA-
and KLH-linked Lea, with the
Gal
1-3GlcNAc
-1-3Gal
1-4Glc-containing blood group related
neoglycoprotein lacto-N-tetraose (LNT)-KLH, and with
PAA-linked Lea and Leb. In addition, this MAb
reacted strongly (OD492 > 2.5) with LPS of strain
UA948, which has been shown by structural analysis to contain
Lea (16). We concluded (Table 2) that MAb 4D2
reacts exclusively with H type I and that serotyping results obtained
with 218/2B3 need to be interpreted with care.
Characterization of H type I-negative phase variants and
identification of genes involved in H type I biosynthesis.
We
first isolated H type I-negative variants of NCTC 11637. After probing
colony blots of strain NCTC 11637 with anti-H type I MAb 4D2, H type
I-negative colonies were isolated and serotyped by ELISA (Table
3). The H type I-negative variant 3a has
been described earlier (4). Three types of variants were
obtained: variant H1, which was H type I negative, i positive, and
Lex/y positive (frequency of phase variation, 0.45%);
variant H12, which had a strongly decreased H type I expression, was
Ley negative, and was Lex positive (frequency
of phase variation, 0.6%); and strain H13, which was Ley
positive and Lex negative (frequency of phase variation,
0.3%). Strain 3a (frequency of phase variation, 0.3%) represented a
fourth type of H type I-negative variant; this strain was
Ley negative, had a strongly decreased H type I expression,
expressed Lex, and in addition was Lea/b
positive.
We first investigated whether the loss of H type I expression was
reversible: H11 (H type I negative) was colony blotted with
the anti-H
type I MAb 4D2, and a 4D2-positive colony (named variant
H111) was
isolated and serotyped; the LPS serotype of H111 (frequency
of phase
variation, 1.1%) was identical to that of NCTC 11637
(Table
3). Thus,
strain NCTC 11637 was able to phase vary reversibly
in the H type I
epitope without a simultaneous loss of Le
y expression.
Based on the structures shown in Fig.
1,
we hypothesized
that phase variation in a
3-galT gene
would explain the reversible
switch in phenotype observed: when this
gene was off, no H type
I can be formed, with synthesis of
Le
x and Le
y still being possible. As yet, no
3-galT gene has been annotated
for either strain 26695 or
J99; however, several other genes with
sequence homology to
glycosyltransferases have been identified
(
1,
19). We
investigated one of these genes, JHP563 from
strain J99 (the homologue
of gene HP0619 in strain 26695), because
it has sequence similarity to
lic2b, a gene necessary for LPS
biosynthesis in
H. influenzae; in addition, JHP563 and HP0619
contain homopolymeric C
tracts, signatures of phase variation.
We inactivated the JHP563
homologue of NCTC 11637 with conventional
recombinant techniques; the
knockout mutant NCTC 11637 KO563 indeed
lacked the H type I epitope and
had an increase in Le
y expression (Table
3); inactivation
of the gene in another strain
(G27) also yielded a mutant that lacked H
type I (Table
3). PCR
analysis (observed product length of 600 bp
versus calculated
length of 600 bp) demonstrated that the mutation
indeed had taken
place in a homologue of JHP563. Of interest, G27 also
expresses
Le
a, while the isogenic JHP563 knockout lacked
this antigen; this
suggests that the JHP563 homologue plays a role in
the synthesis
of both H type I and Le
a.

View larger version (25K):
[in this window]
[in a new window]
|
FIG. 1.
Structure of Lewis blood group antigens and
glycosyltransferases required for biosynthesis. Gal,
D-galactose; Fuc, L-fucose; GlcNAc,
N-acetyl-D-glucosamine.
|
|
The LPS structure of NCTC KO563 was compared with that of its parent
NCTC 11637. Recently, NCTC 11637 was shown to express,
in addition to
Le
x (
8), two other Lewis determinants
(
17), Le
y [
m/z 812

606(812-206)]
and H type 1 [638

228(638-410)]. The FAB-MS
of the
intact LPS of methylated NCTC 11637 KO563 yielded strong
ions at
m/z 189 for terminal Fuc,
m/z 812

606 for
Le
y,
m/z 1435

1229 for
Le
y
Le
x,
m/z 682 for
Fuc-(1

3)-GlcNAc-(1

7)-DDHep,
m/z 886 for
Fuc-(1

3)-GlcNAc-(1

7)-[Glc-1

2]-DDHep,
and
m/z 1090 for Fuc-(1

3)-GlcNAc-(1

7)-[Glc-1

6-Glc-1

2]-DDHep.
No ions
indicative of H type 1, 638

228, were observed in this
FAB-MS. These
data confirmed the loss of the H type I epitope
and the increased
expression of Le
y that were also seen in serological
examinations (Table
3).
Our findings demonstrate that JHP563 determines the biosynthesis of the
H type I epitope and Le
a and suggest that JHP563 codes for
a

3-GalT. Evidence for a role
of this gene in phase variation in the
H type I epitope was obtained
by sequencing this
3-galT
in strains NCTC 11637, H11, and H111.
Poly(C) tract lengths were as
follows: C14 for NCTC 11637, C13
for H11, and C14 for H111. No other
differences in DNA sequence
of
3-galT in these strains
were observed (data not shown). A
3-galT with a
C
14 tract yields a full-length polypeptide, while
a
C
13 tract yields a truncated product; this is in agreement
with
the serological data that show that the NCTC 11637 and H111
express
H type I, while this epitope is absent in strain H11. These
data
confirm the role of JHP563 homologues in H type I phase variation
and confirm that they encode a

3-GalT.
The second class of H type I-negative variants we isolated is
exemplified by variant H13, which expresses Le
y only. We
described variants of the H13 phenotype in a previous
paper; this
phenotype is due to phase variation in

3-GlcNAcT
(
4).
The third class of H type I-negative variants was exemplified by the
two similar yet distinctive strains, H12 and 3a (Table
3). Both were
Le
x positive, with a decreased expression of H type I and
Le
y as compared to NCTC 11637; in addition, 3a expressed
Le
a/b. A colony blot of strain NCTC 11637 probed with MAb
218/2B3 (anti-Le
a/b) yielded a variant (strain LeA,
frequency of variation, 0.6%)
with a serotype indistinguishable from
that of strain 3a (Table
3). This simultaneous loss of H type I and
Le
y in strain 3a was reversible. An H type I-positive
switchback
variant (strain 3a1; frequency of variation, 1.0%) with a
serotype
similar to that of strain NCTC 11637 was isolated from strain
3a by colony blotting after probing with MAb 4D2 (Table
3). The
simultaneous loss of H type I and Le
y can be explained by
phase variation in
futC, the gene encoding

2-FucT
(encoded by a homologue of HP093-HP094 of strain 26695).
Inactivation
of
futC in strain NCTC 11637 yielded a mutant (NCTC
KO93-KO94) with an LPS phenotype similar to that of strain 3a
(Table
3); PCR analysis of NCTC 11637 KO93-KO94 (observed product
length of
850 bp versus calculated length of 873 bp) demonstrated
that the
mutation had indeed taken place in
futC. We believe that
the
phenotype of the
futC knockout is due to inactivation of
futC and not to polar effects, because in both strains 26695 and J99,
futC is not in an operon and the genes downstream
have an orientation
opposite to that of
futC. In addition,
the genes downstream code
for a restriction-modification system, not
likely to influence
LPS phenotype; finally, the observed phenotype is
as expected,
since earlier in vitro studies had shown that FutC is able
to
fucosylate Gal

1.3GlcNAc to form H type I (
22). The
reaction
of this knockout mutant with MAb 218/2B3 indicates that it
expressed
Le
a and not Le
b, because synthesis of
Le
b requires an active

2-FucT, while this enzyme is not
required
for Le
a biosynthesis (Fig.
1). The LPS structure
of NCTC KO93-KO94 was
compared with that of its parent, NCTC 11637. The
FAB-MS of the
methylated intact NCTC 11637 KO93-KO94 indicated the
presence
of the sole blood group antigen, Le
x
[638

432(638-206)], along with
m/z 682 for
Fuc-(1

3)-GlcNAc-(1

7)-DDHep.
These data demonstrate that
Le
y and H type I, both present in parent strain NCTC 11637 (
17),
had been lost upon mutagenesis of
futC.
These findings demonstrated
the role of the HP093-HP094 homologue in
biosynthesis of both
Le
y and H type I and extended findings
that purified, recombinant
HP093-HP094 is able to

2-fucosylate the
synthetic acceptor Gal

1.3GlcNAc
to yield H type I (
22).
The molecular basis of phase variation
in
futC has already
been elucidated (
21) and is due to length
changes in C
tracts, as well as to ribosomal
slippage.
Finally, we investigated which gene encodes the

4-FucT that is
required for biosynthesis of the Le
a epitope. Previously,
we have shown that two

3-FucTs are involved
in biosynthesis of
Le
x (
5); the genes encoding the two enzymes are
futA and
futB.
The gene
futB is off in
NCTC 11637 (
5), and sequencing data
showed that this is also
the case in strain 3a; both strains have
a C
9 tract which
leads to biosynthesis of a truncated polypeptide.
In contrast,
futA is on in both strains (a C
10 tract). We
tested
the hypothesis that FutA is also involved in Le
a
biosynthesis and able to transfer fucose to the C
4 position
of
GlcNAc. PCR analysis of the
futA knockout mutant of
strain 3a
(3a KO379) demonstrated that the mutation had taken place at
the
intended location (observed product length of 3.2 kb versus
calculated
length of 3,097 bp). As determined by serology, 3a KO379
indeed
lacked Le
a and expressed only the nonfucosylated
polylactosamine (i-antigen)
and H type I. This demonstrated that FutA
is both an

3- and an

4-FucT. These findings extend the recently
published data of
Rasko et al. (
18) that show that also FutB
is both an

3- and

4-FucT.
In summary, we have identified the
3-galT gene that is
essential for biosynthesis of H type I and Le
a and
demonstrated that this gene phase varies through DNA slippage
in a
poly(C) tract. In addition, we have shown that
futC and
futA are involved not only in biosynthesis of
Le
x/y but also in that of H type I and Le
a.
These findings complement earlier studies of phase variation
in
Le
x and Le
y (
4,
5,
21) and show that
H. pylori has a great potential
to diversify. The biological
role of
H. pylori Lewis antigens
remains largely unknown.
Recent data, however, show that Lewis
antigens might be adhesins
(
12); phase variation in LPS might
allow attachment and
detachment of bacteria by this on-off expression
of Lewis antigens and
hence facilitate transmission and colonization
(
7).
 |
ACKNOWLEDGMENTS |
We are extremely grateful to Antonello Covacci, IRIS Research
Center, Chiron SpA, Siena, Italy, for the precious advice and guidance
at the beginning of this experimental work, and Silvia Guidotti, IRIS
Research Center, for help with the nucleotide sequencing.
 |
FOOTNOTES |
*
Corresponding author. Mailing address: Department of
Medical Microbiology, Vrije Universiteit, Medical School, van der
Boechorststraat 7, 1081 BT Amsterdam, The Netherlands. Phone: 31 20 4448297. Fax: 31 20 4448318. E-mail:
BJ.Appelmelk.mm{at}med.vu.nl.
Editor:
R. N. Moore
 |
REFERENCES |
| 1.
|
Alm, R. A.,
L. L. Ling,
D. T. Moir,
B. L. King,
E. D. Brown,
P. C. Doig,
D. R. Smith,
B. Noonan,
B. C. Guild,
B. L. deJonge,
G. Carmel,
P. J. Tummino,
A. Caruso,
M. Uria-Nickelsen,
D. M. Mills,
C. Ives,
Q. Jiang,
D. E. Taylor,
G. F. Voviv, and T. J. Trust.
1999.
Comparison of two unrelated isolates of the human gastric pathogen Helicobacter pylori.
Nature
397:176-180[CrossRef][Medline].
|
| 2.
|
Appelmelk, B. J.,
I. M. Simoons-Smit,
R. Negrini,
A. P. Moran,
G. O. Aspinall,
J. G. Forte,
T. De Vries,
H. Quan,
T. Verboom,
J. J. Maaskant,
P. Ghiara,
E. J. Kuipers,
E. Bloemena,
T. M. Tadema,
R. R. Townsend,
K. Tyagarajan,
J. M. Crothers, Jr.,
M. A. Monteiro,
A. Savio, and J. de Graaff.
1996.
Potential role of molecular mimicry between Helicobacter pylori lipopolysaccharide and host Lewis blood group antigens in autoimmunity.
Infect. Immun.
64:2031-2040[Abstract].
|
| 3.
|
Appelmelk, B. J.,
R. Negrini,
A. P. Moran, and E. J. Kuipers.
1997.
Molecular mimicry between Helicobacter pylori and the host.
Trends Microbiol.
5:70-73[CrossRef][Medline].
|
| 4.
|
Appelmelk, B. J.,
B. Shiberu,
C. Trinks,
N. Tapsi,
P. Y. Zheng,
T. Verboom,
J. Maaskant,
C. H. Hokke,
W. E. C. M. Schiphorst,
D. Blanchard,
I. M. Simoons-Smit,
D. H. van den Eijnden, and C. M. J. E. Vandenbroucke-Grauls.
1998.
Phase variation in Helicobacter pylori lipopolysaccharide.
Infect. Immun.
66:70-76[Abstract/Free Full Text].
|
| 5.
|
Appelmelk, B. J.,
S. L. Martin,
M. A. Monteiro,
C. A. Clayton,
A. A. McColm,
P. Y. Zheng,
T. Verboom,
J. J. Maaskant,
D. H. Van den Eijnden,
C. H. Hokke,
M. B. Perry,
C. M. J. E. Vandenbroucke-Grauls, and J. G. Kusters.
1999.
Phase variation in Helicobacter pylori lipopolysaccharide due to changes in the lengths of poly(C) tracts in 3-fucosyltransferase genes.
Infect. Immun.
67:5361-5366[Abstract/Free Full Text].
|
| 6.
|
Appelmelk, B. J.,
H. P. Wirth,
R. Lansbergen,
I. Schilders,
S. L. Martin,
T. Verboom, and C. M. J. E. Vandenbroucke-Grauls.
1999.
H. pylori diversifies in the human host through lipopolysaccharide phase variation.
Gut
45(Suppl. 3):A23-A24.
|
| 7.
|
Appelmelk, B. J., and C. M. J. E. Vandenbroucke-Grauls.
2000.
H. pylori and Lewis antigens.
Gut
47:10-11[Free Full Text].
|
| 8.
|
Aspinall, G. O.,
M. A. Monteiro,
H. Pang,
E. J. Walsh, and A. P. Moran.
1996.
Lipopolysaccharide of the Helicobacter pylori type strain NCTC 11637 (ATCC 43504): structure of the O antigen and core oligosaccharide regions.
Biochemistry
35:2489-2497[CrossRef][Medline].
|
| 9.
|
Bijlsma, J. J.,
C. M. J. E. Vandenbroucke-Grauls,
S. H. Phadnis, and J. G. Kusters.
1999.
Identification of virulence genes of Helicobacter pylori by random insertion mutagenesis.
Infect. Immun.
67:2433-2440[Abstract/Free Full Text].
|
| 10.
|
Blanchard, D.,
D. Bernard,
M. J. Loirat,
Y. Frioux,
J. Guimbretiere, and L. Guimbretiere.
1992.
Characterization of murine monoclonal antibodies directed to fetal erythrocytes.
Rev. Fr. Transfus. Hemobiol.
35:239-254[CrossRef][Medline].
|
| 11.
|
Censini, S.,
C. Lange,
Z. Xiang,
J. E. Crabtree,
P. Ghiara,
M. Borodovsky,
R. Rappuoli, and A. Covacci.
1996.
Cag, a pathogenicity island of Helicobacter pylori, encodes type I-specific and disease-associated virulence factors.
Proc. Natl. Acad. Sci. USA
93:14648-14653[Abstract/Free Full Text].
|
| 12.
|
Edwards, N. J.,
M. A. Monteiro,
G. Faller,
E. J. Walsh,
A. P. Moran,
I. S. Roberts, and N. J. High.
2000.
Lewis X structures in the O antigen side-chain promote adhesion of Helicobacter pylori to the gastric epithelium.
Mol. Microbiol.
35:1530-1539[CrossRef][Medline].
|
| 13.
|
Ge, Z.,
N. W. Chan,
M. Palcic, and D. E. Taylor.
1997.
Cloning and heterologous expression of an 1,3-fucosyltransferase gene from the gastric pathogen Helicobacter pylori.
J. Biol. Chem.
272:21357-21363[Abstract/Free Full Text].
|
| 14.
|
Logan, S. M.,
J. W. Conlan,
M. A. Monteiro,
W. W. Wakarchuk, and E. Altman.
2000.
Functional genomics of Helicobacter pylori: identification of a beta-1,4 galactosyltransferase and generation of mutants with altered lipopolysaccharide.
Mol Microbiol.
35:1156-1167[CrossRef][Medline].
|
| 15.
|
Martin, S. L.,
M. R. Edbroke,
T. C. Hodgman,
D. H. van den Eijnden, and M. I. Bird.
1997.
Lewis X biosynthesis in Helicobacter pylori. Molecular cloning of an (1,3)-fucosyltransferase gene.
J. Biol. Chem.
272:21349-21356[Abstract/Free Full Text].
|
| 16.
|
Monteiro, M. A.,
K. H. Chan,
D. A. Rasko,
D. E. Taylor,
P. Y. Zheng,
B. J. Appelmelk,
H. P. Wirth,
M. Yang,
M. J. Blaser,
S. O. Hynes,
A. P. Moran, and M. B. Perry.
1998.
Simultaneous expression of type 1 and type 2 Lewis blood group antigens by Helicobacter pylori lipopolysaccharides. Molecular mimicry between H. pylori lipopolysaccharides and human gastric epithelial cell surface glycoforms.
J. Biol. Chem.
273:11533-11543[Abstract/Free Full Text].
|
| 17.
|
Monteiro, M. A.,
B. J. Appelmelk,
D. A. Rasko,
A. P. Moran,
S. O. Hynes,
L. L. MacLean,
K. H. Chan,
F. S. Michael,
S. M. Logan,
J. O'Rourke,
A. Lee,
D. E. Taylor, and M. B. Perry.
2000.
Lipopolysaccharide structures of Helicobacter pylori genomic strains 26695 and J99, mouse model H. pylori Sydney strain, H. pylori P466 carrying sialyl Lewis X, and H. pylori UA915 expressing Lewis B: classification of H. pylori lipopolysaccharides into glycotype families.
Eur. J. Biochem.
267:305-320[Medline].
|
| 18.
|
Rasko, D. A.,
G. Wang,
M. M. Palcic, and D. E. Taylor.
2000.
Cloning and characterization of the alpha(1,3/4) fucosyltransferase of Helicobacter pylori.
J. Biol. Chem.
275:4988-4994[Abstract/Free Full Text].
|
| 19.
|
Tomb, J. F.,
O. White,
A. R. Kerlavage,
R. A. Clayton,
G. G. Sutton,
R. D. Fleischman,
K. A. Ketchum,
H. P. Klenk,
S. Gill,
B. A. Dougherty,
K. Nelson,
J. Quackenbush,
L. Zhou,
E. F. Kirkness,
S. Peterson,
B. Loftus,
D. Richardson,
R. Dodson,
H. G. Khalak,
A. Glodek,
K. McKenney,
L. M. Fitzgerald,
N. Lee,
M. D. Adams,
E. K. Hickey,
D. E. Berg,
J. D. Gocayne,
T. R. Utterback,
J. D. Peterson,
J. M. Kelley,
M. D. Cotton,
J. M. Weidman,
C. Fujii,
C. Bowman,
L. Watthey,
E. Wallin,
W. S. Hayes,
M. Bordovsky,
P. D. Karp,
H. O. Smith,
C. M. Fraser, and C. J. Venter.
1997.
The complete genome sequence of the gastric pathogen Helicobacter pylori.
Nature
388:539-547[CrossRef][Medline].
|
| 20.
|
Van Dam, G. J.,
A. A. Bergwerff,
J. E. Thomas-Oates,
J. P. Rotmans,
J. P. Kamerling,
J. F. Vliegenthart, and A. M. Deelder.
1994.
The immunologically reactive O-linked polysaccharide chains derived from circulating cathodic antigen isolated from human blood fluke Schistosoma mansoni have Lewis x as repeating unit.
Eur. J. Biochem.
225:467-482[Medline].
|
| 21.
|
Wang, G.,
D. A. Rosko,
R. Sherburne, and D. E. Taylor.
1999.
Molecular genetic basis for the variable expression of Lewis y antigen in Helicobacter pylori: analysis of the (1,2)fucosyltransferase gene.
Mol. Microbiol.
31:1265-1274[CrossRef][Medline].
|
| 22.
|
Wang, G.,
P. G. Boulton,
N. W. Chan,
M. M. Palcic, and D. E. Taylor.
1999.
Novel Helicobacter pylori alpha1,2-fucosyltransferase, a key enzyme in the synthesis of Lewis antigens.
Microbiology
145:3245-3253[Abstract/Free Full Text].
|
| 23.
|
Weiser, J. N., and N. Pan.
1998.
Adaptation of Haemophilus influenzae to acquired and innate humoral immunity based on phase variation of lipopolysaccharide.
Mol. Microbiol.
30:767-775[CrossRef][Medline].
|
Infection and Immunity, October 2000, p. 5928-5932, Vol. 68, No. 10
0019-9567/00/$04.00+0
Copyright © 2000, American Society for Microbiology. All rights reserved.
This article has been cited by other articles:
-
Giannakis, M., Backhed, H. K., Chen, S. L., Faith, J. J., Wu, M., Guruge, J. L., Engstrand, L., Gordon, J. I.
(2009). Response of Gastric Epithelial Progenitors to Helicobacter pylori Isolates Obtained from Swedish Patients with Chronic Atrophic Gastritis. J. Biol. Chem.
284: 30383-30394
[Abstract]
[Full Text]
-
Ma, B., Simala-Grant, J. L., Taylor, D. E.
(2006). Fucosylation in prokaryotes and eukaryotes. Glycobiology
16: 158R-184R
[Abstract]
[Full Text]
-
Ma, B., Audette, G. F., Lin, S., Palcic, M. M., Hazes, B., Taylor, D. E.
(2006). Purification, Kinetic Characterization, and Mapping of the Minimal Catalytic Domain and the Key Polar Groups of Helicobacter pylori {alpha}-(1,3/1,4)-Fucosyltransferases. J. Biol. Chem.
281: 6385-6394
[Abstract]
[Full Text]
-
Ma, B., Lau, L. H., Palcic, M. M., Hazes, B., Taylor, D. E.
(2005). A Single Aromatic Amino Acid at the Carboxyl Terminus of Helicobacter pylori {alpha}1,3/4 Fucosyltransferase Determines Substrate Specificity. J. Biol. Chem.
280: 36848-36856
[Abstract]
[Full Text]
-
Khamri, W., Moran, A. P., Worku, M. L., Karim, Q. N., Walker, M. M., Annuk, H., Ferris, J. A., Appelmelk, B. J., Eggleton, P., Reid, K. B. M., Thursz, M. R.
(2005). Variations in Helicobacter pylori Lipopolysaccharide To Evade the Innate Immune Component Surfactant Protein D. Infect. Immun.
73: 7677-7686
[Abstract]
[Full Text]
-
Langdon, R., Craig, J. E, Goldrick, M., Houldsworth, R., High, N. J
(2005). Analysis of the role of HP0208, a phase-variable open reading frame, and its homologues HP1416 and HP0159 in the biosynthesis of Helicobacter pylori lipopolysaccharide. J Med Microbiol
54: 697-706
[Abstract]
[Full Text]
-
Salaun, L., Ayraud, S., Saunders, N. J.
(2005). Phase variation mediated niche adaptation during prolonged experimental murine infection with Helicobacter pylori. Microbiology
151: 917-923
[Abstract]
[Full Text]
-
Eaton, K. A., Logan, S. M., Baker, P. E., Peterson, R. A., Monteiro, M. A., Altman, E.
(2004). Helicobacter pylori with a Truncated Lipopolysaccharide O Chain Fails To Induce Gastritis in SCID Mice Injected with Splenocytes from Wild-Type C57BL/6J Mice. Infect. Immun.
72: 3925-3931
[Abstract]
[Full Text]
-
Salaun, L., Linz, B., Suerbaum, S., Saunders, N. J.
(2004). The diversity within an expanded and redefined repertoire of phase-variable genes in Helicobacter pylori. Microbiology
150: 817-830
[Abstract]
[Full Text]
-
Ma, B., Wang, G., Palcic, M. M., Hazes, B., Taylor, D. E.
(2003). C-terminal Amino Acids of Helicobacter pylori{alpha}1,3/4 Fucosyltransferases Determine Type I and Type II Transfer. J. Biol. Chem.
278: 21893-21900
[Abstract]
[Full Text]
-
Boneca, I. G., Reuse, H. d., Epinat, J.-C., Pupin, M., Labigne, A., Moszer, I.
(2003). A revised annotation and comparative analysis of Helicobacter pylori genomes. Nucleic Acids Res
31: 1704-1714
[Abstract]
[Full Text]
-
de Vries, N., Duinsbergen, D., Kuipers, E. J., Pot, R. G. J., Wiesenekker, P., Penn, C. W., van Vliet, A. H. M., Vandenbroucke-Grauls, C. M. J. E., Kusters, J. G.
(2002). Transcriptional Phase Variation of a Type III Restriction-Modification System in Helicobacter pylori. J. Bacteriol.
184: 6615-6623
[Abstract]
[Full Text]
-
Takata, T., El-Omar, E., Camorlinga, M., Thompson, S. A., Minohara, Y., Ernst, P. B., Blaser, M. J.
(2002). Helicobacter pylori Does Not Require Lewis X or Lewis Y Expression To Colonize C3H/HeJ mice. Infect. Immun.
70: 3073-3079
[Abstract]
[Full Text]
-
Snyder, L. A. S., Butcher, S. A., Saunders, N. J.
(2001). Comparative whole-genome analyses reveal over 100 putative phase-variable genes in the pathogenic Neisseria spp.. Microbiology
147: 2321-2332
[Abstract]
[Full Text]