Previous Article | Next Article 
Infection and Immunity, November 2000, p. 6139-6146, Vol. 68, No. 11
0019-9567/00/$04.00+0
Copyright © 2000, American Society for Microbiology. All rights reserved.
Genetic and Functional Analysis of a PmrA-PmrB-Regulated Locus
Necessary for Lipopolysaccharide Modification, Antimicrobial Peptide
Resistance, and Oral Virulence of Salmonella enterica
Serovar Typhimurium
John S.
Gunn,1,*
Sara S.
Ryan,1
Jennifer C.
Van
Velkinburgh,1
Robert K.
Ernst,2 and
Samuel I.
Miller2
Department of Microbiology, University of
Texas Health Science Center at San Antonio, San Antonio, Texas
78229,1 and Departments of Medicine and
Microbiology, University of Washington, Seattle, Washington
981952
Received 8 June 2000/Returned for modification 28 July
2000/Accepted 4 August 2000
 |
ABSTRACT |
The two-component regulatory system PmrA-PmrB confers resistance of
Salmonella spp. to cationic antimicrobial peptides (AP) such as polymyxin (PM), bactericidal/permeability-increasing protein, and azurocidin. This resistance occurs by transcriptional activation of
two loci termed pmrE and pmrHFIJKLM. Both
pmrE and pmrHFIJKLM produce products required
for the biosynthesis of lipid A with 4-aminoarabinose (Ara4N). Ara4N
addition creates a more positively charged lipopolysaccharide (LPS) and
thus reduces cationic AP binding. Experiments were conducted to further
analyze the regulation of the pmrHFIJKLM operon and
the role of this operon and the surrounding genomic region in
LPS modification and antimicrobial peptide resistance. The
pmrHFIJKLM genes are cotranscribed and over 3,000-fold
regulated by PmrA-PmrB. The pmrHFIJKLM promoter bound PmrA,
as determined by gel shift analysis, as did a 40-bp region of the
PmrA-PmrB-regulated pmrCAB promoter. Construction of
nonpolar mutations in the pmrHFIJKLM genes showed that all
except pmrM were necessary for the Ara4N addition to lipid
A and PM resistance. The flanking genes of the operon
(pmrG and pmrD) were not necessary for PM
resistance, but pmrD was shown to be regulated by the
PhoP-PhoQ regulatory system. BALB/c mice inoculated with
pmrA and pmrHFIJKLM mutant strains demonstrated
virulence attenuation when the strains were administered orally but not
when they were administered intraperitoneally, indicating that Ara4N
addition may be important for resistance to host innate defenses within
intestinal tissues.
 |
INTRODUCTION |
The key to success for many bacteria
in causing infection is colonization of host tissues. Enteric bacteria,
such as Salmonella spp., have to survive in harsh host
microenvironments including the intestinal mucosa. At the
intestinal mucosa, these bacteria encounter host defense mechanisms
including antimicrobial peptides (AP), which are cationic, amphipathic
molecules that kill bacteria by membrane permeabilization. Within the
intestine, AP are secreted into the lumen by Paneth cells located
in the base of intestinal crypts. AP are also found within
phagocytic cells located in the intestinal submucosa. Following oral
ingestion, typhoid fever-causing strains of Salmonella can
transcytose through M cells and intestinal epithelial cells and are
then taken up by and survive within resident phagocytes. The ability of
salmonellae to survive within the host intestine and within
professional phagocytes is likely to depend, at least in part, on
mechanisms of resistance to AP.
Lipopolysaccharade (LPS) is the major surface component of
gram-negative bacteria. Lipid A is the bioactive component of LPS that
comprises the outer leaflet of the gram-negative bacterial outer
membrane. Phosphate groups on lipid A and LPS core components result in
the bacterial surface having a net negative charge. This charge plays a
significant role in the electrostatic interaction of cationic AP with
the bacterial surface. Gram-negative organisms can synthesize LPS with
specific lipid A and core modifications in response to environmental
conditions that include those found in host tissues. Lipid A
modifications are best characterized for Salmonella spp. in
which the addition of palmitate or 4-aminoarabinose (Ara4N) to lipid A
is coordinately regulated by the two-component system PhoP-PhoQ
(9-11), which is necessary for bacterial survival within
macrophages and within the host (6, 12, 15).
Ara4N-containing lipid A results in a less negatively charged bacterial
surface, which reduces AP binding and promotes resistance to the
cationic AP polymyxin B (PM), bactericidal/permeability-increasing
protein, and azurocidin (17, 18).
PhoP-PhoQ-mediated Ara4N addition to lipid A occurs through
transcriptional activation of the genes encoding another two-component system, PmrA-PmrB, which can itself be activated independent of PhoP-PhoQ by low-pH or high-iron conditions (9, 14, 20). Two
loci, pmrE and pmrHFIJKLM, are regulated by
PmrA-PmrB and are essential for both biosynthesis of lipid A containing
Ara4N and for resistance to PM (1, 8). This study was
conducted to examine the individual and collective roles of the genes
of the pmrHFIJKLM operon, as well as flanking genes,
in AP resistance, modification of lipid A, and Salmonella
enterica serovar Typhimurium virulence.
 |
MATERIALS AND METHODS |
Bacterial strains, culture conditions, and reagents.
Bacterial strains used in this study are listed in Table
1. Cultures were grown on Luria-Bertani
(LB) agar plates or broth at 37°C with aeration. Antibiotics were
used at the following concentrations: chloramphenicol, 25 µg/ml;
ampicillin, 50 µg/ml; kanamycin, 45 µg/ml; tetracycline, 15 µl/ml; streptomycin, 1,000 µg/ml. The chromogenic substrate for
-galactosidase,
5-bromo-4-chloro-indolyl-
-D-galactopyranoside (X-Gal),
was used at a concentration of 40 µg/ml.
Construction of luciferase fusions and transcription assays.
pmrD was amplified from plasmid pKK01 (8) by PCR
using primers JG177 (5' GGG AAT TCT GCC ATG TTC TGG TGC TGT GC 3')
and JG178 (5' GGG GTA CCG CGC GTC AAC CGC TGC CAT TC
3'). This fragment was digested with the restriction enzymes
EcoRI and KpnI and ligated into pGPL01, which is
a Pir-dependent suicide vector containing a promoterless firefly
luciferase gene downstream of the multiple cloning site (9).
This clone, transformed into Escherichia coli SM10
Pir,
was mated with CS019, and a single recombinant was identified. P22HTint
phage transduction was used to transduce the
pmrD::luc fusion into various strains.
Lucifierase activity was determined as previously described
(9) after growth of strains to log phase (optical density at
600 nm [OD600] ~0.6). A pmrM luciferase
fusion was constructed in a manner identical to that for the
pmrD fusion with primers JG252 (5'
GGAATTCGGACTGATAAGCGTTGCG 3') and JG253 (5'
GGGGTACCTGATGCACGCTGTTATTCC 3'). The luciferase fusion to the
pmrHFIJKLM promoter was also constructed similarly to the
pmrD and pmrM fusions, except that the promoter
fragment was cloned into pLB02 (7), which contains DNA
homologous to a region downstream of pagC, where the vector
is recombined. The primers used to amplify the pmrHFIJKLM
promoter were JG122 (5' GGGGTACCTGAAAGCCGCTTT TC 3') and
JG123 (5' GGAATTCTTTTTACTTCACCT 3').
Analysis of LPS modification.
LPS was isolated by
Mg2+-ethanol precipitation as described by Darveau and
Hancock (4), and lipid A was isolated by hydrolysis in 1%
sodium dodecyl sulfate at pH 4.5 (3). Negative-ion
matrix-assisted laser desorption ionization-time of flight (MALDI-TOF)
mass spectrometry was performed as described previously (5).
Lyophilized lipid A was dissolved with 5 µl of a
5-chloro-2-mercaptobenzothiazole (CMBT) MALDI matrix in
chloroform-methanol (1:1 [vol/vol]) and then applied (1 µl) to the
sample plate. All MALDI-TOF experiments were performed using a
BiflexIII mass spectrometer (Bruker Daltonics, Inc., Billerica, Mass.).
Mass spectroscopy tracings were analyzed for the presence or absence of
Ara4N based on known peak locations at m/z 1,929 (hexa-acylated lipid A with Ara4N) and 2,167 (hepta-acylated lipid A
with Ara4N).
Assays of DNA binding.
PCR fragments of the
pmrHFIJKLM and pmrCAB operons were
digested with EcoRI (located at one end of each fragment)
and labeled with [
-32P]dATP (10 µCi/reaction) with
the Klenow fragment of DNA polymerase I. Binding reactions were carried
out by the incubation of the purified PmrA or PmrA-constitutive
(PmrAc) His-tagged proteins with binding buffer (10mM
Tris-HCl [pH 7.5], 1mM EDTA, 100 mM KCl, 0.1 mM dithiothreitol, 5%
glycerol, 75 µg of sonicated salmon sperm DNA/ml, 10 mg of bovine
serum albumin/ml for 5 min at room temperature. Labeled probe (1 to 5 ng) was added, and the reaction mixture was incubated for 10 min at
room temperature. Samples were electophoresed at 4°C on a 5%
acrylamide gel at 200 V. Gels were subsequently dried and autoradiographed.
Animal studies.
Survival assays were accomplished as
follows. Female BALB/c mice were inoculated orally with 20 µl of an
overnight culture (washed and diluted to 106 organisms/20
µl in phosphate-buffered saline (PBS), which is 1 log unit above the
50% lethal dose [LD50]) using the animal's swallowing
reflex. Mice were prefed 20 µl of 10% sodium bicarbonate 30 min
prior to bacterial inoculation. Alternatively, after dilution in PBS,
animals were inoculated via the intraperitoneal route with various
numbers of organisms in a 100-µl volume. Overnight cultures were
plated to enumerate the numbers of organisms inoculated. The average
days of survival and the numbers of surviving mice were recorded. In
competition assays, female BALB/c mice were inoculated orally as
described above. Mice were inoculated with a mixture of 10 µl of two
different strains (each containing 106 organisms/10 µl).
Mice were sacrificed when clearly moribund, and livers and spleens were
removed. The organs were homogenized in 1 × PBS, diluted, and
plated onto the appropriate antibiotic-containing agar plates, which
selected for one of the two competing strains.
MIC assays of AP resistance.
PM (U.S. Biochemicals; 8,040 U
mg
1) was used at concentrations of 0.0084 to 12 µg/ml
in both plate and broth assays. Standard MIC testing of susceptibility
to PM was accomplished as described by Steinberg et al.
(21).
Deletion analysis of the pmrHFIJKLM
operon.
Flanking regions of the genes of the
operon were amplified using PCR and digested with the
restriction enzyme NcoI. Primers that were used are listed
in Table 2. The flanking regions were then ligated together and digested with the restriction enzymes EcoRI (3') and XbaI (5'). This fragment was then
ligated into plasmid pKAS32, a suicide vector containing a dominant
streptomycin sensitivity allele (19). Deletion constructs in
SM10
Pir were mated with JSG844, and single recombinants were
selected by plasmid-encoded resistance to ampicillin and
chromosome-encoded resistance to chloramphenicol and sensitivity to
streptomycin. Losses of the plasmid (secondary recombination events)
were selected following overnight incubation by growth on 1,000-µg/ml
streptomycin-containing agar. Colonies were further screened by PCR to
confirm the incorporation of the deletion. Mutation of the
pmrM gene was accomplished not by the construction of a
nonpolar deletion but by the construction of the
pmrM::luc fusion described above, which
essentially inserts plasmid pGPL01 into the pmrM coding
sequence.
Confirmation of in-frame deletions and complementation
experiments.
PCR fragments overlapping the deletion sites were
sequenced to confirm correct incorporation of the in-frame deletion.
Deletions in pmrH and pmrF were
complemented with plasmid pKK013 (carrying only the intact
pmrH and pmrF genes). The pmrJ, pmrK,
pmrL, and pmrM genes were complemented by pKK012-1
(carrying only the intact pmrJKL and pmrM genes).
To further confirm nonpolarity, the pmrM::luc fusion was mated into each deletion strain and luciferase activity was monitored.
Isolation of the PmrA protein.
The pmrA gene or
the mutant, constitutive allele of this gene (pmrA505) was
amplified by PCR with primers JG106 (5'
GCGGATCCAAGATACTGATTGTTGAAG 3') and JG107 (5'
AACTGCAGTTAGCTTTCCTCAGTGGC 3') from strains ATCC 14028s (wild
type [WT]) and JSG435, respectively. These fragments were cloned into
the N-terminal His tag-encoding vector pQE30 and transformed into
strain XL1-Blue-MRF'. Transcription of the genes was induced with IPTG
(isopropyl-
-D-thiogalactopyranoside) upon movement of
the plasmids into strain M15/pREP4, and the His-tagged proteins were
purified as previously described (7).
 |
RESULTS |
Definition of the pmrHFIJKLM transcriptional unit and
promoter.
The pmrHFIJKLM genes are unidirectionally
transcribed, and the individual open reading frames are separated by no
more than 5 bp, as shown in the diagram of this chromosomal region
(Fig. 1). This arrangement suggested that
these genes formed a typical prokaryotic operon. To
demonstrate that these genes were indeed cotranscribed, a
luciferase fusion to pmrM, the last gene of the operon, was constructed in single copy on the chromosome. Upon the movement of this fusion into PmrA-null (PmrA
),
PmrAc, and PmrAc
pmrF::Tn10d backgrounds by P22-mediated
transduction, luciferase activity was monitored. As shown in Fig.
2, this fusion was highly regulated
by PmrA-PmrB, and the reporter activity in a PmrA
strain
was similar to that in a strain containing the
pmrF::Tn10d insertion, demonstrating that the
insertion in pmrF had a polar effect on downstream gene
transcription. Therefore, these data strongly suggest that the
pmrHFIJKLM genes are cotranscribed and that the promoter is
upstream of this operon.

View larger version (9K):
[in this window]
[in a new window]
|
FIG. 1.
Diagram of the chromosomal region containing the
pmrG, pmrD, and pmrHFIJKLM genes. Arrows,
direction of transcription.
|
|

View larger version (29K):
[in this window]
[in a new window]
|
FIG. 2.
The pmrHFIJKLM genes are expressed as
an operon. PmrA , PmrAc, and
PmrAc pmrF::Tn10d strains were
examined. Each strain contained a single-copy
pmrM::luc fusion and was assayed in
logarithmic phase (OD600, 0.6) for firefly
luciferase-activity (expressed as relative light units [RLU]). The
data are from a single experiment of three independent assays that gave
similar results.
|
|
To define the DNA region of the
pmrHFIJKLM operon
necessary for PmrA-mediated activation, a 118-bp region of the
predicted
promoter was examined for regulation in a single-copy
luciferase
assay system and also by gel mobility shift experiments for
DNA
binding. To examine promoter regulation, the fragment was cloned
into the luciferase fusion/suicide vector pLB02 (
7)
and subsequently
recombined (into an innocuous site downstream of
pagC) onto the
chromosomes of PmrA

and
PmrA
c strains. As shown in Fig.
3, analysis of luciferase activity
showed this promoter to be 3,442-fold activated by PmrA. Furthermore,
little activity of the
pmrHFIJKLM
promoter-luciferase gene fusion
was observed in a
PmrA

or PhoP
c PmrA

strain. This demonstrates that there is little transcription
of the
pmrHFIJKLM genes in the absence of PmrA and that direct
activation of the promoter is mediated by PmrA and not PhoP.

View larger version (44K):
[in this window]
[in a new window]
|
FIG. 3.
The pmrHFIJKLM promoter is highly PmrA-PmrB
activated and tightly regulated. PmrA , PmrAc,
PhoPc PmrA , and PhoP
PmrAc strains containing a single-copy
pmrHFIJKLM promoter::luc fusion were assayed
in logarithmic phase (OD600, 0.6) for firefly luciferase
activity (expressed as relative light units [RLU]). Note that the
y-axis scale is logarithmic. The data are from a single
experiment of three independent assays that gave similar results.
|
|
To demonstrate PmrA binding to this promoter fragment, gel mobility
shift experiments were conducted with the purified PmrA-His
protein, as
well as a mutant version of this protein (
17) previously
shown to result in constitutive activation of PmrA-PmrB regulated
genes
(PmrA
c-His). As shown in Fig.
4, the
pmrHFIJKLM promoter
fragment bound
to both PmrA-His and PmrA
c-His. Densitometry
studies suggest that the PmrA
c-His protein resulted in a
threefold increase in the amount of
shifted promoter fragment,
suggesting that constitutive activation
of PmrA-regulated genes by this
protein may be due to increased
affinity for promoter binding.

View larger version (47K):
[in this window]
[in a new window]
|
FIG. 4.
Binding of the PmrA-His and PmrAc-His
proteins to the pmrHFIJKLM promoter (called pmrF)
and the pmrCAB promoter (called pmrC). The sizes
of the fragments used and the primers used to amplify the fragments are
noted. Arrows, shifted fragments. N, no protein added; A, PmrA-His
added; Ac, PmrAc-His added.
|
|
To extend the results discussed above to the definition of a consensus
DNA binding site for PmrA, we performed gel shift analysis
on promoter
fragments of another PmrA-regulated locus,
pmrCAB.
The
pmrCAB operon is positively autoregulated by PmrA
(
9,
20).
PCR fragments extending 75, 100, 125, and 200 bp
upstream from
the ATG start codon of the
pmrC gene were
examined by gel mobility
shift experiments, and all fragments were
shown to bind PmrA (Fig.
4; data not shown for the 100- and 125-bp
fragments). Based on
these studies, a 40-bp fragment corresponding to a
region directly
upstream of the predicted

35 sequence was amplified
by PCR and
analyzed in the gel shift assay. As shown in Fig.
5, this fragment
also bound PmrA. In
addition, the binding of PmrA to the
pmrCAB promoter was
shown to be specific. Binding could be completely
abolished with 50 ng
of unlabeled promoter fragment DNA; however,
100 ng of unlabeled,
noncompetitive (pUC19) DNA did not produce
any reduction of
PmrA-
pmrCAB promoter binding. Therefore, the
PmrA
binding site is contained within this 40-bp sequence.

View larger version (50K):
[in this window]
[in a new window]
|
FIG. 5.
PmrA-His protein binding to the pmrCAB
promoter is specific. The presence or absence of the PmrA-His protein,
competitive DNA, and noncompetitive DNA is noted at the top. The
numbers at the bottom are the lane numbers.
|
|
Regulation and role in PM resistance of the flanking genes of the
operon.
It has been shown that the gene upstream of and
divergently transcribed from the pmrHFIJKLM operon
is the PmrA-PmrB-regulated gene, pmrG (8).
The gene directly downstream and divergently transcribed
from the pmrHFIJKLM operon is pmrD,
which imparts increased PM resistance to S. enterica
serovar Typhimurium when expressed from a multicopy plasmid
(16). To further the studies of this chromosomal region,
experiments were designed to determine the potential regulation of
pmrD and the role of pmrD and pmrG in
resistance to PM.
To examine both the regulation and role in AP resistance of the
pmrD gene, a fragment internal to the gene was cloned into
the luciferase fusion/suicide vector pGPL01, and this fusion was
recombined onto the chromosome. This resulted in both a gene disruption
and a transcriptional fusion of
pmrD to the
luc
gene. Regulation
of this locus was examined by moving this region into
PhoP

, PhoP
c, PmrA

, and
PmrA
c backgrounds by P22-mediated transduction, followed by
assay of
firefly luciferase activity. We chose to examine regulation by
PhoP and PmrA as these two regulators are directly or indirectly
involved in the regulation of
pmrG and the
pmrHFIJKLM operon.
As shown in Fig.
6, this locus is activated 66-fold by
PhoP-PhoQ
but is not regulated by PmrA-PmrB. This
pmrD
mutant (in a high-level-PM-resistant
strain background
[PmrA
c]) was also examined on PM-containing plates and by
MIC analysis
for an effect on resistance to PM. Both plate and MIC
assays showed
that the (single-copy) loss of
pmrD had no
effect on resistance
to PM under the growth conditions employed
(data not shown).

View larger version (33K):
[in this window]
[in a new window]
|
FIG. 6.
PhoP-PhoQ but not PmrA-PmrB regulates the
pmrD gene. PmrA , PmrAc,
PhoPc, and Phop strains containing a
single-copy pmrD::luc fusion were assayed in
logarithmic phase (OD600, 0.6) for firefly luciferase
activity (expressed as relative light units [RLU]). Results are
expressed as ratios of firefly luciferase activity in PmrAc
versus PmrA backgrounds and in PhoPc versus
PhoP backgrounds.
|
|
To examine the effect of the loss of the PmrA-PmrB-regulated
pmrG gene on PM resistance,
pmrG::Tn
phoA was transduced into
a
PmrA
c background and the resulting strains were examined
for resistance
to PM on plates and by MIC analysis. Like the loss
of
pmrD, the
loss of
pmrG had no effect on
resistance to PM under standard
growth conditions. Therefore, this
chromosomal region contains
three regulated loci, one by PhoP-PhoQ
(
pmrD) and two by PmrA-PmrB
(
pmrG and
pmrHFIJKLM), while of these three loci only
mutations
in
pmrHFIJKLM affect PM resistance when strains
are grown on standard
laboratory
media.
Deletion analysis of the pmrHFIJKLM operon:
roles of individual loci in LPS modification and PM resistance.
To
examine the roles of individual genes of the pmrHFIJKLM
operon in resistance to PM and in Ara4N modification of lipid
A, nonpolar deletions were constructed in pmrH,
pmrF, pmrI, pmrJ, pmrK, and
pmrL. An insertion mutation was created in pmrM
by recombination of a suicide plasmid within this locus. The
chromosomally incorporated deletions were confirmed to be nonpolar by
sequencing the deletion junctions and by demonstrating the lack of an
effect on luciferase activity of a pmrM::luc
fusion mated into each deletion background. These nonpolar deletion or
mutant strains (constructed in a PmrAc background) were
then examined for resistance to PM. All mutations except that in
pmrM had a major effect on resistance to PM (MIC of
PmrAc and
pmrM strains, 4 µg/ml; MIC of
strains with pmrHFIJKL deletions, 0.1 µg/ml). To determine
if the loss in resistance to PM was due to the loss of Ara4N in lipid
A, MALDI-TOF mass spectroscopy was performed on purified lipid A. This
analysis confirmed the absence of Ara4N in deletion strains with
reduced resistance to PM (Fig. 7). This
can be seen by the absence of peaks at m/z 1,929 and 2,167, which correspond to hexa- and hepta-acyl lipid A with Ara4N, respectively. Loss of the peaks at m/z 1,949 and 2,189 is
also evident in the mutants, as these peaks correspond to hexa- and hepta-acyl lipid A, respectively, with Ara4N and the
PhoP-PhoQ-mediated hydroxyl addition to myristate. The profile of
the pmrM mutant was identical to that of the
PmrAc strain (the parental strain of all mutants examined
[8]), further demonstrating that this gene plays no
role in Ara4N addition to lipid A or PM resistance.

View larger version (18K):
[in this window]
[in a new window]
|
FIG. 7.
Mass spectroscopy of the lipid A from
pmrF, pmrI, pmrK, pmrL, and
pmrM nonpolar deletion strains. The m/z ratios
and related structures are as follows: 1,797, unmodified hexa-acyl
lipid A; 1,815, hexa-acyl lipid A with 2-OH myristate; 1,929, hexa-acyl
lipid A with Ara4N; 1,949, hexa-acyl lipid A with 2-OH myristate and
Ara4N; 2,036, unmodified hepta-acyl lipid A; 2,052, hepta-acyl lipid A
with 2-OH myristate; 2,167, hepta-acyl lipid A with Ara4N; 2,189, hepta-acyl lipid A with 2-OH myristate and Ara4N. The lipid A from
strains with pmrH and pmrJ nonpolar deletions was
also examined, and the results were identical to those shown in panels
A through D but were not included due to differences in the scale of
m/z values examined and the difficulty in comparing these
tracings to those for the other samples. The PmrAc strain
that is the parental background of the strains with the examined
deletions has been examined previously (8), and results for it are
identical to those shown in panel E.
|
|
LPS modification affects oral virulence.
It has been shown
previously that a strain containing a
pmrF::Tn10d insertion was unable to add Ara4N
to lipid A, which resulted in a significant decrease in resistance to
PM (8). To determine the effect on S. enterica serovar Typhimurium virulence of the lipid A modification
with Ara4N, the pmrF::Tn10d mutant was
examined in the mouse model of typhoid fever.
Mice inoculated orally with the
pmrF::Tn
10d
mutant at a dose approximately 1 log unit above the LD
50
had a sevenfold increase
in survival versus mice inoculated with the WT
strain (62 versus
9%) (Fig.
8A).
Furthermore, of those mice inoculated with the
pmrF::Tn
10d mutant, the time to death of some
of the mice was
greater than 20 days, while the mice inoculated with
the WT consistently
averaged about 12 days (Fig.
8B). To confirm the
observed virulence
defect, competition assays were performed with the
pmrF::Tn
10d mutant and the WT strain. These
data show that the
pmrF::Tn
10d mutant was
dramatically impaired (10- to 1,000-fold) in its ability
to compete
with the WT strain (Fig.
8C). In vitro competition
assays demonstrated
that the defect was not due to a growth deficiency
(Fig.
8C). A
PmrA

strain was also examined in all of the
above-mentioned virulence
assays. Although it was expected that a
PmrA

strain should show the same, if not a greater,
defect than the
pmrF::Tn
10d mutant, the
virulence defect that was observed was
not as dramatic as that seen
with the
pmrF::Tn
10d mutant (Fig.
8).

View larger version (20K):
[in this window]
[in a new window]
|
FIG. 8.
Mutations in pmrA or the
pmrHFIJKLM operon affect virulence by the oral
route. Mice were inoculated orally with a dose of 106 CFU.
BALB/c mice were infected with ATCC 14028s (WT), WT with a
pmrA::Tn10d insertion (PmrA ),
WT with a pmrF::Tn10d insertion
(PmrF ), or a combination of two of these strains. (A)
Percent survival of BALB/c mice receiving the WT, PmrA ,
or PmrF strain. The numbers above the bars represent the
number of surviving mice per the number of mice tested. (B) Percent
survival of mice over 40 days postinfection. (C) Competition assays of
WT versus PmrA and WT versus PmrF strains.
The competitive index is the ratio of CFU in the livers of mice
infected with a PmrA , WT, or PmrF strain to
CFU in livers of mice infected with the WT strain. The WT-versus-WT
experiment involved two WT strains marked with different antibiotic
resistances. The competitions labeled in vitro were performed by growth
overnight in LB medium to ensure that any in vivo effects were not due
to a growth disadvantage. Both liver and spleen were examined in the
competition assays, but only the data for the liver are shown.
|
|
Intraperitoneal inoculation of JSG485
(
pmrF::Tn
10d) and PmrA

strains
into mice had no effect on the LD
50 (<20 organisms) or
the
survival time of the mice compared to inoculation with the
WT (data
not shown). Therefore, loss of Ara4N affects
S. enterica serovar Typhimurium virulence during early events in a natural
infection but not at later stages of macrophage survival and growth
within the liver and
spleen.
 |
DISCUSSION |
Activation of the PmrA-PmrB two-component regulatory system by
environmental signals or by mutations within pmrA that
result in a constitutive phenotype activates the transcription of genes whose products covalently modify LPS. These modifications (Ara4N and
phosphoethanolamine) result in increased resistance to AP, which are
membrane-active pore formers present at mucosal surfaces and within
macrophages and neutrophils. Increased resistance to these peptides
provides the bacterium with a survival advantage within the host. In
this work, we presented a detailed characterization of an island of
PmrA-PmrB- and PhoP-PhoQ-regulated genes. Experiments were conducted to
examine the roles of the individual genes in this region in resistance
to AP and what effect the loss of genes in this region has on S. enterica serovar Typhimurium virulence.
The pmrHFIJKLM locus is regulated by PmrA-PmrB, and a
pmrF::Tn10d insertion was shown to eliminate
the ability to modify lipid A with Ara4N and markedly reduced
resistance to PM (8). These genes were shown to be
cotranscribed, as a pmrM::luc fusion was activated by PmrA-PmrB and luciferase activity was dramatically reduced
when the reporter fusion was recombined downstream of the
pmrF::Tn10d insertion. Fusion of the promoter
of this operon to the gene encoding firefly luciferase showed
it to be over 3,000-fold activated by PmrA-PmrB. It is intriguing to
propose that this highly expressed in vivo-activated promoter may be
useful in a live-attenuated Salmonella vaccine for the
expression of heterologous antigens. This approach has several
advantages including high-level expression in host antigen-presenting
cells and the ability to construct stable, single-copy chromosomal
constructs. In fact, this approach has been successfully tested using
phoP-regulated gene promoters (2, 13).
Studies of the regulators of two-component systems have shown that they
bind to consensus sequences in the promoters of regulated genes.
Therefore, experiments were designed to examine the interaction of PmrA
with pmr promoters. The PmrA protein was purified (both WT
and constitutive forms) and used in promoter binding studies. A 118-bp
region of the pmrHFIJKLM promoter and a 40-bp region of the
pmrCAB operon promoter were found to shift with each
protein. The 40-bp region of the pmrCAB promoter is located
just upstream of the
35 region, which places the putative binding
site in a position comparable to those of other transcriptional
activators of the OmpR family. Recently, Wøsten and Groisman
(22) demonstrated similar binding of the PmrA protein to the
promoters of activated genes and defined a consensus binding site of
5' TTAAKTTCTTAAKGTT 3' for PmrA. This site is located
within both the pmrCAB and pmrHFIJKLM operon promoter fragments that bound PmrA (16 of 16 match in
each). The PmrAc protein bound approximately threefold more
promoter fragments than the WT PmrA protein, suggesting that the
constitutive activity of this protein may be due to increased promoter affinity.
Nonpolar deletions were constructed in each gene of the
pmrHFIJKLM operon (except pmrM, which was
disrupted by insertion), and the effect of these mutations on PM
resistance was measured. All of the genes except pmrM had an
effect on PM resistance, which resulted in an MIC level similar to that
of a PmrA
strain (MIC of PmrAc and
pmrM strains, 4 µg/ml; MIC of pmrHFIJKL
deletion strains, 0.1 µg/ml). Based on protein homologies and known
sugar biosynthesis pathways, a model involving the
pmrHFIJKLM operon and pmrE has been
proposed for Ara4N biosynthesis and addition to lipid A (1). This pathway begins with the conversion of UDP-glucose to
UDP-glucuronic acid by the pmrE gene product, followed by
the conversion to UDP-4-amino-L-deoxyarabinose and
attachment of this moiety to lipid A by the products of the pmrHFIJKLM operon. This model, however, was
unable to identify functions for PmrL and PmrM, as neither of these
small proteins has any strong similarities to proteins in GenBank. From
this study, it is clear that PmrL does belong at some point in the pathway but PmrM does not. Therefore, the function of PmrM remains unknown.
Previous studies showed that the gene upstream of the
pmrHFIJKLM operon, pmrG, was
regulated by PmrA-PmrB (8). Because the effect of this gene
on the PM resistance phenotype had not been previously examined,
a pmrG mutant was assayed for PM resistance in a
PmrAc background and the pmrG mutation was shown
to have no effect. The gene downstream of the operon,
pmrD, however, had previously been shown to have an effect
on PM resistance only in high copy number. To see if it too was
regulated by PmrA-PmrB, a firefly luciferase fusion was created and
expression was measured when strains were grown in various backgrounds.
This data surprisingly demonstrated that pmrD was regulated
by PhoP-PhoQ and not PmrA-PmrB. Interestingly, work by others
accomplished concurrently with our studies also showed that
pmrD was regulated by PhoP-PhoQ and that the pmrD
gene product mediates interaction of the PhoP-PhoQ system with the
PmrA-PmrB system, as PmrA-regulated genes are not expressed in a
pmrD mutant grown under PhoP-PhoQ-inducing conditions (low magnesium) (14). PmrD is thought to exert its effect on
PmrA-PmrB through a posttranscriptional mechanism, possibly involving
its effect on PmrA phosphorylation. These results likely explain why pmrD had an effect on PM resistance only when in multicopy
and when strains were grown in LB medium (non-phoP-PhoQ-inducing conditions).
Loss of expression of the pmrHFIJKLM operon
eliminates Ara4A addition to lipid A and PM resistance. To
determine if this loss played a role in S. enterica
serovar Typhimurium pathogenesis, a pmrF mutant was
examined in mice and was shown to have markedly reduced virulence by
the oral route but not by the intraperitoneal route. In addition, for
most of the mice that did eventually die, the time from
inoculation to death was much longer than for mice infected with a WT
strain. A pmrA mutant showed similar results, but did
not display as severe of a virulence defect as the
pmrF mutant strain. This was surprising, as PmrA activates
the pmrF-containing operon and therefore
was expected to give similar results. These data suggest that the
pmrHFIJKLM operon may be expressed in vivo by a
mechanism independent of PmrA-PmrB.
At this time, it is unclear at which stage of infection the
pmrHFIJKLM locus plays a role. The PmrA-PmrB system (and the
PhoP-PhoQ system, which can activate transcription of pmrAB)
is thought to be induced within macrophages, and if the role of the
PmrA-PmrB regulatory system is to promote survival within macrophages,
then a defect should have been observed in mice by both the
intraperitoneal and oral routes. Therefore, the data suggest that the
defect is prior to the interaction with macrophages. In vitro
experiments show no defect in invasion or type III secretion with
pmrA or pmrF mutants (J. S. Gunn,
unpublished results). Therefore, it is intriguing to speculate
that PmrA-PmrB may be activated by unknown environmental signals within
the small intestine and that the PmrA-PmrB-induced LPS modifications
play a role in resistance to intestinal AP or other intraintestinal
antimicrobial factors.
The results of this work further characterize a highly
regulated island of genes necessary for LPS modification, AP
resistance, survival in mice, and two-component system
interactions. Furthermore, these data demonstrate that in
vivo-regulated modifications of LPS are an important part of
Salmonella pathogenesis and suggest that the PhoP-PhoQ and
PmrA-PmrB regulatory systems may be important at locations other than
within host cells.
 |
ACKNOWLEDGMENTS |
This work was supported by grants AI30479 (S.I.M.), AI43521
(J.S.G.), and T32AI07271-15 (S.S.R.) from the National Institutes of Health.
 |
FOOTNOTES |
*
Corresponding author. Mailing address: University
of Texas Health Science Center at San Antonio, Department of
Microbiology, MC 7758, 7703 Floyd Curl Dr., San Antonio, TX 78229-3900. Phone: (210) 567-3973. Fax: (210) 567-3795. E-mail:
gunnj{at}uthscsa.edu.
Editor:
J. T. Barbieri
 |
REFERENCES |
| 1.
|
Baker, S. J.,
C. Daniels, and R. Morona.
1997.
PhoP/Q regulated genes in Salmonella typhi: identification of melittin sensitive mutants.
Microb. Pathog.
22:165-179[CrossRef][Medline].
|
| 2.
|
Bullifent, H. L.,
K. F. Griffin,
S. M. Jones,
A. Yates,
L. Harrington, and R. W. Titball.
2000.
Antibody responses to Yersinia pestis F1-antigen expressed in Salmonella typhimurium aroA from in vivo-inducible promoters.
Vaccine.
18:2668-2676[CrossRef][Medline].
|
| 3.
|
Caroff, M.,
A. Tacken, and L. Szabo.
1988.
Detergent-accelerated hydrolysis of bacterial endotoxins and determination of the anomeric configuration of the glycosyl phosphate present in the "isolated lipid A" fragment of the Bordetella pertussis endotoxin.
Carbohydr. Res.
175:273-282[CrossRef][Medline].
|
| 4.
|
Darveau, R. P., and R. E. Hancock.
1983.
Procedure for isolation of bacterial lipopolysaccharides from both smooth and rough Pseudomonas aeruginosa and Salmonella typhimurium strains.
J. Bacteriol.
155:831-838[Abstract/Free Full Text].
|
| 5.
|
Ernst, R. K.,
E. C. Yi,
L. Guo,
K. B. Lim,
J. L. Burns,
M. Hackett, and S. I. Miller.
1999.
Specific lipopolysaccharide found in cystic fibrosis airway Pseudomonas aeruginosa.
Science
286:1561-1565[Abstract/Free Full Text].
|
| 6.
|
Fields, P. I.,
R. V. Swanson,
C. G. Haidaris, and F. Heffron.
1986.
Mutants of Salmonella typhimurium that cannot survive within the macrophage are avirulent.
Proc. Natl. Acad. Sci. USA
83:5189-5193[Abstract/Free Full Text].
|
| 7.
|
Gunn, J. S.,
E. L. Hohmann, and S. I. Miller.
1996.
Transcriptional regulation of Salmonella virulence: a PhoQ periplasmic domain mutation results in increased net phosphotransfer to PhoP.
J. Bacteriol.
178:6369-6373[Abstract/Free Full Text].
|
| 8.
|
Gunn, J. S.,
K. B. Lim,
J. Krueger,
K. Kim,
L. Guo,
M. Hackett, and S. I. Miller.
1998.
PmrA-PmrB regulated genes necessary for 4-aminoarabinose lipid A modification and polymyxin resistance.
Mol. Microbiol.
27:1171-1182[CrossRef][Medline].
|
| 9.
|
Gunn, J. S., and S. I. Miller.
1996.
PhoP/PhoQ activates transcription of pmrA/B, encoding a two-component system involved in Salmonella typhimurium antimicrobial peptide resistance.
J. Bacteriol.
178:6857-6864[Abstract/Free Full Text].
|
| 10.
|
Guo, L.,
K. Lim,
J. S. Gunn,
B. Bainbridge,
R. Darveau,
M. Hackett, and S. I. Miller.
1997.
Regulation of lipid A modifications by Salmonella typhimurium virulence genes phoP-phoQ.
Science.
276:250-253[Abstract/Free Full Text].
|
| 11.
|
Guo, L.,
K. B. Lim,
C. M. Poduje,
M. Daniel,
J. S. Gunn,
M. Hackett, and S. I. Miller.
1998.
Lipid A acylation and bacterial resistance against vertebrate antimicrobial peptides.
Cell
95:189-198[CrossRef][Medline].
|
| 12.
|
Hohmann, E. L.,
C. A. Oletta,
K. P. Killeen, and S. I. Miller.
1996.
phoP/phoQ-deleted Salmonella typhi (TY800) is a safe and immunogenic single dose typhoid fever vaccine in volunteers.
J. Infect. Dis.
173:1408-1414[Medline].
|
| 13.
|
Hohmann, E. L.,
C. A. Oletta,
W. P. Loomis, and S. I. Miller.
1995.
Macrophage-inducible expression of a model antigen in Salmonella typhimurium enhances immunogenicity.
Proc. Natl. Acad. Sci. USA
92:2904-2908[Abstract/Free Full Text].
|
| 14.
|
Kox, L. F.,
M. M. Wosten, and E. A. Groisman.
2000.
A small protein that mediates the activation of a two-component system by another two-component system.
EMBO J.
19:1861-1872[CrossRef][Medline].
|
| 15.
|
Miller, S. I.,
A. M. Kukral, and J. J. Mekalanos.
1989.
A two-component regulatory system (phoP phoQ) controls Salmonella typhimurium virulence.
Proc. Natl. Acad. Sci. USA
86:5054-5058[Abstract/Free Full Text].
|
| 16.
|
Roland, K. L.,
C. R. Esther, and J. K. Spitznagel.
1994.
Isolation and characterization of a gene, pmrD, from Salmonella typhimurium that confers resistance to polymyxin when expressed in multiple copies.
J. Bacteriol.
176:3589-3597[Abstract/Free Full Text].
|
| 17.
|
Roland, K. L.,
L. E. Martin,
C. R. Esther, and J. K. Spitznagel.
1993.
Spontaneous pmrA mutants of Salmonella typhimurium LT2 define a new two-component regulatory system with a possible role in virulence.
J. Bacteriol.
175:4154-4164[Abstract/Free Full Text].
|
| 18.
|
Shafer, W. M.,
S. G. Casey, and J. K. Spitznagel.
1984.
Lipid A and resistance of Salmonella typhimurium to antimicrobial granule proteins of human neutrophils.
Infect. Immun.
43:834-838[Abstract/Free Full Text].
|
| 19.
|
Skorupski, K., and R. K. Taylor.
1996.
Positive selection vectors for allelic exchange.
Gene
169:47-52[CrossRef][Medline].
|
| 20.
|
Soncini, F. C., and E. A. Groisman.
1996.
Two-component regulatory systems can interact to process multiple environmental signals.
J. Bacteriol.
178:6796-6801[Abstract/Free Full Text].
|
| 21.
|
Steinberg, D. A.,
M. A. Hurst,
C. A. Fujii,
A. H. Kung,
J. F. Ho,
F. C. Cheng,
D. J. Loury, and J. C. Fiddes.
1997.
Protegrin-1: a broad-spectrum, rapidly microbicidal peptide with in vivo activity.
Antimicrob. Agents Chemother.
41:1738-1742[Abstract].
|
| 22.
|
Wøsten, M. M., and E. A. Groisman.
1999.
Molecular characterization of the PmrA regulon.
J. Biol. Chem.
274:27185-27190[Abstract/Free Full Text].
|
Infection and Immunity, November 2000, p. 6139-6146, Vol. 68, No. 11
0019-9567/00/$04.00+0
Copyright © 2000, American Society for Microbiology. All rights reserved.
This article has been cited by other articles:
-
Pilonieta, M. C., Erickson, K. D., Ernst, R. K., Detweiler, C. S.
(2009). A Protein Important for Antimicrobial Peptide Resistance, YdeI/OmdA, Is in the Periplasm and Interacts with OmpD/NmpC. J. Bacteriol.
191: 7243-7252
[Abstract]
[Full Text]
-
Abi Khattar, Z., Rejasse, A., Destoumieux-Garzon, D., Escoubas, J. M., Sanchis, V., Lereclus, D., Givaudan, A., Kallassy, M., Nielsen-Leroux, C., Gaudriault, S.
(2009). The dlt Operon of Bacillus cereus Is Required for Resistance to Cationic Antimicrobial Peptides and for Virulence in Insects. J. Bacteriol.
191: 7063-7073
[Abstract]
[Full Text]
-
Adams, M. D., Nickel, G. C., Bajaksouzian, S., Lavender, H., Murthy, A. R., Jacobs, M. R., Bonomo, R. A.
(2009). Resistance to Colistin in Acinetobacter baumannii Associated with Mutations in the PmrAB Two-Component System. Antimicrob. Agents Chemother.
53: 3628-3634
[Abstract]
[Full Text]
-
Arafah, S., Rosso, M.-L., Rehaume, L., Hancock, R. E. W., Simonet, M., Marceau, M.
(2009). An iron-regulated LysR-type element mediates antimicrobial peptide resistance and virulence in Yersinia pseudotuberculosis. Microbiology
155: 2168-2181
[Abstract]
[Full Text]
-
Sun, S., Negrea, A., Rhen, M., Andersson, D. I.
(2009). Genetic Analysis of Colistin Resistance in Salmonella enterica Serovar Typhimurium. Antimicrob. Agents Chemother.
53: 2298-2305
[Abstract]
[Full Text]
-
Gooderham, W. J., Gellatly, S. L., Sanschagrin, F., McPhee, J. B., Bains, M., Cosseau, C., Levesque, R. C., Hancock, R. E. W.
(2009). The sensor kinase PhoQ mediates virulence in Pseudomonas aeruginosa. Microbiology
155: 699-711
[Abstract]
[Full Text]
-
Manabe, T., Kawasaki, K.
(2008). Extracellular Loops of Lipid A 3-O-Deacylase PagL Are Involved in Recognition of Aminoarabinose-Based Membrane Modifications in Salmonella enterica Serovar Typhimurium. J. Bacteriol.
190: 5597-5606
[Abstract]
[Full Text]
-
Pranting, M., Negrea, A., Rhen, M., Andersson, D. I.
(2008). Mechanism and Fitness Costs of PR-39 Resistance in Salmonella enterica Serovar Typhimurium LT2. Antimicrob. Agents Chemother.
52: 2734-2741
[Abstract]
[Full Text]
-
Wang, W.-B., Chen, I-C., Jiang, S.-S., Chen, H.-R., Hsu, C.-Y., Hsueh, P.-R., Hsu, W.-B., Liaw, S.-J.
(2008). Role of RppA in the Regulation of Polymyxin B Susceptibility, Swarming, and Virulence Factor Expression in Proteus mirabilis. Infect. Immun.
76: 2051-2062
[Abstract]
[Full Text]
-
Eswarappa, S. M., Panguluri, K. K., Hensel, M., Chakravortty, D.
(2008). The yejABEF operon of Salmonella confers resistance to antimicrobial peptides and contributes to its virulence. Microbiology
154: 666-678
[Abstract]
[Full Text]
-
Yan, A., Guan, Z., Raetz, C. R. H.
(2007). An Undecaprenyl Phosphate-Aminoarabinose Flippase Required for Polymyxin Resistance in Escherichia coli. J. Biol. Chem.
282: 36077-36089
[Abstract]
[Full Text]
-
Murray, S. R., Ernst, R. K., Bermudes, D., Miller, S. I., Low, K. B.
(2007). PmrA(Con) Confers pmrHFIJKL-Dependent EGTA and Polymyxin Resistance on msbB Salmonella by Decorating Lipid A with Phosphoethanolamine. J. Bacteriol.
189: 5161-5169
[Abstract]
[Full Text]
-
Mohapatra, N. P., Soni, S., Bell, B. L., Warren, R., Ernst, R. K., Muszynski, A., Carlson, R. W., Gunn, J. S.
(2007). Identification of an Orphan Response Regulator Required for the Virulence of Francisella spp. and Transcription of Pathogenicity Island Genes. Infect. Immun.
75: 3305-3314
[Abstract]
[Full Text]
-
Kawasaki, K., China, K., Nishijima, M.
(2007). Release of the Lipopolysaccharide Deacylase PagL from Latency Compensates for a Lack of Lipopolysaccharide Aminoarabinose Modification-Dependent Resistance to the Antimicrobial Peptide Polymyxin B in Salmonella enterica. J. Bacteriol.
189: 4911-4919
[Abstract]
[Full Text]
-
Mascher, T., Helmann, J. D., Unden, G.
(2006). Stimulus Perception in Bacterial Signal-Transducing Histidine Kinases. Microbiol. Mol. Biol. Rev.
70: 910-938
[Abstract]
[Full Text]
-
Reynolds, C. M., Ribeiro, A. A., McGrath, S. C., Cotter, R. J., Raetz, C. R. H., Trent, M. S.
(2006). An Outer Membrane Enzyme Encoded by Salmonella typhimurium lpxR That Removes the 3'-Acyloxyacyl Moiety of Lipid A. J. Biol. Chem.
281: 21974-21987
[Abstract]
[Full Text]
-
Trent, M. S., Stead, C. M., Tran, A. X., Hankins, J. V.
(2006). Invited review: Diversity of endotoxin and its impact on pathogenesis. Innate Immunity
12: 205-223
[Abstract]
-
Campos, M. A., Morey, P., Bengoechea, J. A.
(2006). Quinolones sensitize gram-negative bacteria to antimicrobial peptides.. Antimicrob. Agents Chemother.
50: 2361-2367
[Abstract]
[Full Text]
-
Tran, A. X., Whittimore, J. D., Wyrick, P. B., McGrath, S. C., Cotter, R. J., Trent, M. S.
(2006). The Lipid A 1-Phosphatase of Helicobacter pylori Is Required for Resistance to the Antimicrobial Peptide Polymyxin.. J. Bacteriol.
188: 4531-4541
[Abstract]
[Full Text]
-
Cole, A. L., Yang, O. O., Warren, A. D., Waring, A. J., Lehrer, R. I., Cole, A. M.
(2006). HIV-1 Adapts to a Retrocyclin with Cationic Amino Acid Substitutions That Reduce Fusion Efficiency of gp41.. J. Immunol.
176: 6900-6905
[Abstract]
[Full Text]
-
Faucher, Séb. P., Porwollik, S., Dozois, C. M., McClelland, M., Daigle, F.
(2006). Transcriptome of Salmonella enterica serovar Typhi within macrophages revealed through the selective capture of transcribed sequences. Proc. Natl. Acad. Sci. USA
103: 1906-1911
[Abstract]
[Full Text]
-
Merighi, M., Carroll-Portillo, A., Septer, A. N., Bhatiya, A., Gunn, J. S.
(2006). Role of Salmonella enterica Serovar Typhimurium Two-Component System PreA/PreB in Modulating PmrA-Regulated Gene Transcription. J. Bacteriol.
188: 141-149
[Abstract]
[Full Text]
-
Merighi, M., Ellermeier, C. D., Slauch, J. M., Gunn, J. S.
(2005). Resolvase-In Vivo Expression Technology Analysis of the Salmonella enterica Serovar Typhimurium PhoP and PmrA Regulons in BALB/c Mice. J. Bacteriol.
187: 7407-7416
[Abstract]
[Full Text]
-
Kristian, S. A., Datta, V., Weidenmaier, C., Kansal, R., Fedtke, I., Peschel, A., Gallo, R. L., Nizet, V.
(2005). D-Alanylation of Teichoic Acids Promotes Group A Streptococcus Antimicrobial Peptide Resistance, Neutrophil Survival, and Epithelial Cell Invasion. J. Bacteriol.
187: 6719-6725
[Abstract]
[Full Text]
-
Kim, W., Surette, M. G.
(2005). Prevalence of Surface Swarming Behavior in Salmonella. J. Bacteriol.
187: 6580-6583
[Abstract]
[Full Text]
-
Tran, A. X., Lester, M. E., Stead, C. M., Raetz, C. R. H., Maskell, D. J., McGrath, S. C., Cotter, R. J., Trent, M. S.
(2005). Resistance to the Antimicrobial Peptide Polymyxin Requires Myristoylation of Escherichia coli and Salmonella typhimurium Lipid A. J. Biol. Chem.
280: 28186-28194
[Abstract]
[Full Text]
-
Williams, G. J., Breazeale, S. D., Raetz, C. R. H., Naismith, J. H.
(2005). Structure and Function of Both Domains of ArnA, a Dual Function Decarboxylase and a Formyltransferase, Involved in 4-Amino-4-deoxy-L-arabinose Biosynthesis. J. Biol. Chem.
280: 23000-23008
[Abstract]
[Full Text]
-
Rediers, H., Rainey, P. B., Vanderleyden, J., De Mot, R.
(2005). Unraveling the Secret Lives of Bacteria: Use of In Vivo Expression Technology and Differential Fluorescence Induction Promoter Traps as Tools for Exploring Niche-Specific Gene Expression. Microbiol. Mol. Biol. Rev.
69: 217-261
[Abstract]
[Full Text]
-
Tamayo, R., Choudhury, B., Septer, A., Merighi, M., Carlson, R., Gunn, J. S.
(2005). Identification of cptA, a PmrA-Regulated Locus Required for Phosphoethanolamine Modification of the Salmonella enterica Serovar Typhimurium Lipopolysaccharide Core. J. Bacteriol.
187: 3391-3399
[Abstract]
[Full Text]
-
Zhang, H., Morikawa, K., Ohta, T., Kato, Y.
(2005). In vitro resistance to the CS{alpha}{beta}-type antimicrobial peptide ASABF- is conferred by overexpression of sigma factor sigB in Staphylococcus aureus. J Antimicrob Chemother
55: 686-691
[Abstract]
[Full Text]
-
Winfield, M. D., Latifi, T., Groisman, E. A.
(2005). Transcriptional Regulation of the 4-Amino-4-deoxy-L-arabinose Biosynthetic Genes in Yersinia pestis. J. Biol. Chem.
280: 14765-14772
[Abstract]
[Full Text]
-
Breazeale, S. D., Ribeiro, A. A., McClerren, A. L., Raetz, C. R. H.
(2005). A Formyltransferase Required for Polymyxin Resistance in Escherichia coli and the Modification of Lipid A with 4-Amino-4-deoxy-L-arabinose: IDENTIFICATION AND FUNCTION OF UDP-4-DEOXY-4-FORMAMIDO-L-ARABINOSE. J. Biol. Chem.
280: 14154-14167
[Abstract]
[Full Text]
-
Tanabe, H., Ayabe, T., Bainbridge, B., Guina, T., Ernst, R. K., Darveau, R. P., Miller, S. I., Ouellette, A. J.
(2005). Mouse Paneth Cell Secretory Responses to Cell Surface Glycolipids of Virulent and Attenuated Pathogenic Bacteria. Infect. Immun.
73: 2312-2320
[Abstract]
[Full Text]
-
Kawasaki, K., Ernst, R. K., Miller, S. I.
(2005). Inhibition of Salmonella enterica Serovar Typhimurium Lipopolysaccharide Deacylation by Aminoarabinose Membrane Modification. J. Bacteriol.
187: 2448-2457
[Abstract]
[Full Text]
-
Sahl, H.-G., Pag, U., Bonness, S., Wagner, S., Antcheva, N., Tossi, A.
(2005). Mammalian defensins: structures and mechanism of antibiotic activity. J. Leukoc. Biol.
77: 466-475
[Abstract]
[Full Text]
-
Geurtsen, J., Steeghs, L., Hove, J. t., van der Ley, P., Tommassen, J.
(2005). Dissemination of Lipid A Deacylases (PagL) among Gram-negative Bacteria: IDENTIFICATION OF ACTIVE-SITE HISTIDINE AND SERINE RESIDUES. J. Biol. Chem.
280: 8248-8259
[Abstract]
[Full Text]
-
Bennett, H. P. J., Clarke, D. J.
(2005). The pbgPE operon in Photorhabdus luminescens Is Required for Pathogenicity and Symbiosis. J. Bacteriol.
187: 77-84
[Abstract]
[Full Text]
-
Shelburne, C. E., Coulter, W. A., Olguin, D., Lantz, M. S., Lopatin, D. E.
(2005). Induction of {beta}-Defensin Resistance in the Oral Anaerobe Porphyromonas gingivalis. Antimicrob. Agents Chemother.
49: 183-187
[Abstract]
[Full Text]
-
Winfield, M. D., Groisman, E. A.
(2004). Phenotypic differences between Salmonella and Escherichia coli resulting from the disparate regulation of homologous genes. Proc. Natl. Acad. Sci. USA
101: 17162-17167
[Abstract]
[Full Text]
-
Campos, M. A., Vargas, M. A., Regueiro, V., Llompart, C. M., Alberti, S., Bengoechea, J. A.
(2004). Capsule Polysaccharide Mediates Bacterial Resistance to Antimicrobial Peptides. Infect. Immun.
72: 7107-7114
[Abstract]
[Full Text]
-
Marceau, M., Sebbane, F., Ewann, F., Collyn, F., Lindner, B., Campos, M. A., Bengoechea, J.-A., Simonet, M.
(2004). The pmrF polymyxin-resistance operon of Yersinia pseudotuberculosis is upregulated by the PhoP-PhoQ two-component system but not by PmrA-PmrB, and is not required for virulence. Microbiology
150: 3947-3957
[Abstract]
[Full Text]
-
Matsukawa, M., Greenberg, E. P.
(2004). Putative Exopolysaccharide Synthesis Genes Influence Pseudomonas aeruginosa Biofilm Development. J. Bacteriol.
186: 4449-4456
[Abstract]
[Full Text]
-
Lee, H., Hsu, F.-F., Turk, J., Groisman, E. A.
(2004). The PmrA-Regulated pmrC Gene Mediates Phosphoethanolamine Modification of Lipid A and Polymyxin Resistance in Salmonella enterica. J. Bacteriol.
186: 4124-4133
[Abstract]
[Full Text]
-
Baud, D., Benyacoub, J., Revaz, V., Kok, M., Ponci, F., Bobst, M., Curtiss, R. III, De Grandi, P., Nardelli-Haefliger, D.
(2004). Immunogenicity against Human Papillomavirus Type 16 Virus-Like Particles Is Strongly Enhanced by the PhoPc Phenotype in Salmonella enterica Serovar Typhimurium. Infect. Immun.
72: 750-756
[Abstract]
[Full Text]
-
Moskowitz, S. M., Ernst, R. K., Miller, S. I.
(2004). PmrAB, a Two-Component Regulatory System of Pseudomonas aeruginosa That Modulates Resistance to Cationic Antimicrobial Peptides and Addition of Aminoarabinose to Lipid A. J. Bacteriol.
186: 575-579
[Abstract]
[Full Text]
-
Swords, W. E., Jones, P. A., Apicella, M. A.
(2003). Review: The lipo-oligosaccharides of Haemophilus influenzae: an interesting array of characters. Innate Immunity
9: 131-144
[Abstract]
-
Kim, W., Killam, T., Sood, V., Surette, M. G.
(2003). Swarm-Cell Differentiation in Salmonellaenterica Serovar Typhimurium Results in Elevated Resistance to Multiple Antibiotics. J. Bacteriol.
185: 3111-3117
[Abstract]
[Full Text]
-
Kato, A., Latifi, T., Groisman, E. A.
(2003). Closing the loop: The PmrA/PmrB two-component system negatively controls expression of its posttranscriptional activator PmrD. Proc. Natl. Acad. Sci. USA
100: 4706-4711
[Abstract]
[Full Text]
-
Tamayo, R., Ryan, S. S., McCoy, A. J., Gunn, J. S.
(2002). Identification and Genetic Characterization of PmrA-Regulated Genes and Genes Involved in Polymyxin B Resistance in Salmonella enterica Serovar Typhimurium. Infect. Immun.
70: 6770-6778
[Abstract]
[Full Text]
-
Tucker, D. L., Tucker, N., Conway, T.
(2002). Gene Expression Profiling of the pH Response in Escherichia coli. J. Bacteriol.
184: 6551-6558
[Abstract]
[Full Text]
-
Ulvatne, H., Haukland, H. H., Samuelsen, O., Kramer, M., Vorland, L. H.
(2002). Proteases in Escherichia coli and Staphylococcus aureus confer reduced susceptibility to lactoferricin B. J Antimicrob Chemother
50: 461-467
[Abstract]
[Full Text]
-
Swords, W. E., Chance, D. L., Cohn, L. A., Shao, J., Apicella, M. A., Smith, A. L.
(2002). Acylation of the Lipooligosaccharide of Haemophilus influenzae and Colonization: an htrB Mutation Diminishes the Colonization of Human Airway Epithelial Cells. Infect. Immun.
70: 4661-4668
[Abstract]
[Full Text]
-
Brodsky, I. E., Ernst, R. K., Miller, S. I., Falkow, S.
(2002). mig-14 Is a Salmonella Gene That Plays a Role in Bacterial Resistance to Antimicrobial Peptides. J. Bacteriol.
184: 3203-3213
[Abstract]
[Full Text]
-
Zhou, Z., Ribeiro, A. A., Lin, S., Cotter, R. J., Miller, S. I., Raetz, C. R. H.
(2001). Lipid A Modifications in Polymyxin-resistant Salmonella typhimurium. PMRA-DEPENDENT 4-AMINO-4-DEOXY-L-ARABINOSE, AND PHOSPHOETHANOLAMINE INCORPORATION. J. Biol. Chem.
276: 43111-43121
[Abstract]
[Full Text]
-
Trent, M. S., Ribeiro, A. A., Lin, S., Cotter, R. J., Raetz, C. R. H.
(2001). An Inner Membrane Enzyme in Salmonella and Escherichia coli That Transfers 4-Amino-4-deoxy-L-arabinose to Lipid A. INDUCTION IN POLYMYXIN-RESISTANT MUTANTS AND ROLE OF A NOVEL LIPID-LINKED DONOR. J. Biol. Chem.
276: 43122-43131
[Abstract]
[Full Text]
-
Trent, M. S., Ribeiro, A. A., Doerrler, W. T., Lin, S., Cotter, R. J., Raetz, C. R. H.
(2001). Accumulation of a Polyisoprene-linked Amino Sugar in Polymyxin-resistant Salmonella typhimurium and Escherichia coli. STRUCTURAL CHARACTERIZATION AND TRANSFER TO LIPID A IN THE PERIPLASM. J. Biol. Chem.
276: 43132-43144
[Abstract]
[Full Text]
-
Breazeale, S. D., Ribeiro, A. A., Raetz, C. R. H.
(2002). Oxidative Decarboxylation of UDP-Glucuronic Acid in Extracts of Polymyxin-resistant Escherichia coli. ORIGIN OF LIPID A SPECIES MODIFIED WITH 4-AMINO-4-DEOXY-L-ARABINOSE. J. Biol. Chem.
277: 2886-2896
[Abstract]
[Full Text]