Previous Article | Next Article 
Infection and Immunity, November 2000, p. 6133-6138, Vol. 68, No. 11
0019-9567/00/$04.00+0
Copyright © 2000, American Society for Microbiology. All rights reserved.
Antigenic Variation of Anaplasma
marginale by Expression of MSP2 Mosaics
Anthony F.
Barbet,1,*
Anna
Lundgren,1
Jooyoung
Yi,1
Fred R.
Rurangirwa,2 and
Guy
H.
Palmer2
Department of Pathobiology, College of
Veterinary Medicine, University of Florida, Gainesville, Florida
32611-0880,1 and Program in Vector-Borne
Diseases, Department of Veterinary Microbiology and Pathology,
Washington State University, Pullman, Washington
99164-70302
Received 25 May 2000/Returned for modification 28 June
2000/Accepted 9 August 2000
 |
ABSTRACT |
Anaplasma marginale is a tick-borne pathogen, one of
several closely related ehrlichial organisms that cause disease in
animals and humans. These Ehrlichia species have complex
life cycles that require, in addition to replication and development
within the tick vector, evasion of the immune system in order to
persist in the mammalian reservoir host. This complexity requires
efficient use of the small ehrlichial genome. A. marginale
and related ehrlichiae express immunoprotective, variable outer
membrane proteins that have similar structures and are encoded by
polymorphic multigene families. We show here that the major outer
membrane protein of A. marginale, MSP2, is encoded on a
polycistronic mRNA. The genomic expression site for this mRNA is
polymorphic and encodes numerous amino acid sequence variants in
bloodstream populations of A. marginale. A potential
mechanism for persistence is segmental gene conversion of the
expression site to link hypervariable msp2 sequences to the
promoter and polycistron.
 |
INTRODUCTION |
Ehrlichiae are major causes of
tick-borne diseases, including the recently emergent human monocytic
and two granulocytic ehrlichioses and the most prevalent tick-borne
infection in cattle worldwide, anaplasmosis (6). These
pathogens, classified in genogroups I and II of the tribe
Ehrlichieae, have a complex life cycle characterized by
acute and persistent infection in the mammalian host and several replicative and developmental stages within the tick vector (10, 17). Notably, this complexity is achieved using a small genome, only 0.8 to 1.5 Mb in a single chromosome (1, 25).
Persistence of Anaplasma marginale in cattle, which is
fundamental for continued transmission, reflects sequential expression
of antigenically variant outer membrane proteins that are encoded by
the msp2 multigene family (21). The outer
membrane proteins of different ehrlichial organisms are significantly
similar to one another in amino acid sequence, are all encoded by
multigene families, and possess one to four variable regions (8,
13, 18-20, 22, 26, 29, 32). In A. marginale-infected
cattle, three to six MSP2 variants are expressed in each sequential
rickettsemic cycle, which recur every 4 to 8 weeks during persistent
infection (8, 9, 15, 16). Thus, over the 7-year period in
which A. marginale has been shown to persist, over 500 variants may be expressed. Although the cyclic emergence and immune
control of A. marginale is similar to that occurring in
African trypanosomiasis, the mechanisms used by the organism to persist
in mammalian hosts are unknown. We show here that variation of
msp2 in erythrocyte stages of A. marginale proceeds through the formation of different sequence mosaics in a
polycistronic expression site.
 |
MATERIALS AND METHODS |
Isolation and sequencing of A. marginale genomic
DNA.
Florida and South Idaho strains of A. marginale
were maintained as liquid nitrogen-cryopreserved stabilates of infected
bovine erythrocytes in dimethyl sulfoxide-phosphate-buffered saline
that were then used to infect cattle (20). A. marginale genomic DNA was isolated from highly rickettsemic
(>50% rickettsemia) bovine blood by lysis with sodium dodecyl sulfate
and lysozyme, treatment with proteinase K and RNase, phenol-chloroform
extraction, and ethanol precipitation (5). In some cases,
for PCR amplification and analysis of low rickettsemias, genomic DNA
was isolated from 200 µl of infected blood by using a QIAamp DNA mini
kit (Qiagen, Valencia, Calif.). To obtain the sequence of the complete
msp2 coding region, the sequence flanking orf2
and msp2 was obtained in both 5' and 3' directions and then
confirmed on both strands following PCR amplification of the entire
locus (14, 28). Sequencing was performed at the University
of Florida DNA Sequencing Core Laboratory (Gainesville, Fla.) using ABI
Prism dye terminator cycle sequencing protocols developed by Applied
Biosystems (Perkin-Elmer Corp., Foster City, Calif.). The fluorescently
labeled extension products were analyzed on an Applied Biosystems model
373 Stretch DNA Sequencer (Perkin-Elmer Corp.). Oligonucleotide primers
were designed using OLIGO 5.0 (Molecular Biology Insights, Cascade, Colo.) software and synthesized by Genosys Biotechnologies (The Woodlands, Tex.). Nucleotide sequences were analyzed using the GCG
programs (Genetics Computer Group, University of Wisconsin) available
through the Biological Computing core facilities of the
Interdisciplinary Center for Biotechnology Research at the University
of Florida. Sequence alignments were made using PILEUP and GAP, and
similarities were displayed using PLOTSIMILARITY. Prokaryotic
factor-independent RNA polymerase terminator sequences were predicted
using TERMINATOR.
Analysis of msp2 mRNA.
Total RNA was isolated
from whole blood obtained during acute rickettsemia with the FL strain
of A. marginale by extraction with 6 M urea-3M LiCl
(27). For reverse transcription-PCR (RT-PCR) analysis, RNA
was digested with RQ1 DNase (Promega, Madison, Wis.) and the reactions
were conducted with or without reverse transcriptase (Retroscript kit;
Ambion, Austin, Tex.) in a total volume of 20 µl. Then 1.5 µl of
the RT reaction mixture was used in primary PCRs and 2.5 µl of the
primary PCR mixture was used in secondary or nested PCRs. For primer
extension analysis, the oligonucleotide primer was 5'-end labeled with
32P using T4 polynucleotide kinase and extended in
sequencing reactions with reverse transcriptase, using as template 50 µg of RNA isolated from A. marginale-infected blood or 0.5 µg of a 3.9-kb PCR product DNA containing msp2,
orf2 to orf4, and flanking regions
(12). RNase protection assays were conducted with an
antisense RNA probe prepared from msp2 cDNA clone AR11
(7), which contains coding sequence for both msp2
and orf2 (see below). AR11 plasmid DNA was linearized with
XhoI and labeled with [32P]UTP using the
Maxiscript kit (Ambion) and SP6 RNA polymerase, and the 722-nucleotide
probe was purified by gel isolation. The labeled probe was hybridized
with different amounts of A. marginale RNA or carrier yeast
RNA and then subjected to digestion with RNase A-RNase T1
as described by the manufacturer (RPAIII kit; Ambion). Protected probe
fragments were analyzed by electrophoresis in an 8 M urea-5%
acrylamide gel with 32P-labeled RNA Century Marker Plus
standards (Ambion).
Southern blotting of A. marginale genomic DNA.
Probes for Southern blots were derived as follows: msp2
probe, insert DNA from msp2 cDNA clone AR3 (7)
that includes nucleotides 18 to 555 of msp2; orf2
probe, PCR amplification product from msp2 cDNA clone AR9
(7) with oligonucleotide primers AB688 and AB689 that
contains nucleotides 28 to 275 of orf2; orf3
probe, PCR amplification product from msp2 cDNA clone AR9
with primers AB690 and AB691 and with nucleotides 618 to 877 of
orf3; orf4 probe, PCR amplification product from
Florida strain A. marginale genomic DNA with primers AB783
and AB747 that contains nucleotides 467 to 896 of orf4. DNA
probes were labeled with fluorescein-dUTP, hybridized, washed under
high-stringency conditions (0.1× SSC [1× SSC is 0.15 M NaCl plus
0.015 M sodium citrate] plus 0.1% sodium dodecyl sulfate at 60°C)
and detected by chemiluminescence (Illuminator chemiluminescent
detection system; Stratagene, La Jolla, Calif.). Oligonucleotide probes
were synthesized with a 5' fluorescein end label (Genosys
Biotechnologies), hybridized, washed, and detected similarly, using
final wash temperatures of 5°C below their respective
Tm values. Molecular size standards were
Illuminator nonradioactive markers (Stratagene).
Determination of msp2 expression site structure in
progenitor and progeny populations of A. marginale.
Bovine
no. 196 was infected with A. marginale (Florida strain). At
40 days after the initial infection, the animal experienced a peak of
acute rickettsemia of 6% (the percentage of erythrocytes containing
A. marginale), which subsequently resolved, and the animal
became an asymptomatic carrier of infection. At 107 days after initial
infection, the animal was splenectomized, which caused recrudescence of
a microscopically detectable rickettsemia. The animal was exsanguinated
19 days after splenectomy with a rickettsemia of 95% to obtain the
Florida-relapse strain.
Synthetic oligonucleotides.
The synthetic oligonucleotides
used in this study were (5'-3') AB192 (CTATCCTTGAAGCTAATCTTG),
AB198 (AAGGCAAACCTAACACCCAAC), AB688
(GGACTGCTTGCCTTCACGCTGTT), AB689
(TGAGCTGGGGAAAAGACGCTTGG), AB690
(CGGCGGCGTGGAGTTCCTTGA), AB691 (TGCCTGCTTCGACGCCAAGGT), AB747 (ATACAAACCCGACCACAAAATCC), AB750
(GGATTTTGTGGTCGGGTTTGTAT), AB752
(CACCGGTTGATGAAGTTTGC), AB764 (GCGTTCGGCAGGCATTTTGG),
AB765 (GGAACAACCCCAATACCATC), AB766
(GTATGTCGATTCGCGGAAGAGCCTGTTGT), AB767
(ACGCGCTTGAATAAATCGTT), AB783 (AGTATCACATTGGGGAGGTTT),
AB784 (GGAGGGAAAGCCGAAGTTG), AB847
(ACAGACACACTGCTTTCTGTTGAGGGGAACAAAGAC), AB871
(GTACCACTGGCAGTGGTGTCCATTGAT), and AB872 (ATTGTTGGTGCTGCCACTGGTGGCGTTAAC).
Nucleotide sequence accession numbers.
The sequences
reported have been assigned GenBank accession numbers AF200925 to
AF200927.
 |
RESULTS |
MSP2 is encoded on a polycistronic mRNA transcript.
Examination of over 250 msp2 transcripts expressed during
acute or persistent A. marginale rickettsemia revealed a
single, central hypervariable region that encodes the approximately
100-amino-acid antigenically variable domain (8, 9). The
hypervariable msp2 region, characterized by nucleotide
insertions, deletions, and substitutions, is flanked by highly
conserved 5' and 3' ends. This structure is shared by the MSP2 homolog
(Blastp E value of 10
102) in a causative agent of human
granulocytic ehrlichiosis (13, 18, 32). Using cDNA clones
derived from A. marginale during acute rickettsemia, we
identified transcripts that extended 5' to the ATG initiation codon for
MSP2 (7). In the longest cDNA clone, AR9, this 5' sequence
extended 726 bp beyond the msp2 ATG and contained two
additional open reading frames (ORFs). The immediately 5'-proximal ORF
(orf2) was separated from the msp2 ATG by only 12 bp and was separated from orf3 (Fig.
1) by 23 bp. This structure is typical of
prokaryotic polycistronic mRNAs, where the ORFs are generally separated
by <30 bp. To obtain the structure of a complete transcriptional unit,
we sequenced genomic DNA (14, 28) and identified a single
locus containing msp2 linked to orf2 and
orf3 and a fourth ORF (orf4) immediately 5' to
orf3 (Fig. 1). Numbering from msp2,
orf2 encodes a polypeptide with a molecular weight of 13,219 that is predicted by the PSORT (http://psort.nibb.ac.jp) algorithm to
be an outer membrane protein. orf2 did not resemble any
sequence in the databases. orf3 and orf4 also
encoded predicted outer membrane proteins with molecular weights of,
respectively, 31,118 and 29,061; both were significantly similar
(Blastp E values of 2 × 10
19 and 1 × 10
12, respectively) to the outer membrane protein OMP1b
of Ehrlichia chaffeensis, the causative agent of human
monocytic ehrlichiosis (19). There were no other significant
ORFs within 130 bp 5' or 240 bp 3' to these four ORFs in the genome.
Thus, the structure in Fig. 1 appeared to represent the entire coding
region for a polycistronic msp2 transcript.

View larger version (17K):
[in this window]
[in a new window]
|
FIG. 1.
Structure and variability of the msp2
polycistronic expression site. (A) Diagram of the four ORFs comprising
the polycistronic expression site for msp2, showing the
molecular weights (M.W.) of encoded proteins, primary (1°) and
secondary (2°) RT-PCR products generated from msp2 mRNA,
location of probe used in the RNase protection assay (RPA probe, see
Fig. 2), and FspI cleavage sites (see Fig. 4 and 5). P,
predicted promoter region, 72 to 108 bp 5' to orf4; T,
predicted prokaryotic terminator sequence,
GTAGACCAGC....TAGTCGTCAC, 149 to 200 bp 3' to
msp2. (B) PLOTSIMILARITY profile of nucleotide sequence
variability between msp2 expression sites of Florida (F) and
South Idaho (I-1) strains of A. marginale. A similarity
score of 1.0 indicates identical sequence in a sliding window of 10 nucleotides, and a decreasing score from 1.0 to 0.0 indicates
increasing variation. (C) PLOTSIMILARITY profile of expression site
variability in the South Idaho strain of A. marginale
examined at two time points 10 days apart in acute rickettsemia (I-1
and I-2).
|
|
To confirm that the genomic region shown in Fig.
1 encoded a
polycistronic transcript, RNA obtained from
A. marginale
during
acute rickettsemia was analyzed by RT-PCR, RNase protection, and
primer extension (Fig.
2). RNA encoding
MSP2 and also containing
orf2 to
orf4 was present
as a polycistronic transcript that could
be amplified by RT-PCR. No
amplified products were present in
control reactions without RT. The
sequenced RT-PCR product of
2 kbp (Fig.
2) contained the regions of
msp2 and
orf2 to
orf4 expected from
the genomic locus. An RNase protection assay was
performed to
investigate whether
msp2 was transcribed primarily
as a
polycistronic mRNA. An antisense RNA probe of 624 bases (317
bases at
the 5' end of
msp2 and 307 bases of the intercistronic
sequence and
orf2 [Fig.
1]) was protected from RNase
digestion
by hybridization with total
A. marginale RNA (Fig.
2), suggesting
that the majority of
msp2 transcripts were
polycistronic and linked
to
orf2 when expressed during acute
rickettsemia. The transcription
start site (+1) was identified by
primer extension analysis (Fig.
2) as 74bp 5' to the ATG initiation
codon of
orf4 within the
sequence:

35 ATTTAAATTGCAAAATATA

GCTCTC
TTGACT 
10+1 TAAT

TTAGTA
TACCTTATGGG
TGTGTGGG

View larger version (40K):
[in this window]
[in a new window]
|
FIG. 2.
Analysis of msp2 transcript structure by
RT-PCR, primer extension analysis, and RNase protection assay (RPA).
For RT-PCR, total DNase-treated RNA of Florida strain A. marginale was reverse transcribed into DNA using oligonucleotide
primer AB198, which anneals to the 3' end of msp2. The cDNA
was amplified in a primary PCR with primers AB765 and AB766, which
generated a product of 3.2 kbp. The primary PCR product was amplified
in a secondary or nested PCR with primer combinations AB192 and AB764,
AB689 and AB764, and AB192 and AB688 to generate products of 2.0, 1.5, and 0.7 kbp, respectively. See Fig. 1 for the locations of RT-PCR
products. S, molecular size standards; +, with reverse transcriptase;
, negative control reactions without reverse transcriptase. For
primer extension, oligonucleotide primer AB784, which anneals 153 nucleotides 3' to the ATG initiation codon of orf4, was
radiolabeled with 32P and extended in sequencing reactions
using reverse transcriptase and either total RNA of A. marginale or denatured, PCR-amplified genomic DNA containing
orf2 to orf4, msp2, and flanking
regions as templates. The order of sequencing reactions T, G, C, and A,
is shown above the DNA lanes and was the same in the RNA lanes. A
strong stop was detected in RNA at the A (underlined) in sequence
TGCAACCCACACACCCATAAGG, with evidence
also for a minority of transcripts continuing to the next base, C
(italic). This corresponds to the coding-strand sequence
CCTTATGGGTGTGTGGGTTGCA (see the
text). For the RNase protection assay, a 32P-labeled
antisense RNA probe of 722 nucleotides (317 nucleotides of the
msp2 gene, 307 nucleotides of orf2 and
intercistronic spacer, 98 nucleotides of plasmid vector) was allowed to
hybridize to various amounts (10, 3, and 0.1 µg) of total RNA of
A. marginale and carrier yeast RNA or to yeast RNA alone
(lane 0) and then unprotected single-stranded probe was digested with
RNase and analyzed by denaturing polyacrylamide gel electrophoresis. C,
probe plus yeast RNA, not digested with RNase. The positions of
molecular size standards are shown on the left. A band of 624 bp
containing the A. marginale sequences within the probe
(msp2 and orf2) was the predominant fragment
protected.
|
|
This sequence contained elements that may be

35 and

10
promoter regions (underlined). The consensus
Escherichia
coli 
35
region is TTGACA and

10 is TATAAT,
with an optimal spacing between
them of 17 ± 1 bp
(
11). The three of six identities at

10 were
the most
highly conserved first, second, and sixth positions of
the
E. coli consensus sequence. There was also an AT-rich region
upstream
of

35 in the
A. marginale sequence typical of prokaryotic
promoters (
11). Interestingly, a second region was found
(double
underline) with a similar level of sequence identity to the
consensus
E. coli 
35 and

10 sequences, separated from
the first by only
6 bp. The significance of this potential
dual-promoter structure
in transcriptional control is
unknown.
This msp2 expression site encodes hypervariable
sequences expressed in vivo.
To analyze the variability of MSP2
encoded by the polycistronic expression site, we sequenced the
expression site in two genetically and biologically distinct A. marginale strains obtained during acute rickettsemia (Fig. 1B) and
at two different time points in a single acute infection (Fig. 1C).
Alignment of complete expression site sequences revealed minor
substitutions in orf2 and orf3 and no changes in
the predicted promoter region (orf2 gene product, 98% amino
acid identity between the Florida [F] and South Idaho [I-1]
strains; orf3 gene product, 99% identity). There were more substitutions in orf4, and these were distributed throughout
the orf4 sequence (96% identity between the F and I-1
strains). The greatest differences were in msp2 and included
substitutions, insertions, and deletions (92% identity between F and
I-1). Essentially similar results were obtained comparing expression
site structure at two sequential time points in a single acute
infection (Fig. 1C). In msp2, most of the expression site
variability was localized to the region encoding the known MSP2
hypervariable region (8, 9) (Fig. 1B and C). We sequenced
this hypervariable region in multiple, independent DNA clones of the
genomic expression site and compared the encoded MSP2 peptide sequences
(Fig. 3). Each population of A. marginale, whether taken from animals with acute rickettsemia with
the Florida or South Idaho strains or from different time points in a
single infection, was extremely polymorphic in the part of the
expression site encoding the MSP2 hypervariable region.

View larger version (50K):
[in this window]
[in a new window]
|
FIG. 3.
Multiple different msp2 variants are present
in the polycistronic expression site in each population of A. marginale. The expression site was amplified by PCR using primers
which annealed 288 bp 3' to the termination codon of msp2
(AB752) and to the intercistronic sequence between orf3 and
orf4 (AB750) to generate a product of 2.9 kbp from A. marginale genomic DNA that contained msp2,
orf2, and orf3. The PCR product was cloned in
pCR-XL-TOPO vector (Invitrogen), and independent colonies containing a
2.9-kbp insert were selected for sequencing of cloned plasmid DNA. The
hypervariable region of the msp2 gene was sequenced on both
strands in 106 independent clones derived by PCR amplification from
genomic DNA of the F, I-1, and I-2 A. marginale populations.
DNA sequences were translated to amino acids, and the different variant
sequences were aligned with PILEUP. The predominant sequence variants
are shown. The percentage of each sequence variant in that population
is indicated in brackets, e.g., the major sequence variant detected in
the South Idaho A. marginale population I-1 was variant A,
which was found in 48% of the independent clones of the expression
site. Identical amino acids shared between all variants are indicated
by dashes and shown on the bottom row of the alignment.
|
|
Do the expressed
msp2 RNA transcripts reflect the sequence
of this genomic locus? The major variant type in
msp2 cDNA
clones
(
7) derived from animals with acute rickettsemia with
the Florida
strain of
A. marginale was identical to the
expression site variant,
F VarA (Fig.
3). The major
msp2
variants present in cDNA clones
from acute rickettsemia with the South
Idaho strain were SGV1
and SGV2 (
24). These transcribed
variants were identical to
I-1 VarA (SGV1) and I-1 VarB (SGV2), which
represent the predominant
genomic polycistronic expression site
sequences at this time point
(Fig.
3). We also identified less frequent
sequence variants,
including I-1 VarD and I-2 VarC, in mRNA by RT-PCR
with oligonucleotide
primers designed from the expression site DNA
sequence followed
by cloning and sequencing. Thus, both major and minor
variant
msp2 transcripts have corresponding genomic
expression sites.
Importantly, sequencing of cDNA clones derived from
RT-PCR confirmed
the linkage of the
msp2 variants to
orf2 to
orf4 on polycistronic
transcripts.
Genomic mechanism of msp2 variation.
How does this
extensive msp2 expression site polymorphism occur? There are
multiple genes containing msp2-related sequences in A. marginale (20). Restriction enzyme digests of A. marginale genomic DNA probed with msp2 identified these
multiple msp2 copies in both the Florida and South Idaho
strains but showed only a single band when probed with orf2,
orf3, or orf4 (Fig.
4). Therefore, while msp2 and
orf2 genes are contiguous in the expression site, multiple
msp2 sequences are dispersed throughout the chromosome and
are not contiguous with orf2. Both A. marginale
and the human granulocytic ehrlichiosis agent contain incomplete
msp2 genes that have the hypervariable and flanking
conserved sequences but lack 5' or 3' coding regions (2,
31). Hybridizing Southern blots of A. marginale
genomic DNA with different regions of msp2 (20)
shows that the majority of msp2-containing genomic sequences lack the conserved 5' end that is present in msp2 mRNA
(8). This is consistent with recombination into the
polycistronic expression site as a mechanism for activation of
msp2 genes, including incomplete genes. Further support for
this mechanism is provided by the presence of msp2 mosaic
sequences within the expression site. For example, F VarC is identical
to F VarA from amino acids 28 to 84 and to F VarB from amino acids 69 to 136 (Fig. 3). Specific MSP2 sequence motifs encoded in the
expression site, for example, NAI, KAV, or NAV (amino acids 34 to 36 [Fig. 3]) and TNGEKVSQ or TSGDELSK (amino acids 43 to 50), are
present outside the expression site in other msp2 copies
(2, 20, 31). Extensive intragenic recombination between the
expression site and other msp2 copies, employing flanking
conserved regions, would result in the formation of the different
sequence mosaics observed in the msp2 hypervariable region
and link variable msp2 sequences to orf2 to
orf4 and the promoter.

View larger version (109K):
[in this window]
[in a new window]
|
FIG. 4.
Structure of msp2 and orf2 to
orf4 in genomic DNA of Florida and South Idaho strains of
A. marginale. Southern blots of Florida (F) or South Idaho
(I) genomic DNA digested with the restriction enzyme FspI
and hybridized with probes specific for msp2,
orf2, orf3, or orf4 are shown.
FspI cleaves 41 nucleotides 5' to orf4 and 268 nucleotides 3' to msp2 to release a fragment of 3.76 kbp
containing the complete polycistronic msp2 expression site
sequence (see Fig. 1) from both Florida and South Idaho genomic DNAs.
Molecular size standards are shown in the left lane of each blot.
Multiple msp2-related sequences are detected in genomic DNA
of both strains; only msp2 sequences located in the
expression site are contiguous with orf2 to
orf4.
|
|
Data supporting this hypothesis are shown in Fig.
5, comparing the expression site
structure in Florida strain
A. marginale (progenitor) with
that in a Florida-relapse strain (progeny) derived
after >3 months of
persistent bovine infection. Oligonucleotide
probes to
msp2
hypervariable region sequences present only in
the expression site of
the progeny strain detect an extra band
in the progeny population.
Probes to the hypervariable region
sequence present in the expression
site in both the progenitor
and progeny strains detect an expression
site band in both populations,
as expected (Fig.
5).
Non-expression-site-associated bands remain
unchanged in both the
progenitor and progeny strains; these may
be templates for segmental
gene conversion of the expression site.

View larger version (122K):
[in this window]
[in a new window]
|
FIG. 5.
Comparison of genes encoding the msp2
hypervariable region in Florida (F) and Florida relapse (F-rel) strains
of A. marginale. Hypervariable-region sequences were
obtained from independent clones of the msp2 expression site
(ES) in F (10 clones) and F-rel (11 clones) genomic DNA. From this DNA
sequence information, different oligonucleotide probes to the
hypervariable region were synthesized to use in Southern blotting.
These probes contained sequence either unique to one set of expression
site clones (the AB871 and AB872 sequences were both observed in 2 of
11 clones of the F-rel expression site and 0 of 10 clones of the F
expression site) or were present in different proportions (the AB847
sequence was present in 5 of 10 expression site clones in the F strain
and 1 of 11 expression site clones in the F-rel strain). A. marginale genomic DNA of the F or F-rel strains was digested with
FspI to release the 3.76-kbp expression site (arrow),
separated by gel electrophoresis, and probed with the indicated
fluorescein-labeled synthetic oligonucleotides. With probe AB872, an
extra (expression site) band of 3.76 kbp is detected in F-rel compared
to F genomic DNA probed with the same sequence. A 4.4-kbp band is
detected in both F and F-rel DNA, which may contain a template copy for
conversion of the expression site. The expression site band is less
intense than the 4.4-kbp band because the AB872 sequence is present in
the expression site of only some organisms in the F-rel population of
A. marginale (approximately 18% [2 of 11] of the total
would be predicted from the fraction of F-rel expression site clones
containing the AB872 sequence). This figure is approximate because of
the small number of clones analyzed and the possibility of
representation bias following amplification and cloning of the
expression site. A similar result was obtained with a different
F-rel-specific probe, AB871, except that there are two potential
template copies of the AB871 sequence on 4.4- and 3.5-kbp fragments.
The AB847 blot is an example of the converse situation: the AB847
sequence is well represented in the expression site of the F population
of A. marginale but has nearly disappeared from the
expression site in F-rel A. marginale. Potential template
copies for the AB847 expression site sequence are on 11- and 7.2-kbp
fragments.
|
|
 |
DISCUSSION |
A mechanism involving recombination into a polycistronic
expression site, especially one containing other outer membrane protein genes, is unusual and represents efficient use of a small genome to
generate diversity. Since orf3 and orf4 are
distantly related members of the msp2 gene family, they,
too, could vary by recombination with partially homologous sequences
elsewhere in the genome. Comparison of orf3 and
orf4 in different A. marginale populations shows
that variation in these genes occurs at a lower rate than in
msp2. The large number of diverse sequences found in the
expression site of a single A. marginale population at a
single time is consistent with the extensive variation of
msp2 during the multiple rickettsemia cycles that comprise a
single infection.
Recombination of portions of silent genes into a monocistronic
expression site has been described for other prokaryotes, including the
tick-borne Borrelia burgdorferi (30). However,
B. burgdorferi uses plasmid-encoded genes to generate this
diversity, an option unavailable to A. marginale
(1). In some respects, A. marginale msp2
variation resembles the formation of mosaic genes in the polycistronic
expression sites encoding the variable surface glycoprotein (VSG) of
African trypanosomes. Complete genes and otherwise inactive pseudogenes
are used to generate these mosaics in chronic trypanosomiasis (4,
23). The sequence mosaics encompass most regions of the VSG and
are not targeted to a single hypervariable region as in A. marginale msp2. The trypanosome, because of its larger genome size, also has sufficient VSG-encoding genes to produce considerable variation without needing combinatorial mechanisms.
Rickettsiae, including the ehrlichial pathogens, are thought to be
closely related to the original bacterial endosymbionts of eukaryotic
cells that evolved into mitochondria by loss of genes whose function
has been replaced by the host genome (3). Rickettsia
prowazekii contains a high proportion of noncoding DNA (24%),
despite a size of only 1.1 Mb. Rickettsial genes are postulated to be
in the process of elimination from the genome by a series of steps
comprising mutation to pseudogene, to unrecognizable sequence, to small
fragments, to extinction (3). The data reported herein
suggest that some pseudogene sequences may not be on their way to
extinction but play a critical role in adaptive mechanisms of
small-genome pathogens.
In conclusion, the MSP2 outer membrane protein is encoded on a
polycistronic RNA transcript in erythrocyte stages of A. marginale. In addition to msp2, three other genes are
present on this transcript that also are predicted to encode outer
membrane proteins. All but one of these genes are significantly similar
to outer membrane protein genes present in other ehrlichial pathogens,
including those that infect humans. There is extensive polymorphism in
the genomic expression site for this msp2 polycistronic
transcript and evidence for gene rearrangement during persistent
infection. Availability of the expression site sequence should allow
the determination of the MSP2 variants expressed from this site during cyclical transmission of A. marginale between ticks and
cattle. These data provide a possible molecular basis for persistence of A. marginale and may permit identification of similar
mechanisms of variation in other ehrlichial pathogens. Common
mechanisms of variable surface protein expression may be used by
diverse pathogens to evade the host immune response and cause
persistent infections.
 |
ACKNOWLEDGMENTS |
We thank Carlos R. Sulsona and Carla Robertson for excellent
technical assistance.
This investigation was supported by USDA grant 95-372204-2348 and NIH
grants AI45580 and AI44005.
 |
FOOTNOTES |
*
Corresponding author. Mailing address: Department of
Pathobiology, College of Veterinary Medicine, University of Florida, P. O. Box 110880, Gainesville, FL 32611-0880. Phone: (352)
392-4700, ext. 5819. Fax: (352) 392-9704. E-mail:
barbeta{at}mail.vetmed.ufl.edu.
Editor:
J. M. Mansfield
 |
REFERENCES |
| 1.
|
Alleman, A. R.,
S. M. Kamper,
N. Viseshakul, and A. F. Barbet.
1993.
Analysis of the Anaplasma marginale genome by pulsed-field electrophoresis.
J. Gen. Microbiol.
139:2439-2444[Abstract/Free Full Text].
|
| 2.
|
Alleman, A. R.,
G. H. Palmer,
T. C. McGuire,
T. F. McElwain,
L. E. Perryman, and A. F. Barbet.
1997.
Anaplasma marginale major surface protein 3 is encoded by a polymorphic, multigene family.
Infect. Immun.
65:156-163[Abstract].
|
| 3.
|
Andersson, S. G.,
A. Zomorodipour,
J. O. Andersson,
T. Sicheritz-Ponten,
U. C. Alsmark,
R. M. Podowski,
A. K. Naslund,
A. S. Eriksson,
H. H. Winkler, and C. G. Kurland.
1998.
The genome sequence of Rickettsia prowazekii and the origin of mitochondria.
Nature
396:133-140[CrossRef][Medline].
|
| 4.
|
Barbet, A. F., and S. M. Kamper.
1993.
The importance of mosaic genes to trypanosome survival.
Parasitol. Today
9:63-66[CrossRef][Medline].
|
| 5.
|
Barbet, A. F.,
G. H. Palmer,
P. J. Myler, and T. C. McGuire.
1987.
Characterization of an immunoprotective protein complex of Anaplasma marginale by cloning and expression of the gene coding for polypeptide Am105L.
Infect. Immun.
55:2428-2435[Abstract/Free Full Text].
|
| 6.
|
Dumler, J. S., and J. S. Bakken.
1998.
Human ehrlichioses: newly recognized infections transmitted by ticks.
Annu. Rev. Med.
49:201-213[CrossRef][Medline].
|
| 7.
|
Eid, G.,
D. M. French,
A. M. Lundgren,
A. F. Barbet,
T. F. McElwain, and G. H. Palmer.
1996.
Expression of major surface protein 2 antigenic variants during acute Anaplasma marginale rickettsemia.
Infect. Immun.
64:836-841[Abstract].
|
| 8.
|
French, D. M.,
W. C. Brown, and G. H. Palmer.
1999.
Emergence of Anaplasma marginale antigenic variants during persistent rickettsemia.
Infect. Immun.
67:5834-5840[Abstract/Free Full Text].
|
| 9.
|
French, D. M.,
T. F. McElwain,
T. C. McGuire, and G. H. Palmer.
1998.
Expression of Anaplasma marginale major surface protein 2 variants during persistent cyclic rickettsemia.
Infect. Immun.
66:1200-1207[Abstract/Free Full Text]. (Erratum, 66:2400.)
|
| 10.
|
Ge, N. L.,
K. M. Kocan,
E. F. Blouin, and G. L. Murphy.
1996.
Developmental studies of Anaplasma marginale (Rickettsiales: Anaplasmataceae) in male Dermacentor andersoni (Acari: Ixodidae) infected as adults by using nonradioactive in situ hybridization and microscopy.
J. Med. Entomol.
33:911-920[Medline].
|
| 11.
|
Hawley, D. K., and W. R. McClure.
1983.
Compilation and analysis of Escherichia coli promoter DNA sequences.
Nucleic Acids Res.
11:2237-2255[Abstract/Free Full Text].
|
| 12.
|
Hollingshead, S. K.,
V. A. Fischetti, and J. R. Scott.
1987.
Size variation in group A streptococcal M protein is generated by homologous recombination between intragenic repeats.
Mol. Gen. Genet.
207:196-203[CrossRef][Medline].
|
| 13.
|
Ijdo, J. W.,
W. Sun,
Y. Zhang,
L. A. Magnarelli, and E. Fikrig.
1998.
Cloning of the gene encoding the 44-kilodalton antigen of the agent of human granulocytic ehrlichiosis and characterization of the humoral response.
Infect. Immun.
66:3264-3269[Abstract/Free Full Text].
|
| 14.
|
Johnston, S. L.,
M. Strausbauch,
G. Sarkar, and P. J. Wettstein.
1995.
A novel method for sequencing members of multi-gene families.
Nucleic Acids Res.
23:3074-3075[Free Full Text].
|
| 15.
|
Kieser, S. T.,
I. S. Eriks, and G. H. Palmer.
1990.
Cyclic rickettsemia during persistent Anaplasma marginale infection of cattle.
Infect. Immun.
58:1117-1119[Abstract/Free Full Text].
|
| 16.
|
Knowles, D.,
D. E. Torioni,
G. Palmer,
T. McGuire,
D. Stiller, and T. McElwain.
1996.
Antibody against an Anaplasma marginale MSP5 epitope common to tick and erythrocyte stages identifies persistently infected cattle.
J. Clin. Microbiol.
34:2225-2230[Abstract].
|
| 17.
|
Kocan, K. M.,
D. Stiller,
W. L. Goff,
P. L. Claypool,
W. Edwards,
S. A. Ewing,
T. C. McGuire,
J. A. Hair, and S. J. Barron.
1992.
Development of Anaplasma marginale in male Dermacentor andersoni transferred from parasitemic to susceptible cattle.
Am. J. Vet. Res.
53:499-507[Medline].
|
| 18.
|
Murphy, C. I.,
J. R. Storey,
J. Recchia,
L. A. Doros-Richert,
C. Gingrich-Baker,
K. Munroe,
J. S. Bakken,
R. T. Coughlin, and G. A. Beltz.
1998.
Major antigenic proteins of the agent of human granulocytic ehrlichiosis are encoded by members of a multigene family.
Infect. Immun.
66:3711-3718[Abstract/Free Full Text].
|
| 19.
|
Ohashi, N.,
N. Zhi,
Y. Zhang, and Y. Rikihisa.
1998.
Immunodominant major outer membrane proteins of Ehrlichia chaffeensis are encoded by a polymorphic multigene family.
Infect. Immun.
66:132-139[Abstract/Free Full Text].
|
| 20.
|
Palmer, G. H.,
G. Eid,
A. F. Barbet,
T. C. McGuire, and T. F. McElwain.
1994.
The immunoprotective Anaplasma marginale major surface protein 2 is encoded by a polymorphic multigene family.
Infect. Immun.
62:3808-3816[Abstract/Free Full Text].
|
| 21.
|
Palmer, G. H.,
F. R. Rurangirwa,
K. M. Kocan, and W. C. Brown.
1999.
Molecular basis for vaccine development against the ehrlichial pathogen Anaplasma marginale.
Parasitol. Today
15:281-286[CrossRef][Medline].
|
| 22.
|
Reddy, G. R.,
C. R. Sulsona,
A. F. Barbet,
S. M. Mahan,
M. J. Burridge, and A. R. Alleman.
1998.
Molecular characterization of a 28 kDa surface antigen gene family of the tribe Ehrlichiae.
Biochem. Biophys. Res. Commun.
247:636-643[CrossRef][Medline].
|
| 23.
|
Roth, C.,
F. Bringaud,
R. Layden,
T. Baltz, and H. Eisen.
1989.
Active late-appearing variable surface antigen genes in Trypanosoma equiperdum are constructed entirely from pseudogenes.
Proc. Natl. Acad. Sci. USA
86:9375-9379[Abstract/Free Full Text].
|
| 24.
|
Rurangirwa, F. R.,
D. Stiller,
D. M. French, and G. H. Palmer.
1999.
Restriction of major surface protein 2 (MSP2) variants during tick transmission of the ehrlichia Anaplasma marginale.
Proc. Natl. Acad. Sci. USA
96:3171-3176[Abstract/Free Full Text].
|
| 25.
|
Rydkina, E.,
V. Roux, and D. Raoult.
1999.
Determination of the genome size of Ehrlichia spp., using pulsed field gel electrophoresis.
FEMS Microbiol. Lett.
176:73-78[CrossRef][Medline].
|
| 26.
|
Sulsona, C. R.,
S. M. Mahan, and A. F. Barbet.
1999.
The map1 gene of Cowdria ruminantium is a member of a multigene family containing both conserved and variable genes.
Biochem. Biophys. Res. Commun.
257:300-305[CrossRef][Medline].
|
| 27.
|
Van Der Ploeg, L. H. T.,
A. Y. C. Liu,
P. A. M. Michels,
T. De Lange,
P. Borst,
H. K. Majumder,
H. Weber,
H. G. Veeneman, and J. H. Van Boom.
1982.
RNA splicing is required to make the messenger RNA for a variant surface antigen in trypanosomes.
Nucleic Acids Res.
10:3591-3604[Abstract/Free Full Text].
|
| 28.
|
Weber, K. L.,
M. E. Bolander, and G. Sarkar.
1998.
Rapid acquisition of unknown DNA sequence adjacent to a known segment by multiplex restriction site PCR.
BioTechniques
25:415-419[Medline].
|
| 29.
|
Yu, X.,
J. W. McBride,
X. Zhang, and D. H. Walker.
2000.
Characterization of the complete transcriptionally active Ehrlichia chaffeensis 28 kDa outer membrane protein multigene family.
Gene
248:59-68[CrossRef][Medline].
|
| 30.
|
Zhang, J.,
J. M. Hardham,
A. G. Barbour, and S. J. Norris.
1997.
Antigenic variation in Lyme disease Borreliae by promiscuous recombination of VMP-like sequence cassettes.
Cell
89:275-285[CrossRef][Medline].
|
| 31.
|
Zhi, N.,
N. Ohashi, and Y. Rikihisa.
1999.
Multiple p44 genes encoding major outer membrane proteins are expressed in the human granulocytic ehrlichiosis agent.
J. Biol. Chem.
274:17828-17836[Abstract/Free Full Text].
|
| 32.
|
Zhi, N.,
N. Ohashi,
Y. Rikihisa,
H. W. Horowitz,
G. P. Wormser, and K. Hechemy.
1998.
Cloning and expression of the 44-kilodalton major outer membrane protein gene of the human granulocytic ehrlichiosis agent and application of the recombinant protein to serodiagnosis.
J. Clin. Microbiol.
36:1666-1673[Abstract/Free Full Text].
|
Infection and Immunity, November 2000, p. 6133-6138, Vol. 68, No. 11
0019-9567/00/$04.00+0
Copyright © 2000, American Society for Microbiology. All rights reserved.
This article has been cited by other articles:
-
Futse, J. E., Brayton, K. A., Nydam, S. D., Palmer, G. H.
(2009). Generation of Antigenic Variants via Gene Conversion: Evidence for Recombination Fitness Selection at the Locus Level in Anaplasma marginale. Infect. Immun.
77: 3181-3187
[Abstract]
[Full Text]
-
Barbet, A. F., Byrom, B., Mahan, S. M.
(2009). Diversity of Ehrlichia ruminantium Major Antigenic Protein 1-2 in Field Isolates and Infected Sheep. Infect. Immun.
77: 2304-2310
[Abstract]
[Full Text]
-
Granquist, E. G., Stuen, S., Lundgren, A. M., Braten, M., Barbet, A. F.
(2008). Outer Membrane Protein Sequence Variation in Lambs Experimentally Infected with Anaplasma phagocytophilum. Infect. Immun.
76: 120-126
[Abstract]
[Full Text]
-
Palmer, G. H., Futse, J. E., Leverich, C. K., Knowles, D. P. Jr., Rurangirwa, F. R., Brayton, K. A.
(2007). Selection for Simple Major Surface Protein 2 Variants during Anaplasma marginale Transmission to Immunologically Naive Animals. Infect. Immun.
75: 1502-1506
[Abstract]
[Full Text]
-
Ganta, R. R., Cheng, C., Miller, E. C., McGuire, B. L., Peddireddi, L., Sirigireddy, K. R., Chapes, S. K.
(2007). Differential Clearance and Immune Responses to Tick Cell-Derived versus Macrophage Culture-Derived Ehrlichia chaffeensis in Mice. Infect. Immun.
75: 135-145
[Abstract]
[Full Text]
-
Barbet, A. F., Lundgren, A. M., Alleman, A. R., Stuen, S., Bjoersdorff, A., Brown, R. N., Drazenovich, N. L., Foley, J. E.
(2006). Structure of the Expression Site Reveals Global Diversity in MSP2 (P44) Variants in Anaplasma phagocytophilum. Infect. Immun.
74: 6429-6437
[Abstract]
[Full Text]
-
Lin, Q., Zhang, C., Rikihisa, Y.
(2006). Analysis of Involvement of the RecF Pathway in p44 Recombination in Anaplasma phagocytophilum and in Escherichia coli by Using a Plasmid Carrying the p44 Expression and p44 Donor Loci. Infect. Immun.
74: 2052-2062
[Abstract]
[Full Text]
-
Lopez, J. E., Siems, W. F., Palmer, G. H., Brayton, K. A., McGuire, T. C., Norimine, J., Brown, W. C.
(2005). Identification of Novel Antigenic Proteins in a Complex Anaplasma marginale Outer Membrane Immunogen by Mass Spectrometry and Genomic Mapping. Infect. Immun.
73: 8109-8118
[Abstract]
[Full Text]
-
Lin, Q., Rikihisa, Y.
(2005). Establishment of Cloned Anaplasma phagocytophilum and Analysis of p44 Gene Conversion within an Infected Horse and Infected SCID Mice. Infect. Immun.
73: 5106-5114
[Abstract]
[Full Text]
-
Abbott, J. R., Palmer, G. H., Kegerreis, K. A., Hetrick, P. F., Howard, C. J., Hope, J. C., Brown, W. C.
(2005). Rapid and Long-Term Disappearance of CD4+ T Lymphocyte Responses Specific for Anaplasma Marginale Major Surface Protein-2 (MSP2) in MSP2 Vaccinates following Challenge with Live A. marginale. J. Immunol.
174: 6702-6715
[Abstract]
[Full Text]
-
Brayton, K. A., Kappmeyer, L. S., Herndon, D. R., Dark, M. J., Tibbals, D. L., Palmer, G. H., McGuire, T. C., Knowles, D. P. Jr.
(2005). Complete genome sequencing of Anaplasma marginale reveals that the surface is skewed to two superfamilies of outer membrane proteins. Proc. Natl. Acad. Sci. USA
102: 844-849
[Abstract]
[Full Text]
-
Singu, V., Liu, H., Cheng, C., Ganta, R. R.
(2005). Ehrlichia chaffeensis Expresses Macrophage- and Tick Cell-Specific 28-Kilodalton Outer Membrane Proteins. Infect. Immun.
73: 79-87
[Abstract]
[Full Text]
-
Stich, R. W., Olah, G. A., Brayton, K. A., Brown, W. C., Fechheimer, M., Green-Church, K., Jittapalapong, S., Kocan, K. M., McGuire, T. C., Rurangirwa, F. R., Palmer, G. H.
(2004). Identification of a Novel Anaplasma marginale Appendage-Associated Protein That Localizes with Actin Filaments during Intraerythrocytic Infection. Infect. Immun.
72: 7257-7264
[Abstract]
[Full Text]
-
Abbott, J. R., Palmer, G. H., Howard, C. J., Hope, J. C., Brown, W. C.
(2004). Anaplasma marginale Major Surface Protein 2 CD4+-T-Cell Epitopes Are Evenly Distributed in Conserved and Hypervariable Regions (HVR), Whereas Linear B-Cell Epitopes Are Predominantly Located in the HVR. Infect. Immun.
72: 7360-7366
[Abstract]
[Full Text]
-
Zhang, J.-z., Guo, H., Winslow, G. M., Yu, X.-j.
(2004). Expression of Members of the 28-Kilodalton Major Outer Membrane Protein Family of Ehrlichia chaffeensis during Persistent Infection. Infect. Immun.
72: 4336-4343
[Abstract]
[Full Text]
-
Lin, Q., Rikihisa, Y., Felek, S., Wang, X., Massung, R. F., Woldehiwet, Z.
(2004). Anaplasma phagocytophilum Has a Functional msp2 Gene That Is Distinct from p44. Infect. Immun.
72: 3883-3889
[Abstract]
[Full Text]
-
Brown, W. C., Palmer, G. H., Brayton, K. A., Meeus, P. F. M., Barbet, A. F., Kegerreis, K. A., McGuire, T. C.
(2004). CD4+ T Lymphocytes from Anaplasma marginale Major Surface Protein 2 (MSP2) Vaccinees Recognize Naturally Processed Epitopes Conserved in MSP3. Infect. Immun.
72: 3688-3692
[Abstract]
[Full Text]
-
Felek, S., Telford, S. III, Falco, R. C., Rikihisa, Y.
(2004). Sequence Analysis of p44 Homologs Expressed by Anaplasma phagocytophilum in Infected Ticks Feeding on Naive Hosts and in Mice Infected by Tick Attachment. Infect. Immun.
72: 659-666
[Abstract]
[Full Text]
-
Brayton, K. A., Meeus, P. F. M., Barbet, A. F., Palmer, G. H.
(2003). Simultaneous Variation of the Immunodominant Outer Membrane Proteins, MSP2 and MSP3, during Anaplasma marginale Persistence In Vivo. Infect. Immun.
71: 6627-6632
[Abstract]
[Full Text]
-
Kocan, K. M., de la Fuente, J., Guglielmone, A. A., Melendez, R. D.
(2003). Antigens and Alternatives for Control of Anaplasma marginale Infection in Cattle. Clin. Microbiol. Rev.
16: 698-712
[Abstract]
[Full Text]
-
Lin, Q., Rikihisa, Y., Ohashi, N., Zhi, N.
(2003). Mechanisms of Variable p44 Expression by Anaplasma phagocytophilum. Infect. Immun.
71: 5650-5661
[Abstract]
[Full Text]
-
Barbet, A. F., Meeus, P. F. M., Belanger, M., Bowie, M. V., Yi, J., Lundgren, A. M., Alleman, A. R., Wong, S. J., Chu, F. K., Munderloh, U. G., Jauron, S. D.
(2003). Expression of Multiple Outer Membrane Protein Sequence Variants from a Single Genomic Locus of Anaplasma phagocytophilum. Infect. Immun.
71: 1706-1718
[Abstract]
[Full Text]
-
Brown, W. C., Brayton, K. A., Styer, C. M., Palmer, G. H.
(2003). The Hypervariable Region of Anaplasma marginale Major Surface Protein 2 (MSP2) Contains Multiple Immunodominant CD4+ T Lymphocyte Epitopes That Elicit Variant-Specific Proliferative and IFN-{gamma} Responses in MSP2 Vaccinates. J. Immunol.
170: 3790-3798
[Abstract]
[Full Text]
-
Lohr, C. V., Brayton, K. A., Shkap, V., Molad, T., Barbet, A. F., Brown, W. C., Palmer, G. H.
(2002). Expression of Anaplasma marginale Major Surface Protein 2 Operon-Associated Proteins during Mammalian and Arthropod Infection. Infect. Immun.
70: 6005-6012
[Abstract]
[Full Text]
-
Brown, W. C., McGuire, T. C., Mwangi, W., Kegerreis, K. A., Macmillan, H., Lewin, H. A., Palmer, G. H.
(2002). Major Histocompatibility Complex Class II DR-Restricted Memory CD4+ T Lymphocytes Recognize Conserved Immunodominant Epitopes of Anaplasma marginale Major Surface Protein 1a. Infect. Immun.
70: 5521-5532
[Abstract]
[Full Text]
-
Lin, Q., Zhi, N., Ohashi, N., Horowitz, H. W., Aguero-Rosenfeld, M. E., Raffalli, J., Wormser, G. P., Rikihisa, Y.
(2002). Analysis of Sequences and Loci of p44 Homologs Expressed by Anaplasma phagocytophila in Acutely Infected Patients. J. Clin. Microbiol.
40: 2981-2988
[Abstract]
[Full Text]
-
Ohashi, N., Zhi, N., Lin, Q., Rikihisa, Y.
(2002). Characterization and Transcriptional Analysis of Gene Clusters for a Type IV Secretion Machinery in Human Granulocytic and Monocytic Ehrlichiosis Agents. Infect. Immun.
70: 2128-2138
[Abstract]
[Full Text]
-
Zhi, N., Ohashi, N., Tajima, T., Mott, J., Stich, R. W., Grover, D., Telford III, S. R., Lin, Q., Rikihisa, Y.
(2002). Transcript Heterogeneity of the p44 Multigene Family in a Human Granulocytic Ehrlichiosis Agent Transmitted by Ticks. Infect. Immun.
70: 1175-1184
[Abstract]
[Full Text]
-
Shkap, V., Molad, T., Brayton, K. A., Brown, W. C., Palmer, G. H.
(2002). Expression of Major Surface Protein 2 Variants with Conserved T-Cell Epitopes in Anaplasma centrale Vaccinates. Infect. Immun.
70: 642-648
[Abstract]
[Full Text]
-
Lohr, C. V., Rurangirwa, F. R., McElwain, T. F., Stiller, D., Palmer, G. H.
(2002). Specific Expression of Anaplasma marginale Major Surface Protein 2 Salivary Gland Variants Occurs in the Midgut and Is an Early Event during Tick Transmission. Infect. Immun.
70: 114-120
[Abstract]
[Full Text]
-
de la Fuente, J., Kocan, K. M.
(2001). Expression of Anaplasma marginale Major Surface Protein 2 Variants in Persistently Infected Ticks. Infect. Immun.
69: 5151-5156
[Abstract]
[Full Text]
-
Barbet, A. F., Yi, J., Lundgren, A., McEwen, B. R., Blouin, E. F., Kocan, K. M.
(2001). Antigenic Variation of Anaplasma Marginale: Major Surface Protein 2 Diversity during Cyclic Transmission between Ticks and Cattle. Infect. Immun.
69: 3057-3066
[Abstract]
[Full Text]
-
Brayton, K. A., Knowles, D. P., McGuire, T. C., Palmer, G. H.
(2001). Efficient use of a small genome to generate antigenic diversity in tick-borne ehrlichial pathogens. Proc. Natl. Acad. Sci. USA
98: 4130-4135
[Abstract]
[Full Text]