INTRODUCTION

Top Abstract Introduction Materials and Methods Results Discussion References

Toxoplasma gondii is an obligate, intracellular parasite of warm-blooded animals. In humans, it is best known as a pathogen in the developing fetus and in immunocompromised (e.g., AIDS) patients. It is related to other members of the phylum Apicomplexa, such as Plasmodium (the cause of malaria) and Eimeria (the cause of coccidiosis).

Over the last few years, T. gondii has been actively developed as a model organism with which to study the biology of apicomplexan parasites (6). As part of this effort, a large database of expressed sequence tags (ESTs) has been generated, which led to the tentative identification of numerous Toxoplasma genes based on homology to coding regions from other organisms (1, 19, 25). Parallel efforts to sequence the genomes of Plasmodium (31) and Cryptosporidium (24, 38, 40) are also contributing to the number of apicomplexan sequences deposited in the databases. Of particular interest is a class of homologs representing genes that are unique and conserved among apicomplexan parasites (1). This group of phylogenetically restricted sequences code for proteins closely linked to the particular biology common to apicomplexans, which opens avenues for functional studies in T. gondii which would be difficult to do in a less tractable system.

Invasion of host cells by the asexual stages of apicomplexan parasites is a complex, receptor-mediated event, which is still not well understood. It involves structures of the apical complex (15), specialized surface antigens (17, 32), and products released by secretory organelles (i.e., micronemes, rhoptries, and dense granules) (7, 14, 30). While some members of this phylum, such as T. gondii, are extremely promiscuous with respect to the cell types they are able to infect, others, such as the asexual stages of Plasmodium and Eimeria, are able to selectively invade only certain specialized cells or tissues. Despite these differences in host and tissue specificity, there appears to be a significant conservation of the invasion apparatus, on the level of both ultrastructure and proteins associated with apical organelles (15, 16, 39, 41, 42). These common elements are of particular interest biologically, as they constitute the phylogenetically conserved, basic machinery for host cell invasion essential for the survival of these obligate intracellular parasites. Presumably, additional features and/or adaptations of this basic invasion apparatus have provided each species with the ability to infect its respective host(s) or host cell(s) with various degrees of specificity.

T. gondii molecules involved in the interaction with host cell receptors have been elusive, mainly because of the wide range of cells that this parasite is able to invade. Some of the relevant molecules are most likely concentrated on or at the apical surface membrane at the time of invasion and control temporally discrete events. These events include initial attachment, reorientation, triggered secretion of vesicle contents, building and translocation of the moving junction, and finally the establishment of a functional parasitophorous vacuole (5, 7, 13). Some putative players in these events have been identified by antibodies raised to proteins of apical structures (27); others have been discovered as part of the excreted-secreted fraction stored in organelles and released in a controlled fashion upon contact with the host cell (4, 37).

One of the Plasmodium proteins implicated in invasion is the apical membrane antigen (AMA1) expressed by merozoites. This is a type Ia transmembrane protein with a conserved core structure determined by 16 cysteine residues in the mature extracellular domain (20). The extracellular portion can be subdivided into three structural domains (I to III), containing six, four, and six cysteines, respectively, which form intradomain disulfide bridges (20). The Plasmodium knowlesi and Plasmodium falciparum AMA1 (PkAMA1 and PfAMA1, respectively), for example, are synthesized as proproteins of 66 and 80 kDa, respectively, in mature trophozoites and segmenting schizonts and become concentrated at the apical end of the parasites. Upon merozoite release, AMA1 is proteolytically processed and secreted as a membrane-bound protein onto the surface of free merozoites, where it distributes over the entire parasite (9, 45). While the biological function of AMA1 is still unclear, the importance of this minor antigen in the invasion of red blood cells (RBCs) by free merozoites has been shown in several studies (8, 10, 43). Monoclonal antibodies (MAbs) raised against native PkAMA1 were able to prevent invasion of rhesus RBCs in vitro (43), and immunization of mice with recombinant and refolded AMA1 or passive transfer of specific AMA1 polyclonal antibodies into Plasmodium chabaudi-infected mice prevented lethal parasitemias (2). These data point to an important role of Plasmodium AMA1 in the invasion of erythrocytes. Here, we show that T. gondii has an AMA1 homologue that is also implicated in the invasion process but localizes to the micronemes rather than the rhoptry necks, as seen with Plasmodium AMA1.

	MATERIALS AND METHODS

Top Abstract Introduction Materials and Methods Results Discussion References

Parasites and cultivation. Tachyzoites of the representative T. gondii strains RH (36), ME49 (21), and CEP (34) were grown in monolayers of human foreskin fibroblasts (HFF) in Dulbecco's modified Eagle's medium (DMEM) supplemented with 10% Nu-serum, 2 mM glutamine and gentamicin (20 µg/ml) at 37°C in a humid 5% CO₂ atmosphere.

Library searches and nucleic acid techniques. Assembly of sequences and homology searches of the Toxoplasma EST databases have been described (1, 19, 25). Complete descriptions of the databases can be found at the Genome Web sites (http://www.ebi.ac.uk/parasites/toxo/toxopage.html and http://cbil.humgen.upenn.edu/toxodb/toxodb.html). TgAMA1 ESTs were identified by searching the GenBank database with Toxoplasma EST sequences using BLASTX at NCBI (http://www.ncbi.nlm.nih.gov) and assembled into a single nucleotide sequence contig with the assembly program of the Wisconsin Package version 9.0 (Genetics Computer Group, Madison, Wis.). The ZapII insert TgESTzy99b08.r1, containing a full-length cDNA of TgAMA1 from strain ME49, was obtained from the Washington University-Merck Toxoplasma EST repository via David Sibley (St. Louis, Mo.). The insert was excised for further sequencing as pBluescript SKII using the Stratagene ExAssist helper phage according to the manufacturer's protocol.

Southern blot. Genomic DNA was obtained from RH strain tachyzoites lysed in a Tris-EDTA-LiCl-Triton buffer (26). The DNA was digested overnight with NheI, KpnI, HindIII, EcoRI, or BglII, separated through a 0.9% agarose gel, and transferred to a Nytran membrane through capillary action. The membrane was probed with a 600-bp AMA1 promoter fragment labeled by random priming with [-³²P]dGTP. After autoradiography, the membrane was stripped and reprobed with a 1,600-bp AMA1 C-terminal open reading frame (ORF) fragment, also labeled by random priming with [-³²P]dGTP.

Northern blot. Total RNA was prepared from tachyzoites with Ultraspec as directed by the manufacturer (Biotecx Laboratories). Poly(A)-enriched RNA was derived from the total RNA preparation using the Oligotex mRNA kit (Qiagen, Valencia, Calif.). The RNA was then size fractionated in a 1.0% agarose gel and transferred through capillary action to a Zeta-Probe membrane (Bio-Rad Laboratories, Hercules, Calif.). The membrane was probed sequentially with the 5' and 3' AMA1 fragments described above.

Oligonucleotide primers. The oligonucleotides used included LF-S (AGTGAATTCGTCGACCTTGGACAAGACA), LF-AS (TGAGGATCCTTAGTCGGCCGTGCACTGAAGT), SF-S (ATCGAATTCTGCGCCGAGTTTGCCTTTAAGA), SF-AS (TGAGGATCCTTAACTCCCCGCTGCTGTATACGA), CF-S (CGTGAATTCGCGAAGAGGTTGGACAGA), CF-AS (CGTGGATCCTTAGTAATCCCCCTCGACCATAACA), dTAP (CCGGAATTCGGTACCTCTAGAT₁₈VN), AP (CCGGAATTCGGTACCTCTAGA), CSEQ-S (ATGGGGCTCGTGGGCGTA), CSEQ-AS (GTAGTAATCCCCATCGACCA), AMAKOS (CGAAGCTTGGGACTCAGCTCAAGCACA), AMAKOAS (GCGGCCGCTACGGAATCGCTGTTCT), AMAKOUS1 (GGGCGAGGTCAGCAGATGT), AMAKOUAS (GCGGACAGGCGTAGTAACT), 3DHFRS (GCCATTCATGCCAGTCAGT), KOUS3 (TCCGGCCAAATACATTAAATC), 5DHFRA (GAACAGCAGCAAGATCGGAT), KODAS (ACATAATGTCAACAGCGTAAG), and AMAG (GCCCCATGTGCTTCGTCTCA).

Generation of fusion proteins. Three constructs, long (LF), short (SF), and cytosolic (CF), for production of fusion proteins were generated in the pMal-P2 system (New England Biolabs). The fragments were amplified from TgAMA1 cDNA from strain RH using the primer pairs LF-S and LF-AS, SF-S and SF-AS, and CF-S and CF-AS. The primers were designed with EcoRI (sense) and BamHI (antisense) restriction sites for cloning into the respective sites of the expression vector, downstream of the maltose-binding protein (MBP) gene, giving rise to fusion genes MBP-LF, MBP-SF, and MBP-CF. MBP-LF contained a region corresponding to domains I and II of the ectodomain from Val-69 to Asp-410. MBP-SF covered domain I, starting at the second cysteine (Cys-166) and extending through domain II to Asp-379. MBP-CF contained the COOH-terminal 62-amino-acid stretch corresponding to the presumed cytoplasmic domain from Ala-479 to Tyr-541. Bacterial overexpression was induced using 0.5 mM IPTG (isopropyl--D-thiogalactopyranoside) for 2 h at 37°C, and fusion proteins were purified from bacterial cold shock lysates on amylose resin according to standard protocols (35) and lyophilized as previously described (18).

Peptide synthesis. Two peptides corresponding to Ser-21 through Ser-36, starting at the predicted cleavage site of the signal sequence (N-pep: NH-S-G-L-S-S-S-T-R-S-R-E-S-Q-T-L-S-C-COOH) and from the cytoplasmic tail region Gln-489 through lysine 505 (C-pep: NH-C-Y-Q-A-A-H-H-E-H-E-F-Q-S-D-R-G-A-R-K-COOH) of TgAMA1 were synthesized and coupled to keyhole limpet hemocyanin (KLH).

Generation of polyclonal antibodies. BALB/c mice were immunized intraperitoneally on days 0, 15, and 30 with approximately 50 µg of fusion protein or KLH-coupled peptide resuspended in 100 µl of phosphate-buffered saline (PBS) and emulsified with an equal volume of RIBI adjuvant (RIBI Immunochem Research Inc., Hamilton, Mont.). Blood was collected prior to initial immunization and after each boost from the tail vein, and the serum fraction was assayed for specific antibody content.

MAb production. Splenocytes were harvested from an adult BALB/c mouse 3 days after boosting with the AMA1 cytoplasmic tail peptide conjugated to KLH. The splenocytes were fused to P3x63Ag8.653 myeloma cells at a 5:1 ratio, and hybridomas were selected in DMEM containing hypoxanthine-aminopterin-thymidine. Tissue culture supernatants were screened for AMA1 reactivity by Western blot using strips derived from a sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE) gel of reduced parasite lysate. From this screen, one AMA1 cytoplasmic tail-specific hybridoma was obtained, CL22 (immunoglobulin G2A [IgG2A]).

Inhibition of invasion. Briefly, tachyzoites of the RH strain were pretreated for 30 min at 37°C with heat-inactivated antiserum obtained from mice immunized with MBP-AMA1 fusion proteins or with normal mouse serum. Pretreated tachyzoites were added to HFF monolayers in 24-well plates in duplicate. After a 1-h incubation period at 37°C, unbound tachyzoites were washed off the monolayers. The number of cell-associated tachyzoites was assessed microscopically after fixation or by tritiated uracil incorporation as previously described (33).

Protein analysis. Total lysates were prepared from extracellular tachyzoites in SDS-PAGE sample buffer under reducing conditions. Analytical SDS-PAGE and transfer of proteins to nitrocellulose membranes were performed according to standard protocols (3). Filters were blocked in 5% dry milk-0.5% Tween 20-PBS and incubated with antisera or MAbs diluted in blocking solution. Bound antibodies were detected with horseradish peroxidase-conjugated goat anti-mouse IgG and developed using enhanced chemiluminescence (ECL; Amersham).

Secretion assays. Culture supernatants containing secreted protein were prepared by washing freshly lysed tachyzoites twice in RPMI without serum and incubating the parasites at a density of 10⁸/ml in this solution for 5 min to 1 h at 37°C. Cells were cooled on ice, pelleted by centrifugation at 1,000 × g, and lysed in 200 µl of reducing SDS-PAGE sample buffer. The supernatant was recentrifuged under the same conditions and again at 14,000 × g for 30 min (4°C). The cleared supernatant was lyophilized in 200-µl aliquots and dissolved in 100 µl of reducing SDS-PAGE sample buffer. Approximately 10 µl of each fraction was separated on SDS-PAGE and blotted as described above.

Subcellular fractionation. Fractionation of T. gondii (RH strain) was carried out essentially as described (22). Briefly, parasites were lysed in a Stansted cell disruptor in SMDI (250 mM sucrose, 20 mM MOPS [morpholinepropanesulfonic acid, pH 7.2], 2 mM dithiothreitol [DTT], 5 µg of leupeptin per ml, and 1 mM phenylmethylsulfonyl fluoride [PMSF]). Unbroken cells and debris were pelleted at 500 × g for 15 min in a clinical centrifuge. The supernatant was spun for 25 min at 25,000 × g to obtain a high-speed pellet containing organelles, which were subsequently separated on a 30% Percoll gradient. Three fractions were collected: a top band previously described as containing tachyzoite "ghosts," a middle fraction enriched in micronemes, and a bottom band containing rhoptries and dense granules. The three fractions were centrifuged at 100,000 × g for 90 min, and the organelles were collected from the top of the sedimented Percoll, resuspended in an equal volume of SMDI, and separated by SDS-PAGE. Proteins were transferred to nitrocellulose by a wet electrophoretic technique. Western blots were probed with MAbs using either a 1:50 dilution of tissue culture supernatant or a 1:1,000 to 1:2,000 dilution of ascites fluid in PBS. The T. gondii-specific MAbs used included MAbs against AMA1 (CL22), MIC2 (6D10) (44), ROP2, ROP3, and ROP4 (T34A7) (22), and GRA3 (2H11) (23).

Immunofluorescence assay. Live tachyzoites were prepared for indirect surface immunofluorescence as described previously (18). Cell integrity was monitored by labeling with anti-ROP1 and anti-MIC2 antibodies. For analysis of intracellular parasites, infected fibroblasts grown on glass coverslips were washed in PBS, fixed in cold 2% formaldehyde, and permeabilized with 0.5% Triton X-100 in PBS (PBS-T) for 20 min. Blocking and incubations with diluted antisera or secondary antibodies were done according to standard methods in 2% bovine serum albumin in PBS-T, and coverslips were washed in PBS between incubations with antibody. Labeled cells were embedded with Vectashield (Vector Laboratories) solution for microscopy.

Immunoelectron microscopy. Immunoelectron microscopy was performed on ultrathin cryosections. A tachyzoite-infected Vero cell monolayer was fixed with 4% paraformaldehyde-0.05% glutaraldehyde in 0.2 M sodium phosphate buffer for 90 min, then washed in PBS containing 10% fetal calf serum (PBS-FCS), and infused in 2.3 M sucrose containing 10% polyvinylpyrrolidone prior to freezing in liquid nitrogen. Sections were obtained on an FCS cryoattachment-equipped Leica Ultracut operating at 100°C. Sections were floated successively on PBS-FCS, mouse MBP-SF antiserum diluted 1:20 in PBS-FCS, anti-mouse IgG rabbit serum diluted 1:400 in PBS-FCS, 8-nm protein A-gold diluted in PBS to an optical density at 525 nm (OD₅₂₅) of 0.05, with five 3-min washings in PBS between each step. Sections were then embedded in methylcellulose (2%)-uranyl acetate (0.4%) and observed with a Philips EM 420 electron microscope.

AMA1 knockout. An AMA1 knockout vector was constructed by insertion of AMA1 flanking sequences on either side of a hypoxanthine-xanthine-guanine phosphoribosyltransferase (HXGPRT) expression cassette in pBluescript (12). Briefly, a 1-kb upstream AMA1 fragment and a 4.5-kb downstream AMA1 fragment were obtained by PCR from a genomic DNA template and cloned into polylinker sites adjacent to the dihydrofolate reductase (DHFR) 5' untranslated region (UTR) and 3' UTR so that the AMA1 and HXGPRT sequences sat in the reverse orientation. Specifically, the 4.5-kb AMA1 downstream fragment was amplified by PCR with the AMAKOS and AMAKOAS primers, whereas the 1.0-kb AMA1 upstream fragment was amplified by PCR with the AMAKOUS1 and AMAKOUAS primers. Both PCR fragments were shuttled into pCR2.1-Topo (Invitrogen) prior to insertion adjacent to the HXGPRT expression cassette. Thus, the HXGPRT expression cassette replaces (in opposite orientation) the AMA1 promoter, start codon, and signal peptide. Approximately 50 µg of the AMA1 knock-out plasmid was linearized with NotI prior to electroporation into RH strain tachyzoites lacking HXGPRT. After 24 h, transformants were selected with 100 µg of mycophenolic acid and 50 µg of xanthine per ml of RPMI containing 10% FCS. On day 18 posttransfection, tachyzoites were cloned from the drug-resistant population. Genomic DNA was isolated from 80 distinct drug-resistant clones as well as the drug-resistant population to determine whether targeted disruption of AMA1 had occurred. Homologous recombination upstream of AMA1 was analyzed by PCR using a DHFR 3' UTR sense primer (3DHFRS) and an AMA1 primer (KOUS3), which anneals to a region beyond that included in the knockout vector. Similarly, homologous recombination downstream of AMA1 was analyzed by PCR using a DHFR 5' UTR antisense primer (5DHFRA) and an AMA1 primer which anneals to a region beyond that included in the knockout vector (KODAS). Interruption of the AMA1 ORF was monitored by PCR using AMA1-specific primers KOUS3 and AMAG. The latter primer anneals to a segment of the AMA1 ORF not present in the knockout vector. Southern blot analyses were also done on a subset of the drug-resistant clones as described above, in order to confirm the results obtained by PCR.

	RESULTS

Top Abstract Introduction Materials and Methods Results Discussion References

AMA1 is a conserved protein in Plasmodium and Toxoplasma. BLASTX analysis of the Toxoplasma EST database revealed a clear homologue of Plasmodium AMA1 represented by three ESTs. The complete nucleotide sequence of this Toxoplasma homologue (TgAMA1) was determined from clone TgEST zy99b08.r1 containing an insert of 2,507 bp (GenBank accession number AF010264). The source of the cDNA was a library made from mRNA of strain ME49 tachyzoites (1). A single ORF from nucleotide (nt) 52 to nt 1677 codes for a 541-amino-acid (aa) protein with a predicted molecular mass of ~60 kDa and a theoretical pI of 5.47. Upstream and downstream AMA1 gene fragments were obtained by inverse PCR using AMA1-specific primers and an EcoRV-digested, circularized genomic DNA template. The complete sequence of the PCR-amplified AMA1 gene was acquired by primer walking. This revealed seven introns within the AMA1 coding region, ranging from 240 to 702 bp in length. The genome organization is shown schematically in Fig. 1A. A hydrophobicity plot shows an N-terminal hydrophobic region, which is identified by the program PSORT as a signal sequence with a predicted cleavage site between Ala-20 and Ser-21. After cleavage of the signal sequence, the calculated molecular mass of the mature protein is 57.9 kDa. A putative hydrophobic membrane-spanning region was identified between Ala-456 and Leu-472. The overall arrangement of these elements in TgAMA1 as well as in the Plasmodium homologues is indicative of a type Ia membrane protein (Fig. 1B), with the COOH-terminal 69 aa (Glu-473 to Tyr-541) constituting a presumptive cytoplasmic tail.

View larger version (33K): [in this window] [in a new window]   FIG. 1.   (A) To-scale graphic depiction of the TgAMA1 gene locus, depicting exon (black boxes) and intron segments. Black line, noncoding genomic sequence. (B) Graphic representation of the predicted full-length TgAMA1 protein (GenBank accession number AF010264). Black boxes, hydrophobic sequences. Cysteines are represented by vertical lines. Domains I, II, and III are defined by analogy to those described by Hodder et al. (20) for the P. knowlesi AMA1 ectodomain. (C) Southern blot analysis. Genomic DNA from RH tachyzoites was isolated and digested overnight with NheI (N), KpnI (K), HindIII (H), EcoRI (R), or BglII (B). The DNA was resolved by agarose gel electrophoresis, and blots were probed sequentially with a 600-bp AMA1 5' probe and a 1,200-bp AMA1 3' probe. The migration of size markers is indicated (in kilobases).

View larger version (82K): [in this window] [in a new window]   FIG. 2.   Multiple alignment of AMA1 amino acid sequences from P. berghei, P. yoelii, P. chabaudi, P. knowlesi, P. vivax, and P. falciparum, and TgAMA1. Identical residues in four or more of the seven sequences are boxed. Gaps inserted to optimize alignments are represented by dashes.

TgAMA1 is expressed in tachyzoites of T. gondii. To derive specific antisera against TgAMA1, three TgAMA1 fragments were expressed as fusions with MBP in Escherichia coli. MBP-LF (long fragment) contained a region corresponding to domains I and II of the ectodomain, from Val-69 to Asp-410. MBP-SF (short fragment) covered domain I, starting at the second cysteine (Cys-166) but excluding the highly conserved region and extending through domain II to Asp-379. MBP-CF (cytosolic fragment) contained the COOH-terminal 62 aa, corresponding to the presumed cytoplasmic domain from Ala-479 to Tyr-541. Antiserum to MBP-LF detected a single strong band migrating at ~65 kDa in Western blots of total lysates or Triton X-100 extracts from RH tachyzoites separated on reducing SDS-PAGE (Fig. 3A). Identical results were obtained for the two other reference strains (ME49 and CEP) and when antibodies to MBP-SF and MBP-CF were used (data not shown).

View larger version (66K): [in this window] [in a new window]   FIG. 3.   Western blot strips of parasite-associated TgAMA1 separated on SDS-PAGE. (A) Triton X-100 extracts of RH strain tachyzoites incubated with mouse polyclonal antibodies raised against MBP-LF (LF) or preimmune serum (PI). (B) Reactivity of C-pep (C) and N-pep (N) antibodies with tachyzoite extracts separated on SDS-PAGE gels. A putative precursor band, detected with anti-N-pep, is indicated by an arrow. The migration of size markers is indicated (in kilodaltons).

TgAMA1 is a microneme protein and relocalizes to the surface membrane upon egress of tachyzoites from the parasitophorous vacuole. To localize TgAMA1 in T. gondii, immunofluorescence studies using antisera against fusion proteins and peptides were performed on native extracellular or fixed and detergent-permeabilized intracellular and extracellular parasites. With fixed, permeabilized intracellular parasites, MBP-SF antiserum gave a crescent-shaped pattern at the anterior end of the cell (Fig. 4A and B). For fixed but unpermeabilized extracellular tachyzoites, the staining pattern was clearly distinct from that of intracellular parasites, showing a concentrated surface fluorescence of the apical half of the parasites, with a weak, circumferential staining posterior to this (Fig. 4C and D). Thus, the comparison of parasite surface and intracellular signals obtained with antiserum to the MBP-SF fusion protein shows an apparent redistribution of TgAMA1 subsequent to release of tachyzoites from the parasitophorous vacuole.

View larger version (83K): [in this window] [in a new window]   FIG. 4.   Immunofluorescence localization of TgAMA1 in T. gondii tachyzoites. (A, C, E, and G) Phase-contrast images; (B, D, F, and H) corresponding immunofluorescence images. (A and B) Formaldehyde-fixed and detergent-permeabilized intracellular parasites treated with MBP-SF antiserum. (C and D) Fixed and nonpermeabilized extracellular tachyzoites labeled with MBP-SF antiserum, showing apical localization of TgAMA1 on the surface of intact cells, with distinct circumferential staining. (E and F) Permeabilized intracellular tachyzoites incubated with N-pep antiserum, showing distinct perinuclear staining in addition to the subpellicular apical signal. (G and H) N-pep antiserum labeled mostly a small area at the conoid of extracellular parasites not treated with detergent.

View larger version (104K): [in this window] [in a new window]   FIG. 5.   Immunofluorescence localization of TgAMA1 in intracellular tachyzoites detected with the mouse MAb CL22 (A) and MIC2 detected with a rabbit polyclonal antiserum using intracellular tachyzoites that had been fixed and permeabilized (B). The merged image shows colocalization in large areas of overlap of the two signals (C). The corresponding phase-contrast image is depicted in panel D. (E) Localization of TgAMA1 by immunoelectron microscopy; intracellular tachyzoite section was labeled with MBP-SF antiserum. M, micronemes; R, rhoptries; D, dense granules. Immunogold staining of TgAMA1 in micronemes is marked with arrows. Bar, 0.2 µm.

View larger version (61K): [in this window] [in a new window]   FIG. 6.   Western blot of intracellular organelles from T. gondii fractionated on a Percoll gradient. Lane 1, lysed cells; lane 2, top fraction containing tachyzoite ghosts; lane 3, middle fraction enriched in micronemes; lane 4, bottom fraction containing rhoptries and dense granules. Blots were probed with MAbs to organellar proteins AMA1 (CL22), MIC2 (6D10), ROP2, ROP3, ROP4 (T34A7), and GRA3 (2H11). The migration of size markers is indicated (in kilodaltons).

TgAMA1 is secreted as a lower-molecular-weight form. Shedding of lower-molecular-weight forms (Pk42/44) of PkAMA1(PK66) into the culture supernatant has been reported for free P. knowlesi merozoites prior to and during invasion of RBCs (11). Large amounts of a soluble lower-molecular-weight form of TgAMA1 were also found in the excreted-secreted fraction after incubation of extracellular tachyzoites in serum-free medium. In Western blots of this fraction collected at different time points, a single ~54-kDa soluble fragment, sTgAMA1, was detected with antibodies to MBP-LF (Fig. 7). The stable fragment was first detected after 10 to 20 min of incubation and rapidly increased in concentration over the course of the incubation. Detectable amounts of the 54-kDa soluble form could not be found associated with free parasites (Fig. 7, pellet fractions). Western blots of secreted material and the corresponding parasite lysates were probed with the C-pep antibodies. The C-pep antiserum labeled the ~65-kDa forms in total lysates, but did not react with sTgAMA1 (data not shown). From these results and the observed size difference of approximately 10 kDa between the membrane-associated and soluble forms of TgAMA1, we propose that sTgAMA1 is the product of a proteolytic cleavage in domain III (i.e., in the ectodomain but relatively close to the transmembrane region).

View larger version (20K): [in this window] [in a new window]   FIG. 7.   Secretion assay. Washed parasites were incubated in serum-free RPMI medium at 37°C. Excreted-secreted fractions (S) collected at 0, 5, 10, 20, 30, and 60 min of incubation of extracellular tachyzoites in serum-free medium and corresponding cell pellets (P) were separated on SDS-10% PAGE. Detection of membrane-bound TgAMA1 and secreted TgAMA1 was done with MBP-LF antibodies and subsequent incubation with peroxidase-conjugated goat anti-mouse Ig secondary antibodies.

TgAMA1 is involved in host cell invasion and may be an essential protein. To investigate the function of TgAMA1, we tested the ability of mouse antibodies produced against fusion proteins to inhibit invasion of HFF by extracellular parasites. Tachyzoites were treated with the AMA1-reactive antiserum or pooled normal mouse serum prior to infection of an HFF monolayer. The number of parasites found associated with host cells was assessed microscopically. Coating parasites with the MBP-LF serum reduced the number of cell-associated tachyzoites by ~35 to 75% compared to control serum-coated parasites (data not shown). Precise quantitation of the inhibitory effect of the antiserum is difficult with this assay, so the more quantitative uracil incorporation assay was also done. Antisera obtained from two mice immunized with MBP-LF reproducibly inhibited invasion by ~40% (Fig. 8). This effect does not appear to be a result of antibodies to the MBP portion of the fusion protein, as antiserum from mice immunized with MBP-SF did not alter invasion by tachyzoites. As the MBP-LF protein differs from MBP-SF in containing most of the highly conserved region between His-63 and Ile-96, this segment may have an important biological role.

View larger version (48K): [in this window] [in a new window]   FIG. 8.   Antibodies against recombinant TgAMA1 inhibit infection of HFF. Invasion in the presence of different concentrations of MBP-LF antiserum from mouse 1 (black column) and mouse 2 (stippled column) and MBP-SF antiserum from mouse 3 (white column) is shown as a percentage of invasion in the presence of pooled normal mouse serum as measured by uracil incorporation. Error bars represent the standard deviation for duplicate wells.

	DISCUSSION

Top Abstract Introduction Materials and Methods Results Discussion References

In this report, we describe the cloning and characterization of TgAMA1, a Toxoplasma homologue of the Plasmodium AMA1. We show that the Toxoplasma and Plasmodium proteins are highly conserved in overall organization and, in many places, in their actual sequence. As with PfAMA1 and Plasmodium, antibodies to TgAMA1 significantly impair invasion by Toxoplasma, although to a lesser degree than seen in the Plasmodium experiments. This difference could reflect a greater redundancy in invasion mechanisms, less exposure of key epitopes, or a lower titer of the antibodies used in the Toxoplasma experiments.

TgAMA1 is processed at least once and possibly twice during its transit to the extracellular milieu. The removal of a short segment at the N terminus apparently occurs at some stage during transit to the surface. In extracellular parasites, at least, the mature ectodomain is eventually shed into the supernatant, apparently as a result of cleavage off of the surface (i.e., just N-terminal to the membrane-anchoring domain). All of these properties are analogous to the situation with PfAMA1, although there are differences in detail, as expected from the very different modes of parasite replication (endodyogeny versus schizogony).

A major difference between the Plasmodium AMA1s and TgAMA1 is in their subcellular localization in intracellular parasites: in Plasmodium, they are reported to be in the rhoptries (9, 28), whereas our data indicate a micronemal location for the Toxoplasma protein. Ward and colleagues have likewise colocalized TgAMA1 to the micronemes (11a). As the intracellular targeting of type I transmembrane proteins is typically encoded in the cytoplasmic tail (29), extensive differences in the sequence of this domain in AMA1 from the two parasites may explain the different localizations. It is also possible that the two compartments flow into one another and we are observing the protein at different stages in its trafficking from when the Plasmodium researchers localized it. There is no indication of such a flow in any other studies on rhoptry or microneme proteins, and so we consider this possibility unlikely.

We were unable to fatally disrupt the AMA1 gene in Toxoplasma. Similarly negative results have also been obtained with Plasmodium and PfAMA1 (J. Adams, personal communication). While these techniques are not routine enough in either system to make a negative result conclusive, combined with the antibody studies, they strongly suggest a critical and potentially essential role for AMA1 in parasite growth.

As yet, there are no clues to the presumptive ligands that are recognized by the extracellular and cytoplasmic domains of AMA1. The former may yield important information about host cell molecules that mediate attachment and/or invasion by the parasite. Molecules interacting with the cytoplasmic domain could include those necessary for correct targeting and/or for transducing a signal or kinetic energy from the outside to the inside of the parasite. Experiments that identify these ligands are now crucially needed.