Infection and Immunity, February 2000, p. 429-436, Vol. 68, No. 2
Department of Microbiology and Molecular
Genetics and the National Tuberculosis Center, Department of
Medicine, UMDNJ/New Jersey Medical School, Newark, New Jersey 17103
Received 26 May 1999/Returned for modification 29 July
1999/Accepted 25 October 1999
Oligopeptides play important roles in bacterial nutrition and
signaling. Using sequences from the available genome database for
Mycobacterium tuberculosis H37Rv, the oligopeptide permease operon (oppBCDA) of Mycobacterium bovis BCG was
cloned from a cosmid library. An opp mutant strain was
constructed by homologous recombination with an allele of
oppD interrupted by kanamycin and streptomycin resistance
markers. The deletion was complemented with a wild-type copy of the
opp operon. Two approaches were taken to characterize the
peptide transporter defect in this mutant strain. First, growth of
wild-type and mutant strains was monitored in media containing a wide
variety of peptides as sole source of carbon and/or nitrogen. Among 25 peptides ranging from two to six amino acids in length, none was
capable of supporting measurable growth as the sole carbon source in
either wild-type or mutant strains. The second approach exploited the
resistance of permease mutants to toxic substrates. The tripeptide
glutathione ( Mycobacteria are characterized by
long-term survival in the macrophage. Understanding this lifestyle is
crucial to answering key questions about mycobacterial pathogenesis.
The bacilli infect macrophages early in mycobacterial disease, where
they remain protected from specific and nonspecific immune responses
and many antibacterial drugs. Yet little is known about intracellular
nutrition, i.e., the sources of carbon, nitrogen, and energy and how
they are acquired.
Peptides are a valuable form of nutrients, especially for fastidious
microorganisms, and in some cases, the growth rate of an amino acid
auxotroph can be enhanced with peptides containing the required amino
acid (36). Peptide metabolism and transport has been
extensively characterized in gram-negative species such as
Escherichia coli and Salmonella typhimurium
(13, 27) and in gram-positive organisms (33, 41,
48). In particular, peptide transport and utilization have been
well studied in the fastidious organism Lactococcus lactis
(42).
Peptides often serve as sources of amino acids. Certain auxotrophic
strains of L. lactis require a functional peptide uptake system for growth on milk protein casein (42, 48).
Auxotrophic mutants of Listeria monocytogenes, an
intracellular pathogen, were examined for growth in cell culture and
virulence in mice. In culture, threonine auxotrophs grow poorly on free
threonine and quite well on threonine-containing peptides. These
auxotrophs showed no difference in growth rate within threonine-starved
J774 macrophages, suggesting that threonine-containing peptides are available for intracytoplasmic growth (26).
Nutrient uptake is crucial in the intracellular survival of bacteria
since some nutrients may be severely limited during some stages or
compartments of the infection pathway. For example, transport of
glutamine was investigated in the intracellular parasite S. typhimurium, i.e., a strain with mutations in both synthesis and
high-affinity transport of glutamine was attenuated for survival in
macrophages, whereas either mutation alone had no effect
(18). These results point to the limited accessibility of
this amino acid in the intracellular environment. A gene encoding an
arginine permease is upregulated during infection of L. monocytogenes (17). These experiments suggest that
transport plays a crucial role in the control or maintenance of
intracellular metabolism.
The most common peptide transporters found among the bacteria are
binding protein-dependent permeases. These multicomponent transport
systems use directly a high-energy phosphate bond during transport. The
actions of up to five proteins contribute to the process:
extracytoplasmic binding of the substrate, transfer to one or two
membrane-bound permeases for translocation across the cytoplasmic
membrane, and ATP hydrolysis by one or two proteins located on the
cytoplasmic side of the membrane (47). The energy-requiring step is the hydrolysis of ATP by the ATP-binding subunit: a
conformational change is then transmitted to the membrane-bound
components that mediate passage through the membrane. The components of
these systems are closely related members of the larger structural
superfamily called the "ABC (ATP-binding cassette) transporters"
(12).
The genomic sequence of the virulent laboratory strain H37Rv of
Mycobacterium tuberculosis reveals the presence of two
peptide permease operons homologous to dipeptide (dpp) and
oligopeptide (opp) permeases of other organisms
(7). In this study, the isolation and characterization of a
mutant of BCG lacking a fully functional oligopeptide permease
(opp) is described. The mutant was constructed by homologous
recombination of a copy of a peptide permease gene (oppD)
interrupted by a selectable marker onto the BCG chromosome.
Analysis of the phenotypes of peptide permease mutants is often
difficult due to the presence of more than one permease with overlapping specificities. In addition, the lack of availability of
radiolabeled peptides makes kinetic analysis difficult and costly.
Toxic peptides are useful tools for the selection and characterization
of peptide permeation mutants. Here, glutathione ( Bacterial strains and plasmids.
E. coli strains HB101,
DH5 Media, antibiotics, and growth conditions.
Middlebrook 7H9
(liquid) and 7H11 (agar) media (Difco) supplemented with glycerol
(0.5%) and Tween 80 (0.05%) (Sigma Chemicals) were used for selection
and maintenance of BCG ("rich medium"). When used as the sole
carbon source, amino acids and oligopeptides were obtained from Sigma.
These supplements were included in minimal medium (basal salts) or
Sauton's without added L-asparagine at the concentrations
given in the legends to the figures (8). Ampicillin was used
at a concentration of 50 µg/ml. Kanamycin (Sigma) and streptomycin
(Sigma) were used at concentrations of 50 and 100 µg/ml
(respectively) for E. coli and at 20 µg/ml (both) for BCG.
GSNO was obtained from Alexis Corporation (San Diego, Calif.) and was
>98% pure, as confirmed by thin-layer chromatography (TLC)
(acetonitrile-n-butanol-toluene-acetic acid-water
[1:1:1:1:1]).
Peptides tested for utilization by BCG.
The following
peptides were tested as the sole source of carbon and/or nitrogen (all
amino acids are L enantiomers unless otherwise indicated):
Ala-Ala, Ala-Ala-Ala, Ala-Glu, Ala-His, B-Ala-His, Asp-Asp, Asp-Ala,
Asp-Asp-Asp, Asp-Asp-Asp-Asp, Glu-Ala, Ala-Gly-Gly,
DL-Ala-DL-Leu-Gly, His-Ala, Leu-Phe, Phe-Val,
Val-Phe, Phe-Leu, Leu-Leu, Phe-Phe, Gly-Tyr, Gly-His, Orn-Orn-Orn,
Leu-Leu-Leu, and Phe-Phe-Phe. The media used were Basal Salts
(8) and Sauton's medium (without amino acids), supplemented
with 1/10 the standard amount of A(D)C, omitting the glucose of ADC
when the peptide was being tested as the sole carbon source. No
background growth was detected in basal medium containing ADC as the
carbon and/or nitrogen source.
Construction of BCG deletion strain.
Homologous
recombination of a cloned and interrupted copy of the opp
operon was performed. Oligonucleotide primers (forward, ACTCGATGTCTCCATTCAGG; reverse, ATATCGAGTCTGCGTCCAGG)
amplifying sequences in oppC were used to identify a
cosmid containing opp sequences from a genomic library of
BCG constructed in pYUB18 (14). A 4.5-kb EcoRI
fragment of DNA encompassing part of the opp operon (Rv1280c
to Rv1283c) was cloned from a BCG cosmid library in pYUB18
(14) and inserted into pGEM (see Fig. 1). oppD
was interrupted at the ClaI site with a 3.4-kb
Kanr-Strr antibiotic cassette (pSM240, kindly
provided by I. Smith) to make pRG6. This plasmid was linearized with
SacI. The construct afforded 3 kb of direct homology on
either side of the antibiotic selection marker. Then, 5 to 10 µg was
repeatedly transformed into wild-type BCG (Pasteur) with a typical
yield of one to five colonies per microgram of linearized DNA. A total
of 45 Kanr-Strr colonies were obtained. These
candidates were then screened by PCR with oligonucleotide primers
flanking the ClaI site of the Kan-Str resistance marker
insertion (forward, TGGGTATCGTCGGCGAATC; reverse,
TGCAATGGTTCGGCAATCAG). Of 45 colonies screened, three strains showed amplification products consistent with allele
replacement. One of these, BCG(opp Southern blot analysis.
Genomic DNA was prepared from
wild-type BCG and BCG(opp Analysis of the toxicity of GSH and GSNO.
Mid-log cells
(optical density at 600 nm [OD600] of 0.4 to 0.6) were
diluted to OD600 of 0.1 and incubated in 24-well plates in
Middlebrook 7H9 plus glycerol, ADC, and 0.05% Tween in the presence or
absence of GSH at the concentrations indicated (see Fig. 3). After 3 days, the OD600 of the cultures was measured. A second
growth assay (see Fig. 5) was performed in 5-ml cultures containing
substrates at 2.5 mM. The OD600 was measured every 12 h for 4 days.
0019-9567/00/$04.00+0
Copyright © 2000, American Society for Microbiology. All rights reserved.
A Peptide Permease Mutant of Mycobacterium
bovis BCG Resistant to the Toxic Peptides Glutathione and
S-Nitrosoglutathione
ABSTRACT
Top
Abstract
Introduction
Materials and Methods
Results
Discussion
References
-glutamyl-L-cyteinylglycine [GSH]) is
toxic to wild-type BCG and was used successfully to characterize
peptide uptake in the opp mutant. In 2 mM GSH, growth of
the wild-type strain is inhibited, whereas the opp mutant
is resistant to concentrations as high as 10 mM. Similar results were
found with the tripeptide S-nitrosoglutathione (GSNO),
thought to be a donor of NO in mammalian cells. Using incorporation of [3H]uracil to monitor the effects of GSH and GSNO on
macromolecular synthesis in growing cells, it was demonstrated that the
opp mutant is resistant, whereas the wild type and the
mutant complemented with a wild-type copy of the operon are sensitive
to both tripeptides. In uptake measurements, incorporation of
[3H]GSH is reduced in the mutant compared with wild type
and the complemented mutant. Finally, growth of the three strains in
the tripeptides suggests that GSH is bacteriostatic, whereas GSNO is bacteriocidal.
INTRODUCTION
Top
Abstract
Introduction
Materials and Methods
Results
Discussion
References
-glutamyl-L-cyteinylglycine [GSH]) was shown to be
toxic to BCG. GSH and its toxic NO derivative,
S-nitrosoglutathione (GSNO), were used to characterize a
peptide permease mutant of BCG.
MATERIALS AND METHODS
Top
Abstract
Introduction
Materials and Methods
Results
Discussion
References
, and GM48 were used for DNA manipulation and cloning. BCG
(Pasteur) was used for all experiments and was subcultured for no more
than eight passages in succession. BCG mutant strains were created from
early-passage bacteria, expanded to large volumes, and frozen at
70°C to ensure shorter culture duration. Standard DNA manipulations
were used (25).
-19), was further
characterized by Southern analyses by using both pRG5 DNA (i.e., a
cloned copy of the region used to construct the strain, see Fig. 1) and
the Kan-Str marker (data not shown) as probes. The strain
BCG(opp-19) was used for all subsequent experimentation.
-19) and cut with
HindIII. The DNA fragments were separated on a 0.8% agarose gel and probed with the 4.5-kb EcoRI fragment
(described above) spanning Rv1280c to Rv1283c of the opp
operon. Since there is a HindIII restriction site in the
sequence of the Kan-Str marker used to interrupt the opp
region (see Fig. 1), the mutant strain DNA exhibits two bands when
probed with DNA that flanks the selectable marker's insertion site
(see Fig. 2).
Incorporation of [3H]GSH. Cells growing in Middlebrook 7H9 (plus glycerol, ADC, and 0.05% Tween) were collected at an OD600 of 0.6, washed in basal salts with 0.05% Tween, and concentrated to an OD600 of 3.0. The cell suspensions (1 ml) were warmed to 37°C with shaking. The uptake reaction was initiated by the addition of radiolabeled substrate plus unlabeled substrate at a specific activity of 4.48 µCi/µmol) and to a final concentration of 100 µM. Incorporation was terminated by removal of 0.1-ml samples at the indicated time onto filters (Whatman GF/F, 0.45-µm pore size) prewetted with basal salts. The cells were rinsed quickly (within 10 to 15 s) with three washes of 5 ml of ice-cold basal salts plus Tween 80 on a Hoeffer 10-place manifold with air vacuum. Filters with cells thereon were transferred to vials with 5 ml of scintillation fluid for the determination of radioactivity. Counts per minute were normalized to milligrams of protein per 0.1-ml aliquot for each cell suspension; the protein content was determined by Bio-Rad protein assay. Transport assays were performed three times at each time point in triplicate.
| |
RESULTS |
|---|
|
Top
Abstract
Introduction
Materials and Methods
Results
Discussion
References
|
|---|
Cloning of the opp operon of BCG encoding a binding-protein-dependent transporter. A region encoding four genes (Rv1280c to Rv1283c) is contained in the overlapping cosmids MTCY373, MTCY3H3, and MTCY50 of the Sanger database (Fig. 1) (7). The four genes encode homologs of components of an ABC (ATP binding cassette) transporter (12, 13). This class of transporter is comprised of five components, a periplasmic (or extracellular) substrate binding protein, a two-component membrane permease, and two ATP-hydrolyzing subunits. These energy-transducing proteins can be identical or encoded by different genes.
|
Interruption of genomic copy of opp in BCG. A 4.5-kb fragment of DNA spanning the oppC and oppA genes was cloned and interrupted with a Kan-Str selectable marker to construct pRG6 (Fig. 1). The selectable marker was inserted into the opp operon to interrupt the expression of oppD. The oppD gene encodes the two ATP-binding components of the transport system. In some instances, these ATP-binding components are encoded by two genes (oppD and oppF), but in the case of the M. tuberculosis H37Rv opp operon there is a single gene encoding this component. Without OppD, the transport system cannot function, since energy supplied by ATP hydrolysis would not be available (12). In addition, polar effects of the marker insertion in oppD should interrupt expression of the downstream oppA gene, the product of which binds substrate and delivers it to the inner membrane permease proteins encoded by oppB and oppC.
The plasmid pRG6 (Fig. 1) was used to construct a strain of BCG by homologous recombination. Forty-five Kanr-Strr colonies were first screened by PCR (see Materials and Methods). The products of the PCR reactions of 42 of these DNAs were comprised of two bands, one wild type and one increased by the size of the antibiotic marker: these strains were resistant to Kan and Str as a result of single crossover events and are merodiploids. Three strains showed PCR patterns consistent with allele replacement: in each, a single band of the appropriate size was present. One of these, BCG(opp-19), was used for all further studies.
The structure of the interrupted allele in BCG(opp-19)
was further examined by Southern analysis (Fig.
2). Genomic DNA from the wild type and
the mutant strain was digested with HindIII and probed
with a 4.5-kb DNA fragment representing the cloned region. The probe
hybridized to a fragment of 21 kb from genomic DNA from wild-type BCG.
The probe recognized two bands of 11 and 10 kb from genomic DNA from
the mutant strain BCG(opp-19). This doublet is due to the
presence of a HindIII site in the Kan-Str marker used to
interrupt the opp operon. This, together with the PCR data,
indicates that the Kan-Str marker had been recombined onto the
chromosome of the BCG(opp-19) mutant strain.
|
-19)(opp+), by a
single copy of the wild-type operon. The strain was expected to behave
in a manner similar to that of the wild type in the assays described below.
Peptide utilization by wild-type and
BCG(opp-19).
One method of analyzing transport of a
substrate is to examine a strain's ability to grow on the substrate as
the sole source of carbon and/or nitrogen. Historically, the
mycobacteria were thought to be capable of using peptides and proteins
for growth (39). Here, 25 di- and tripeptides (see listing
and medium composition in Materials and Methods) were tested for
utilization as sole carbon and/or sole nitrogen sources by wild-type
BCG and BCG(opp-19). None of the peptides, when supplied
as the sole source of carbon in the medium, was capable of supporting
growth of any of these strains. When supplied as the sole source of
nitrogen, a small number of peptides from among those tested could
support very poor growth. The doubling time of these cultures was in
the range of 80 to 100 h. The wild-type and mutant strains showed
no significant differences in growth ability on any of these peptides.
Sensitivity of wild type and BCG(opp-19) to the
toxic effects of GSH and GSNO.
A second method of analyzing the
phenotype of a peptide transport mutant involves the use of toxic
substrates: mutants unable to transport the substrate should be
resistant to its toxic effects. The tripeptide GSH is abundant in most
eukaryotic and many bacterial cells and is a major protectant against
oxidative stress. However, GSH is toxic to BCG. To analyze the effects
of GSH on BCG, cultures of wild-type cells growing in Middlebrook 7H9
medium (with glycerol, ADC, and 0.05% Tween) were treated with
increasing concentrations of GSH for 3 days. Figure
3 shows that the growth of BCG was
inhibited in the presence of 4 mM GSH. The oligopeptide permease mutant BCG(opp-19), however, was resistant to the toxic effects
of 4 mM GSH. At 8 mM, however, survival of both the mutant and the wild-type cells was affected.
|
-19 mutant remained unaffected. Importantly, complementation of the opp defect with a wild-type copy of
the opp operon restored sensitivity to the
opp-19 mutant.
|
-19) is resistant to this
concentration as shown in Table 2. When
the cells are exposed to 0.5 mM GSNO, there is a 10% reduction in
[3H]uracil incorporation by wild-type BCG compared to no
measurable reduction of [3H]uracil incorporation in
opp mutant cells.
|
-19) differs from its wild type parent only in the
recombination of an interrupted genomic copy of the oppD
gene. Therefore, the basis of the mutant strain's resistance to the toxic effects of GSH and GSNO may be a result of its reduced ability to
transport GSH. To examine the uptake of GSH by these BCG strains, incorporation of [3H]GSH by wild-type and mutant cells
was measured for 3 h, and the results are shown in Fig.
4. After 3 h, [3H]GSH
was incorporated into BCG(opp-19) less efficiently than in wild-type BCG. The complemented strain,
BCG(opp-19)(opp+), showed levels
of [3H]GSH incorporation restored to those of the
wild-type strain. Thus, the basis of GSH resistance exhibited by the
opp mutant is likely the result of reduced uptake of GSH or
a derivative thereof.
|
,
wild-type BCG, 
,
BCG(opp
,
BCG(oppGSH is cytostatic and GSNO is cytocidal towards BCG in liquid
culture.
Wild-type BCG, BCG(opp-19), and
BCG(opp)(opp+) were grown in
the presence of GSH and GSNO at 2.5 mM for 48 h, during which period the OD600 of the culture increased from 0.1 to 0.6. The growth of the wild type was sensitive to GSH (Fig.
5, closed triangles) during the early
stages of the experiment but showed recovery by the end of the
experiment. This is most likely due to the short half-life of GSH in
solution (37). As expected, BCG(opp-19) was
resistant to the toxic effects of GSH. The complemented mutant strain,
however, consistently showed resistance to GSH during growth, in
contrast to the sensitivity shown in the metabolic assay described
above. Overall, these growth patterns suggest that GSH has a cytostatic
effect on wild-type BCG.
|
), GSH (
), L-Cys-Gly
(
), L-Cys (
), and Gly (Peptide and amino acid components of GSH are not toxic to BCG.
The basis of GSH toxicity against BCG is not known. In S. typhimurium, GSNO itself is not transported into the cell. A
periplasmic transpeptidase encoded by the ggt gene removes
the -glutamyl moiety. The dipeptide
S-nitroso-L-cysteinylglycine is then thought to
enter the cell by the dipeptide permease (dpp) system
(10). To determine whether the dipeptide
L-Cys-Gly or its constituent amino acids were responsible
for toxicity against BCG, these components were tested in both
metabolic and growth assays. None of the components of the tripeptide
showed toxicity against BCG during growth (Fig. 5). However, Table
3 shows that treatment of wild-type and
complemented mutant cells with the dipeptide L-Cys-Gly
shows some inhibition of [3H]uracil incorporation; this
inhibition was not evident in BCG(opp-19) cells.
L-Cys alone showed equivalent but modest toxicity against all three strains (Table 4). Finally, Gly
had no effect on [3H]uracil incorporation by any of the
three strains (Table 5).
|
|
|
| |
DISCUSSION |
|---|
|
Top
Abstract
Introduction
Materials and Methods
Results
Discussion
References
|
|---|
A mutant strain of BCG was constructed in which the oppD gene was interrupted with a selectable marker. Sequence homology indicates that oppD encodes the ATPase component of a binding protein-dependent transport system. This component is positioned as a dimer of peripheral membrane proteins localized on the cytoplasmic side of the membrane. These proteins contribute no substrate specificity to the transport system; rather, they function to couple ATP hydrolysis to translocation of substrate across the membrane. Downstream of this ORF, separated by 4 bp, is the oppA homolog, the substrate binding protein. The number of binding proteins in ABC transport systems usually exceeds that of the membrane components, at ratios of as high as 30- to 50-fold, as is the case with the maltose- and histidine-binding proteins (4). The alterations in peptide uptake exhibited by the BCG opp mutant suggest that the oppD insertion exerts a polar effect on oppA gene expression as well, although this remains to be confirmed by, for example, immunodetection.
Two approaches to phenotypic characterization of the
BCG(opp) mutant were taken. Utilization of peptides as
sole source of carbon or nitrogen can be compared between the wild-type
and mutant strains. Mycobacterium smegmatis can use a wide
range of peptides to support growth (2). But wild-type BCG
was unable to grow on 25 peptides supplied as the sole carbon source,
and extremely poor growth was observed on a small number of peptides
supplied as the sole nitrogen source. The inability of BCG to grow on
peptides as the sole carbon or nitrogen source may be due to
insufficient uptake. Transport of several amino acids has been shown to
be limiting for growth in E. coli and Klebsiella
spp., and mutations resulting in increased transport of the substrate
in question can overcome the negative growth phenotype (28).
Whether the inability of BCG to utilize peptides for growth is due to
insufficient transport can be tested by overexpression of the
opp system.
A fruitful approach to the characterization of nutrient transport mutants is to examine resistance to toxic substrate analogs. Two toxic peptides commonly used with bacteria are triornithine, to which mycobacteria are entirely insensitive (N. D. Connell, unpublished data), and bialaphos (L-alanylalnylphosphothricin). Bialaphos is a tripeptide comprised of two alanine residues and a phosphothricin moiety. After transport by the opp system, bialaphos is cleaved by intracellular peptidases. The phosphothricin moiety is a glutamate analog that binds irreversibly to glutamine synthetase and kills the cell. opp mutants of B. subtilis (43) and Streptomyces coelicolor (34) are resistant to bialaphos. Mycobacteria are sensitive to bialaphos, and the opp mutant described here is fully sensitive to the drug (A. Bhatt and N. D. Connell, unpublished data). A likely interpretation of this result is that the BCG Opp characterized in this study does not transport the tripeptide bialaphos.
The tripeptide GSH, found in most living cells, was used here to
characterize the BCG(opp-19) mutant. A range of functions has been attributed to the peptide, including cofactor function, acting
as a transporter component, providing an alternative source of sulfur,
and participation in cellular processes such as DNA and protein
synthesis, regulation of enzyme activity, and membrane function. In
bacteria, GSH is found in facultative and aerobic bacteria but not in
strict anaerobes (37).
We have shown that, surprisingly, GSH is toxic to mycobacteria. Mycobacteria and other actinomycetes do not synthesize GSH. Rather, they produce mycothiol [1-D-myo-inosityl-2-(N-acetyl-L-cysteinyl)amido-2-deoxy-alpha-D-glucopyranoside; MSH] in millimolar amounts (1). MSH has been isolated from a number of mycobacterial species, including Mycobacterium smegmatis, Mycobacterium bovis, and M. tuberculosis H37Rv (1, 5, 31, 45).
The basis of the toxicity of GSH to mycobacteria is unknown and not previously reported. One possibility is that the presence of high concentrations of GSH may result in an imbalance in a bacterium containing an alternative thiol for regulating reduction/oxidation activity (i.e., mycothiol).
Interestingly, GSH is similar in structure to penicillin precursors
produced by Penicillium and Cephalosporium spp.,
and the 
-lactam form of GSH is penicillin-like. Spallholz has
hypothesized that GSH is an evolutionary precursor of antibiotics
produced by higher eukaryotes before the emergence of cellular immunity (44). Mycobacteria may possess some intrinsic sensitivity to this structure.
Nitric oxide (i.e., NO) and related reactive nitrogen intermediates are thought to be major antimicrobial agents produced during the host defense response (23, 24, 29, 30). In view of the high levels (millimolar concentrations) of GSH found in mammalian cells, the nitrosothiol GSNO is a strong candidate for an in vivo NO donor. In a genetic screen for Salmonella mutants resistant to GSNO, De Groote et al. recovered mutants with defects in dppD and dppA function (10), homologs of the two genes interrupted in the BCG mutant described here.
We have shown that GSNO is cytocidal for wild-type BCG at concentrations similar to those to which Salmonella is sensitive (1 to 2 mM). While the data demonstrate reduced uptake of both GSH and GSNO by the opp BCG mutant, the S-nitrosothiol clearly kills both mutant and wild-type cells in culture. GSH, on the other hand, is toxic only to the wild-type strain. It is possible that GSNO, but not GSH, is transported by more than one permease. Alternatively, unlike Salmonella, BCG may be sensitive to extracellular NO provided by GSNO, and transport of the nitrosothiol, either as a tri- or dipeptide, is not required for toxicity.
Note that the two methods of analysis of toxicity used ([3H] uracil incorporation, Tables 1 to 5, and growth, Fig. 5) yielded some inconsistencies in resistance levels. These are likely the result of differences between the two assays. [3H]uracil incorporation is a general evaluation of the metabolic state of the cells, since [3H]uracil is incorporated into metabolic pools, entering first RNA and later other macromolecules by degradation and reincorporation. The growth curves are a less sensitive indicator of the effects of these peptides on metabolism.
Uptake of GSNO in Salmonella and E. coli is
dependent on the ggt locus, encoding the
-glutamyltranspeptidase (GT) (46). GT transfers a
-Glu group to an acceptor amino acid or peptide, releasing the
dipeptide S-nitrosocysteinylglycine. This points to the
possibility that the NO dipeptide is the actual toxic species in the
toxicity of GSNO against Salmonella. GT activity has been described in a number of species of mycobacteria (M. smegmatis and Mycobacterium avium) (20, 40),
and two ORFs homologous to the ggt gene are present in the
Sanger database (Rv0773c and Rv2394). The latter contains a clear
lipoprotein motif, suggesting that a transpeptidase is localized at the
cell surface in mycobacteria (7).
The data in Tables 3, 4, and 5 suggest that the dipeptide L-Cys-Gly may be at least partially responsible for the toxicity of GSH, since we have demonstrated a low-level toxicity of L-Cys-Gly against BCG. The dipeptide is not active against the opp mutant. Further, the data in Table 4 suggests that L-Cys may be a toxic component of both the tri- and dipeptides. Since this amino acid enters cells by an as-yet-unidentified amino acid permease, all three strains are sensitive to its low-level toxicity. Finally, Gly has no effect on any of the three strains.
Several reports point to a crucial role of peptide transporters in microbial cell signaling and virulence. For example, di- and oligopeptide permeases were identified among a number of mutant loci affecting growth and survival of Staphylococcus aureus in multiple infection environments (9). In Borrelia spp., peptide-binding proteins of ABC-type transporters were found to be conserved those species causing Lyme disease (19). In the group A streptococci, the expression of the cysteine protease is reduced in a dipeptide permease mutant, and expression of the dpp operon is under the control of the Mga virulence regulator (38). The survival of the opp mutant of BCG in cultured, unactivated murine macrophages was unimpaired compared with its wild-type parent (data not shown). This result suggests that, in this assay, access to small peptides is not a major nutritional requirement of BCG.
In addition to the opp operon, the M. tuberculosis database contains an operon (Rv3663c to Rv3666c) homologous to the dpp operon of E. coli and B. subtilis. A tripeptide permease system (tpp) is present in enteric bacteria (3, 4) and L. lacti (11); a tpp operon has not been identified in the M. tuberculosis genome. The specificity of peptide transport systems has been established by transport studies combining single and multiple mutants, peptides, and their analogs (27, 36). The Opp of enteric bacteria transports any peptide up to six amino acids (13, 35), whereas the Opp of L. lactis is restricted to four to eight amino acids (21). The Dpp of enteric bacteria is specific for dipeptides, and the Tpp is specific for hydrophobic tripeptides (15). The data presented in this study suggest that the Opp of BCG may resemble that of E. coli and Salmonella, transporting both di- and tripeptides.
An alternative interpretation is that the opp designation assigned to this particular operon in the M. tuberculosis H37Rv database is in error and that the operon described here, spanning ORFs Rv1280c to Rv1283c, actually encodes a dipeptide permease system. This possibility is suggested by four observations. First, mutations in dpp confer resistance to GSNO in Salmonella spp. (10). Second, as mentioned earlier, two of the four genes in the opp operon of M. tuberculosis (Rv1283c and Rv1281c) show higher homology to dpp components of other species than to opp components (7). Third, unlike opp mutants of Bacillus (43) and Streptomyces (34), the BCG opp mutant described here is not resistant to the toxic tripeptide bialaphos. Fourth, the BCG opp mutant is resistant to the toxic effects of both GSH and L-Cys-Gly.
Further studies are required to understand peptide discrimination of
the mycobacterial permeases. To this end, our laboratory has cloned the
second annotated peptide permease (dpp) (Rv3663c to Rv3666c)
from BCG and is engaged in constructing two additional mutants
(dpp and a double dpp opp
mutant) to complement studies with the opp mutant
described here. Finally, construction of such mutants in M. tuberculosis, currently under way, will enable the analysis of the
role of peptide transport and metabolism in mycobacterial pathogenesis.
| |
ACKNOWLEDGMENTS |
|---|
This work was supported by Public Health Service Award NIAIDR2934436 and by the Foundation of UMDNJ.
We thank John Chan for critical reading of the manuscript; Joe Leibovich, Hieronim Jakubowski, Rosewell Coles, Achal Bhatt, Marcy Peteroy, and Jay Berger for helpful discussions; and Robert Donnelly of the Molecular Resource Facility of UMDNJ-NJMS for DNA sequencing, primers, and advice.
| |
FOOTNOTES |
|---|
* Corresponding author. Mailing address: Department of Microbiology and Molecular Genetics, UMDNJ/New Jersey Medical School, 185 South Orange Ave., Newark, NJ 07103. Phone: (973) 972-3759. Fax: (973) 972-3644. E-mail: connell{at}umdnj.edu.
Editor: V. A. Fischetti
| |
REFERENCES |
|---|
|
Top
Abstract
Introduction
Materials and Methods
Results
Discussion
References
|
|---|
| 1. |
Anderberg, S. J.,
G. L. Newton, and R. C. Fahey.
1998.
Mycothiol biosynthesis and metabolism. Cellular levels of potential intermediates in the biosynthesis and degradation of mycothiol in Mycobacterium smegmatis.
J. Biol. Chem.
273:30391-30397 |
| 2. |
Bhatt, A.,
R. Green,
R. Coles,
M. Condon, and N. D. Connell.
1998.
A mutant of Mycobacterium smegmatis defective in dipeptide transport.
J. Bacteriol.
180:6773-6775 |
| 3. | Boos, W. 1984. Binding-protein-mediated transport systems in Escherichia coli. Biochem. Soc. Trans. 12:141-146[Medline]. |
| 4. | Boos, W., and J. Lucht. 1996. Periplasmic binding protein-dependent ABC transporters, p. 1175-1209. In F. C. Neidhardt, R. Curtiss III, J. L. Ingraham, E. C. C. Lin, K. B. Low, B. Magasanik, W. S. Reznikoff, M. Riley, M. Schaechter, and H. E. Umbarger (ed.), Escherichia coli and Salmonella: cellular and molecular biology, 2nd ed., vol. 1. ASM Press, Washington, D.C. |
| 5. | Bornemann, C., M. A. Jardine, H. S. C. Spies, and D. J. Steenkamp. 1997. Biosynthesis of mycothiol: elucidation of the sequence of steps in Mycobacterium smegmatis. Biochem. J. 325:623-639. |
| 6. |
Chan, J.,
Y. Xing,
R. S. Magliozzo, and B. R. Bloom.
1992.
Killing of virulent Mycobacterium tuberculosis by reactive nitrogen intermediates produced by activated murine macrophages.
J. Exp. Med.
175:1111-1122 |
| 7. | Cole, S. T., R. Brosch, J. Parkhill, T. Garnier, C. Churcher, D. Harris, S. V. Gordon, K. Eiglmeier, S. Gas, C. E. Barry III, F. Tekaia, K. Badcock, D. Basham, D. Brown, T. Chillingworth, R. Connor, R. Davies, K. Devlin, T. Feltwell, S. Gentles, N. Hamlin, S. Holroyd, T. Hornsby, K. Jagels, B. G. Barrell, et al. 1998. Deciphering the biology of Mycobacterium tuberculosis from the complete genome sequence. Nature 393:537-544[CrossRef][Medline]. |
| 8. | Connell, N. D. 1994. Mycobacterium: isolation, maintenance, transformation and mutant selection. Methods Cell Biol. 45:107-125[Medline]. |
| 9. | Coulter, S., W. Schwan, E. Ng, M. Langhorne, H. Ritchie, S. Westbrock-Wadman, W. Hufnagle, K. Folger, A. Bayer, and C. Stover. 1998. Staphylococcus aureus genetic loci impacting growth and survival in multiple infection environments. Mol. Microbiol. 30:393-404[CrossRef][Medline]. |
| 10. |
De Groote, M. A.,
D. Granger,
Y. Xu,
G. Campbell,
R. Prince, and F. C. Fang.
1995.
Genetic and redox determinants of nitric oxide cytotoxicity in a Salmonella typhimurium model.
Proc. Natl. Acad. Sci. USA
92:6399-6403 |
| 11. | Detmers, F., E. Kunji, F. Lanfermeijer, B. Poolman, and W. Konings. 1998. Kinetics and specificity of peptide uptake by the oligopeptide transport system of Lactococcus lactis. Biochemistry 37:16671-16679[CrossRef][Medline]. |
| 12. | Higgins, C. F. 1992. ABC transporters: from microorganisms to man. Annu. Rev. Cell Biol. 8:67-113[CrossRef]. |
| 13. | Higgins, C. F., S. C. Hyde, M. M. Mimmack, U. Gileadi, D. R. Gill, and M. P. Gallagher. 1990. Binding protein-dependent transport systems. J. Bioenerg. Biomembr. 22:571-592[CrossRef][Medline]. |
| 14. | Jacobs, W. R., Jr., G. V. Kalpana, J. D. Cirillo, L. Pascopella, S. B. Snapper, R. A. Udani, W. Jones, R. G. Barletta, and B. R. Bloom. 1991. Genetic systems for mycobacteria. Methods Enzymol. 204:537-555[Medline]. |
| 15. |
Jamieson, D., and C. Higgins.
1984.
Anaerobic and leucine-dependent expression of a peptide transport gene in Salmonella typhimurium.
J. Bacteriol.
160:131-136 |
| 16. | Keshive, M., S. Singh, J. S. Wishnok, S. R. Tannenbaum, and W. M. Deen. 1996. Kinetics of S-nitrosation of thiols in nitric oxide solutions. Chem. Res. Toxicol. 9:988-993[CrossRef][Medline]. |
| 17. | Klarsfeld, A. D., P. L. Goossens, and P. Cossart. 1994. Five Listeria monocytogenes gene preferentially expressed in infected mammalian cells: plcA, purH, purD, pyrE, and an arginine ABC transporter, argJ. Mol. Microbiol. 13:585-597[Medline]. |
| 18. | Klose, K. E., and J. J. Mekalanos. 1997. Simultaneous prevention of glutamine synthesis and high-affinity transport attenuates Salmonella typhimurium virulence. Infect. Immun. 65:587-596[Abstract]. |
| 19. |
Kornacki, J. A., and D. B. Oliver.
1998.
Lyme disease-causing Borrelia species encode multiple lipoproteins homologous to peptide-binding proteins of ABC-type transporters.
Infect. Immun.
66:4115-4122 |
| 20. | Kumar, S., V. Ohja, N. K. Gangerly, and K. K. Kohli. 1990. Presence of gamma glutamyl transferase in Mycobacterium smegmatis. Biochem. Int. 20:539-548[Medline]. |
| 21. |
Kunji, E. R. S.,
E. J. Smid,
R. Plapp,
B. Poolman, and W. N. Konings.
1993.
Di-tri-peptides and oligopeptides are taken up via distinct transport mechanisms in Lactococcus lactis.
J. Bacteriol.
175:2052-2059 |
| 22. |
Lee, M. H.,
L. Pascopella,
W. R. J. Jacobs, and G. F. Hatfull.
1991.
Site-specific integration of mycobacteriophage L5: integration-proficient vectors for Mycobacterium smegmatis, BCG and M. tuberculosis.
Proc. Natl. Acad. Sci. USA
88:3111-3115 |
| 23. | MacMicking, J., Q.-W. Xie, and C. Nathan. 1997. Nitric oxide and macrophage function. Annu. Rev. Immunol. 15:323-350[CrossRef][Medline]. |
| 24. |
MacMicking, J. D.,
R. J. North,
R. LaCourse,
J. S. Mudgett,
S. K. Shah, and C. F. Nathan.
1997.
Identification of nitric oxide synthase as a protective locus against tuberculosis.
Proc. Natl. Acad. Sci. USA
94:5243-5248 |
| 25. | Maniatis, T., E. F. Fritsch, and J. Sambrook. 1982. Molecular cloning: a laboratory manual. Cold Spring Harbor Laboratory, Cold Spring Harbor, N.Y. |
| 26. |
Marquis, H.,
H. G. A. Bouwer,
D. J. Hinrichs, and D. A. Portnoy.
1993.
Intracytoplasmic growth and virulence of Listeria monocytogenes auxotrophic mutants.
Infect. Immun.
61:3756-3760 |
| 27. | Matthews, D. M., and J. W. Payne. 1980. Transmembrane transport of small peptides. Curr. Top. Membr. Transp. 14:332-409. |
| 28. | Metzer, E., and Y. Halperin. 1982. The control of GABA transport and metabolism in Escherichia coli, p. 369-378. In Y. Okada (ed.), Problems in GABA research, from brain to bacteria. Elsevier, Amsterdam, The Netherlands. |
| 29. | Nathan, C. 1995. Natural resistance and nitric oxide. Cell 82:873-876[CrossRef][Medline]. |
| 30. | Nathan, C., and J. Hibbs, Jr. 1991. Role of nitric oxide synthesis in macrophage antimicrobial activity. Curr. Opin. Immunol. 3:65-70[CrossRef][Medline]. |
| 31. |
Newton, G. L.,
K. Arnold,
M. S. Price,
C. Sherrill,
S. B. Delcardayre,
Y. Aharonowitz,
G. Cohen,
J. Davies,
R. C. Fahey, and C. Davis.
1996.
Distribution of thiols in microorganisms: mycothiol is a major thiol in most actinomycetes.
J. Bacteriol.
178:1990-1995 |
| 32. |
Nikitovic, D., and A. Holmgren.
1996.
S-Nitrosoglutathione is cleaved by the thioredoxin system with liberation of glutathione and redox regulating nitric oxide.
J. Biol. Chem.
271:19180-19185 |
| 33. |
Nodwell, J. R., and R. Losick.
1998.
Purification of an extracellular signaling molecule involved in production of aerial mycelium by Streptomyces coelicolor.
J. Bacteriol.
180:1334-1337 |
| 34. | Nodwell, J. R., K. McGovern, and R. Losick. 1996. An oligopeptide permease responsible for the import of an extracellular signal governing aerial mycelium formation in Streptomyces coelicolor. Mol. Microbiol. 22:881-893[CrossRef][Medline]. |
| 35. |
Payne, J.
1968.
Oligopeptide transport in Escherichia coli. Specificity with respect to side chain and distinction from dipeptide transport.
J. Biol. Chem.
243:3395-3403 |
| 36. |
Payne, J. W., and C. Gilvarg.
1968.
The role of the terminal carboxyl group on peptide transport in Escherichia coli.
J. Biol. Chem.
243:335-340 |
| 37. | Penninckx, M. J., and M. T. Elskens. 1993. Metabolism and function of glutathione in micro-organisms. Adv. Microb. Physiol. 34:239-301[Medline]. |
| 38. | Podbielski, A., and B. A. Leonard. 1998. The group A streptococcal dipeptide permease (Dpp) is involved in the uptake of essential amino acids and affects the expression of cysteine protease. Mol. Microbiol. 28:1323-1334[CrossRef][Medline]. |
| 39. | Ratledge, C. 1982. Nutrition, growth and metabolism, p. 186-212. In C. Ratledge, and J. Stanford (ed.), The biology of the mycobacteria, vol. I. Academic Press, London, England. |
| 40. | Shetty, K. T., N. H. Antia, and P. R. Krishnaswamy. 1981. Occurrence of gamma-glutamyl transpeptidase activity in several mycobacteria including Mycobacterium leprae. Int. J. Lepr. Other Mycobact. Dis. 49:49-56[Medline]. |
| 41. | Slack, F. J., J. P. Mueller, M. A. Strauch, C. Mathioloulos, and A. L. Sonenshein. 1991. Transcriptional regulation of a Bacillus subtilis dipeptide transport operon. Mol. Microbiol. 5:1915-1925[CrossRef][Medline]. |
| 42. | Smid, E. J., R. Plapp, and W. N. Konings. 1989. Peptide uptake is essential for growth of Lactococcus lactis on the milk protein casein. J. Bacteriol. 171:5286-5292. |
| 43. |
Solomon, J. M.,
B. A. Lazazzera, and A. D. Grossman.
1996.
Purification and characterization of an extracellular peptide factor that affects two different developmental pathways in Bacillus subtilis.
Genes Dev.
10:2014-2024 |
| 44. | Spallholz, J. 1987. Glutathione: is it an evolutionary vestige of the penicillins? Med. Hypotheses 23:253-257[CrossRef][Medline]. |
| 45. | Spies, H. S., and D. J. Steenkamp. 1994. Thiols of intracellular pathogens. Identification of ovothiol A in Leischmania donovani and structural analysis of a novel thiol from Mycobacterium bovis. Eur. J. Biochem. 224:203-213[Medline]. |
| 46. |
Suzuki, H.,
H. Kumagai,
T. Echigo, and T. Tochikura.
1989.
DNA sequence of the Escherichia coli K-12 gamma-glutamyltranspeptidase gene, ggt.
J. Bacteriol.
171:5169-5172 |
| 47. | Tam, R., and M. H. J. Saier. 1993. Structural, functional and evolutionary relationship among extracellular solute-binding receptors in bacteria. Microbiol. Rev. 57:220-246. |
| 48. | Verheul, A., A. Hagting, M. R. Amezaga, I. R. Booth, F. M. Rombouts, and T. Abee. 1995. A di- and tripeptide transport system can supply Listeria monocytogenes Scott A with amino acids essential for growth. Appl. Environ. Microbiol. 61:226-233[Abstract]. |
Infection and Immunity, February 2000, p. 429-436, Vol. 68, No. 2
0019-9567/00/$04.00+0
Copyright © 2000, American Society for Microbiology. All rights reserved.
This article has been cited by other articles:
-
Hiron, A., Borezee-Durant, E., Piard, J.-C., Juillard, V.
(2007). Only One of Four Oligopeptide Transport Systems Mediates Nitrogen Nutrition in Staphylococcus aureus. J. Bacteriol.
189: 5119-5129
[Abstract] [Full Text] -
Lee, S., Bergeron, H., Lau, P. C. K., Rosazza, J. P. N.
(2007). Thiols in Nitric Oxide Synthase-Containing Nocardia sp. Strain NRRL 5646. Appl. Environ. Microbiol.
73: 3095-3097
[Abstract] [Full Text] -
Dayaram, Y. K., Talaue, M. T., Connell, N. D., Venketaraman, V.
(2006). Characterization of a Glutathione Metabolic Mutant of Mycobacterium tuberculosis and Its Resistance to Glutathione and Nitrosoglutathione. J. Bacteriol.
188: 1364-1372
[Abstract] [Full Text] -
Baltes, N., N'diaye, M., Jacobsen, I. D., Maas, A., Buettner, F. F. R., Gerlach, G.-F.
(2005). Deletion of the Anaerobic Regulator HlyX Causes Reduced Colonization and Persistence of Actinobacillus pleuropneumoniae in the Porcine Respiratory Tract. Infect. Immun.
73: 4614-4619
[Abstract] [Full Text] -
Venketaraman, V., Dayaram, Y. K., Amin, A. G., Ngo, R., Green, R. M., Talaue, M. T., Mann, J., Connell, N. D.
(2003). Role of Glutathione in Macrophage Control of Mycobacteria. Infect. Immun.
71: 1864-1871
[Abstract] [Full Text] -
Borelli, V., Vita, F., Shankar, S., Soranzo, M. R., Banfi, E., Scialino, G., Brochetta, C., Zabucchi, G.
(2003). Human Eosinophil Peroxidase Induces Surface Alteration, Killing, and Lysis of Mycobacterium tuberculosis. Infect. Immun.
71: 605-613
[Abstract] [Full Text]
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Copyright © 2009 by the American Society for Microbiology. For an alternate route to Journals.ASM.org, visit: http://intl-journals.asm.org | More Info»