INTRODUCTION

Top Abstract Introduction Materials and Methods Results Discussion References

Mycobacteria are characterized by long-term survival in the macrophage. Understanding this lifestyle is crucial to answering key questions about mycobacterial pathogenesis. The bacilli infect macrophages early in mycobacterial disease, where they remain protected from specific and nonspecific immune responses and many antibacterial drugs. Yet little is known about intracellular nutrition, i.e., the sources of carbon, nitrogen, and energy and how they are acquired.

Peptides are a valuable form of nutrients, especially for fastidious microorganisms, and in some cases, the growth rate of an amino acid auxotroph can be enhanced with peptides containing the required amino acid (36). Peptide metabolism and transport has been extensively characterized in gram-negative species such as Escherichia coli and Salmonella typhimurium (13, 27) and in gram-positive organisms (33, 41, 48). In particular, peptide transport and utilization have been well studied in the fastidious organism Lactococcus lactis (42).

Peptides often serve as sources of amino acids. Certain auxotrophic strains of L. lactis require a functional peptide uptake system for growth on milk protein casein (42, 48). Auxotrophic mutants of Listeria monocytogenes, an intracellular pathogen, were examined for growth in cell culture and virulence in mice. In culture, threonine auxotrophs grow poorly on free threonine and quite well on threonine-containing peptides. These auxotrophs showed no difference in growth rate within threonine-starved J774 macrophages, suggesting that threonine-containing peptides are available for intracytoplasmic growth (26).

Nutrient uptake is crucial in the intracellular survival of bacteria since some nutrients may be severely limited during some stages or compartments of the infection pathway. For example, transport of glutamine was investigated in the intracellular parasite S. typhimurium, i.e., a strain with mutations in both synthesis and high-affinity transport of glutamine was attenuated for survival in macrophages, whereas either mutation alone had no effect (18). These results point to the limited accessibility of this amino acid in the intracellular environment. A gene encoding an arginine permease is upregulated during infection of L. monocytogenes (17). These experiments suggest that transport plays a crucial role in the control or maintenance of intracellular metabolism.

The most common peptide transporters found among the bacteria are binding protein-dependent permeases. These multicomponent transport systems use directly a high-energy phosphate bond during transport. The actions of up to five proteins contribute to the process: extracytoplasmic binding of the substrate, transfer to one or two membrane-bound permeases for translocation across the cytoplasmic membrane, and ATP hydrolysis by one or two proteins located on the cytoplasmic side of the membrane (47). The energy-requiring step is the hydrolysis of ATP by the ATP-binding subunit: a conformational change is then transmitted to the membrane-bound components that mediate passage through the membrane. The components of these systems are closely related members of the larger structural superfamily called the "ABC (ATP-binding cassette) transporters" (12).

The genomic sequence of the virulent laboratory strain H37Rv of Mycobacterium tuberculosis reveals the presence of two peptide permease operons homologous to dipeptide (dpp) and oligopeptide (opp) permeases of other organisms (7). In this study, the isolation and characterization of a mutant of BCG lacking a fully functional oligopeptide permease (opp) is described. The mutant was constructed by homologous recombination of a copy of a peptide permease gene (oppD) interrupted by a selectable marker onto the BCG chromosome.

Analysis of the phenotypes of peptide permease mutants is often difficult due to the presence of more than one permease with overlapping specificities. In addition, the lack of availability of radiolabeled peptides makes kinetic analysis difficult and costly. Toxic peptides are useful tools for the selection and characterization of peptide permeation mutants. Here, glutathione (-glutamyl-L-cyteinylglycine [GSH]) was shown to be toxic to BCG. GSH and its toxic NO derivative, S-nitrosoglutathione (GSNO), were used to characterize a peptide permease mutant of BCG.

	MATERIALS AND METHODS

Top Abstract Introduction Materials and Methods Results Discussion References

Bacterial strains and plasmids. E. coli strains HB101, DH5, and GM48 were used for DNA manipulation and cloning. BCG (Pasteur) was used for all experiments and was subcultured for no more than eight passages in succession. BCG mutant strains were created from early-passage bacteria, expanded to large volumes, and frozen at 70°C to ensure shorter culture duration. Standard DNA manipulations were used (25).

Media, antibiotics, and growth conditions. Middlebrook 7H9 (liquid) and 7H11 (agar) media (Difco) supplemented with glycerol (0.5%) and Tween 80 (0.05%) (Sigma Chemicals) were used for selection and maintenance of BCG ("rich medium"). When used as the sole carbon source, amino acids and oligopeptides were obtained from Sigma. These supplements were included in minimal medium (basal salts) or Sauton's without added L-asparagine at the concentrations given in the legends to the figures (8). Ampicillin was used at a concentration of 50 µg/ml. Kanamycin (Sigma) and streptomycin (Sigma) were used at concentrations of 50 and 100 µg/ml (respectively) for E. coli and at 20 µg/ml (both) for BCG. GSNO was obtained from Alexis Corporation (San Diego, Calif.) and was >98% pure, as confirmed by thin-layer chromatography (TLC) (acetonitrile-n-butanol-toluene-acetic acid-water [1:1:1:1:1]).

Peptides tested for utilization by BCG. The following peptides were tested as the sole source of carbon and/or nitrogen (all amino acids are L enantiomers unless otherwise indicated): Ala-Ala, Ala-Ala-Ala, Ala-Glu, Ala-His, B-Ala-His, Asp-Asp, Asp-Ala, Asp-Asp-Asp, Asp-Asp-Asp-Asp, Glu-Ala, Ala-Gly-Gly, DL-Ala-DL-Leu-Gly, His-Ala, Leu-Phe, Phe-Val, Val-Phe, Phe-Leu, Leu-Leu, Phe-Phe, Gly-Tyr, Gly-His, Orn-Orn-Orn, Leu-Leu-Leu, and Phe-Phe-Phe. The media used were Basal Salts (8) and Sauton's medium (without amino acids), supplemented with 1/10 the standard amount of A(D)C, omitting the glucose of ADC when the peptide was being tested as the sole carbon source. No background growth was detected in basal medium containing ADC as the carbon and/or nitrogen source.

Construction of BCG deletion strain. Homologous recombination of a cloned and interrupted copy of the opp operon was performed. Oligonucleotide primers (forward, ACTCGATGTCTCCATTCAGG; reverse, ATATCGAGTCTGCGTCCAGG) amplifying sequences in oppC were used to identify a cosmid containing opp sequences from a genomic library of BCG constructed in pYUB18 (14). A 4.5-kb EcoRI fragment of DNA encompassing part of the opp operon (Rv1280c to Rv1283c) was cloned from a BCG cosmid library in pYUB18 (14) and inserted into pGEM (see Fig. 1). oppD was interrupted at the ClaI site with a 3.4-kb Kan^r-Str^r antibiotic cassette (pSM240, kindly provided by I. Smith) to make pRG6. This plasmid was linearized with SacI. The construct afforded 3 kb of direct homology on either side of the antibiotic selection marker. Then, 5 to 10 µg was repeatedly transformed into wild-type BCG (Pasteur) with a typical yield of one to five colonies per microgram of linearized DNA. A total of 45 Kan^r-Str^r colonies were obtained. These candidates were then screened by PCR with oligonucleotide primers flanking the ClaI site of the Kan-Str resistance marker insertion (forward, TGGGTATCGTCGGCGAATC; reverse, TGCAATGGTTCGGCAATCAG). Of 45 colonies screened, three strains showed amplification products consistent with allele replacement. One of these, BCG(opp-19), was further characterized by Southern analyses by using both pRG5 DNA (i.e., a cloned copy of the region used to construct the strain, see Fig. 1) and the Kan-Str marker (data not shown) as probes. The strain BCG(opp-19) was used for all subsequent experimentation.

Southern blot analysis. Genomic DNA was prepared from wild-type BCG and BCG(opp-19) and cut with HindIII. The DNA fragments were separated on a 0.8% agarose gel and probed with the 4.5-kb EcoRI fragment (described above) spanning Rv1280c to Rv1283c of the opp operon. Since there is a HindIII restriction site in the sequence of the Kan-Str marker used to interrupt the opp region (see Fig. 1), the mutant strain DNA exhibits two bands when probed with DNA that flanks the selectable marker's insertion site (see Fig. 2).

Analysis of the toxicity of GSH and GSNO. Mid-log cells (optical density at 600 nm [OD₆₀₀] of 0.4 to 0.6) were diluted to OD₆₀₀ of 0.1 and incubated in 24-well plates in Middlebrook 7H9 plus glycerol, ADC, and 0.05% Tween in the presence or absence of GSH at the concentrations indicated (see Fig. 3). After 3 days, the OD₆₀₀ of the cultures was measured. A second growth assay (see Fig. 5) was performed in 5-ml cultures containing substrates at 2.5 mM. The OD₆₀₀ was measured every 12 h for 4 days.

Incorporation of [³H]GSH. Cells growing in Middlebrook 7H9 (plus glycerol, ADC, and 0.05% Tween) were collected at an OD₆₀₀ of 0.6, washed in basal salts with 0.05% Tween, and concentrated to an OD₆₀₀ of 3.0. The cell suspensions (1 ml) were warmed to 37°C with shaking. The uptake reaction was initiated by the addition of radiolabeled substrate plus unlabeled substrate at a specific activity of 4.48 µCi/µmol) and to a final concentration of 100 µM. Incorporation was terminated by removal of 0.1-ml samples at the indicated time onto filters (Whatman GF/F, 0.45-µm pore size) prewetted with basal salts. The cells were rinsed quickly (within 10 to 15 s) with three washes of 5 ml of ice-cold basal salts plus Tween 80 on a Hoeffer 10-place manifold with air vacuum. Filters with cells thereon were transferred to vials with 5 ml of scintillation fluid for the determination of radioactivity. Counts per minute were normalized to milligrams of protein per 0.1-ml aliquot for each cell suspension; the protein content was determined by Bio-Rad protein assay. Transport assays were performed three times at each time point in triplicate.

	RESULTS

Top Abstract Introduction Materials and Methods Results Discussion References

Cloning of the opp operon of BCG encoding a binding-protein-dependent transporter. A region encoding four genes (Rv1280c to Rv1283c) is contained in the overlapping cosmids MTCY373, MTCY3H3, and MTCY50 of the Sanger database (Fig. 1) (7). The four genes encode homologs of components of an ABC (ATP binding cassette) transporter (12, 13). This class of transporter is comprised of five components, a periplasmic (or extracellular) substrate binding protein, a two-component membrane permease, and two ATP-hydrolyzing subunits. These energy-transducing proteins can be identical or encoded by different genes.

View larger version (14K): [in this window] [in a new window]   FIG. 1.   Map of opp region in M. tuberculosis H37Rv and homologous BCG plasmids. (A) Restriction map of opp region, derived from Sanger database (7). H, HindIII; R, EcoRI; C, ClaI; N, NheI. (B) ORFs comprising the opp operon and gene assignments (oppBCDA). (C) M. tuberculosis cosmids from the Sanger database spanning the opp operon. pRG5 (uninterrupted subfragment), pRG6 (interrupted fragment), and pRG11 (complementing plasmids) are as described in Materials and Methods.

Interruption of genomic copy of opp in BCG. A 4.5-kb fragment of DNA spanning the oppC and oppA genes was cloned and interrupted with a Kan-Str selectable marker to construct pRG6 (Fig. 1). The selectable marker was inserted into the opp operon to interrupt the expression of oppD. The oppD gene encodes the two ATP-binding components of the transport system. In some instances, these ATP-binding components are encoded by two genes (oppD and oppF), but in the case of the M. tuberculosis H37Rv opp operon there is a single gene encoding this component. Without OppD, the transport system cannot function, since energy supplied by ATP hydrolysis would not be available (12). In addition, polar effects of the marker insertion in oppD should interrupt expression of the downstream oppA gene, the product of which binds substrate and delivers it to the inner membrane permease proteins encoded by oppB and oppC.

View larger version (26K): [in this window] [in a new window]   FIG. 2.   Southern analysis of genomic DNA from wild-type and (opp-19) BCG strains. DNAs from wild-type (lane A) and (opp-19) mutant (lane B) cells and plasmid DNAs from pRG5 (lane 1) and pRG6 (lane 2) were digested with HindIII and probed with the 4.5-kb fragment representing the internal cloned region from the opp operon (see Fig. 1 and Materials and Methods).

Peptide utilization by wild-type and BCG(opp-19). One method of analyzing transport of a substrate is to examine a strain's ability to grow on the substrate as the sole source of carbon and/or nitrogen. Historically, the mycobacteria were thought to be capable of using peptides and proteins for growth (39). Here, 25 di- and tripeptides (see listing and medium composition in Materials and Methods) were tested for utilization as sole carbon and/or sole nitrogen sources by wild-type BCG and BCG(opp-19). None of the peptides, when supplied as the sole source of carbon in the medium, was capable of supporting growth of any of these strains. When supplied as the sole source of nitrogen, a small number of peptides from among those tested could support very poor growth. The doubling time of these cultures was in the range of 80 to 100 h. The wild-type and mutant strains showed no significant differences in growth ability on any of these peptides.

Sensitivity of wild type and BCG(opp-19) to the toxic effects of GSH and GSNO. A second method of analyzing the phenotype of a peptide transport mutant involves the use of toxic substrates: mutants unable to transport the substrate should be resistant to its toxic effects. The tripeptide GSH is abundant in most eukaryotic and many bacterial cells and is a major protectant against oxidative stress. However, GSH is toxic to BCG. To analyze the effects of GSH on BCG, cultures of wild-type cells growing in Middlebrook 7H9 medium (with glycerol, ADC, and 0.05% Tween) were treated with increasing concentrations of GSH for 3 days. Figure 3 shows that the growth of BCG was inhibited in the presence of 4 mM GSH. The oligopeptide permease mutant BCG(opp-19), however, was resistant to the toxic effects of 4 mM GSH. At 8 mM, however, survival of both the mutant and the wild-type cells was affected.

View larger version (30K): [in this window] [in a new window]   FIG. 3.   Inhibition of growth of wild-type and (opp-19) BCG by GSH. Exponentially growing cells (OD600, 0.4 to 0.6) were diluted to an OD600 of 0.1 and incubated in 24-well plates in Middlebrook 7H9 in the presence or absence of GSH at the concentrations indicated. After 3 days, the OD600 of the cultures was measured. Black bars, wild-type BCG; hatched bars, BCG(opp-19). The experiment is representative of three similar experiments.

View larger version (16K): [in this window] [in a new window]   FIG. 4.   Uptake of [3H]GSH by wild type, BCG(opp-19), and BCG(opp-19)(opp+). Cells growing in Middlebrook 7H9 were collected at an OD600 of 0.6, washed in basal salts with 0.05% Tween, and concentrated to an OD600 of 3.0. GSH was added at a final concentration of 100 µM, with a specific activity of 4.48 µCi/µmol. Uptake is expressed as counts per minute per milligram of protein. Symbols: , wild-type BCG, , BCG(opp-19)(opp+); , BCG(opp-19). The experiment is representative of three similar experiments.

GSH is cytostatic and GSNO is cytocidal towards BCG in liquid culture. Wild-type BCG, BCG(opp-19), and BCG(opp)(opp⁺) were grown in the presence of GSH and GSNO at 2.5 mM for 48 h, during which period the OD₆₀₀ of the culture increased from 0.1 to 0.6. The growth of the wild type was sensitive to GSH (Fig. 5, closed triangles) during the early stages of the experiment but showed recovery by the end of the experiment. This is most likely due to the short half-life of GSH in solution (37). As expected, BCG(opp-19) was resistant to the toxic effects of GSH. The complemented mutant strain, however, consistently showed resistance to GSH during growth, in contrast to the sensitivity shown in the metabolic assay described above. Overall, these growth patterns suggest that GSH has a cytostatic effect on wild-type BCG.

View larger version (17K): [in this window] [in a new window]   FIG. 5.   Growth of BCG, BCG(opp-19), and BCG(opp-19)(opp+) in glutathione and related compounds. Mid-log-phase wild-type BCG (A), BCG(opp-19) (B), and BCG(opp-19)(opp+) (C) were washed and resuspended at a starting OD600 of 0.1 in complete Middlebrook 7H9 medium plus ADC and Tween 80 containing the following substrates at 2.5 mM: no addition (), L-Ala-Gly (as a control dipeptide) (), GSH (), GSNO (), L-Cys-Gly (), L-Cys (), and Gly (). The OD600 was measured every 12 h over 4 days. The experiment is representative of four similar experiments.

Peptide and amino acid components of GSH are not toxic to BCG. The basis of GSH toxicity against BCG is not known. In S. typhimurium, GSNO itself is not transported into the cell. A periplasmic transpeptidase encoded by the ggt gene removes the -glutamyl moiety. The dipeptide S-nitroso-L-cysteinylglycine is then thought to enter the cell by the dipeptide permease (dpp) system (10). To determine whether the dipeptide L-Cys-Gly or its constituent amino acids were responsible for toxicity against BCG, these components were tested in both metabolic and growth assays. None of the components of the tripeptide showed toxicity against BCG during growth (Fig. 5). However, Table 3 shows that treatment of wild-type and complemented mutant cells with the dipeptide L-Cys-Gly shows some inhibition of [³H]uracil incorporation; this inhibition was not evident in BCG(opp-19) cells. L-Cys alone showed equivalent but modest toxicity against all three strains (Table 4). Finally, Gly had no effect on [³H]uracil incorporation by any of the three strains (Table 5).

	DISCUSSION

Top Abstract Introduction Materials and Methods Results Discussion References

A mutant strain of BCG was constructed in which the oppD gene was interrupted with a selectable marker. Sequence homology indicates that oppD encodes the ATPase component of a binding protein-dependent transport system. This component is positioned as a dimer of peripheral membrane proteins localized on the cytoplasmic side of the membrane. These proteins contribute no substrate specificity to the transport system; rather, they function to couple ATP hydrolysis to translocation of substrate across the membrane. Downstream of this ORF, separated by 4 bp, is the oppA homolog, the substrate binding protein. The number of binding proteins in ABC transport systems usually exceeds that of the membrane components, at ratios of as high as 30- to 50-fold, as is the case with the maltose- and histidine-binding proteins (4). The alterations in peptide uptake exhibited by the BCG opp mutant suggest that the oppD insertion exerts a polar effect on oppA gene expression as well, although this remains to be confirmed by, for example, immunodetection.

Two approaches to phenotypic characterization of the BCG(opp) mutant were taken. Utilization of peptides as sole source of carbon or nitrogen can be compared between the wild-type and mutant strains. Mycobacterium smegmatis can use a wide range of peptides to support growth (2). But wild-type BCG was unable to grow on 25 peptides supplied as the sole carbon source, and extremely poor growth was observed on a small number of peptides supplied as the sole nitrogen source. The inability of BCG to grow on peptides as the sole carbon or nitrogen source may be due to insufficient uptake. Transport of several amino acids has been shown to be limiting for growth in E. coli and Klebsiella spp., and mutations resulting in increased transport of the substrate in question can overcome the negative growth phenotype (28). Whether the inability of BCG to utilize peptides for growth is due to insufficient transport can be tested by overexpression of the opp system.

A fruitful approach to the characterization of nutrient transport mutants is to examine resistance to toxic substrate analogs. Two toxic peptides commonly used with bacteria are triornithine, to which mycobacteria are entirely insensitive (N. D. Connell, unpublished data), and bialaphos (L-alanylalnylphosphothricin). Bialaphos is a tripeptide comprised of two alanine residues and a phosphothricin moiety. After transport by the opp system, bialaphos is cleaved by intracellular peptidases. The phosphothricin moiety is a glutamate analog that binds irreversibly to glutamine synthetase and kills the cell. opp mutants of B. subtilis (43) and Streptomyces coelicolor (34) are resistant to bialaphos. Mycobacteria are sensitive to bialaphos, and the opp mutant described here is fully sensitive to the drug (A. Bhatt and N. D. Connell, unpublished data). A likely interpretation of this result is that the BCG Opp characterized in this study does not transport the tripeptide bialaphos.

The tripeptide GSH, found in most living cells, was used here to characterize the BCG(opp-19) mutant. A range of functions has been attributed to the peptide, including cofactor function, acting as a transporter component, providing an alternative source of sulfur, and participation in cellular processes such as DNA and protein synthesis, regulation of enzyme activity, and membrane function. In bacteria, GSH is found in facultative and aerobic bacteria but not in strict anaerobes (37).

We have shown that, surprisingly, GSH is toxic to mycobacteria. Mycobacteria and other actinomycetes do not synthesize GSH. Rather, they produce mycothiol [1-D-myo-inosityl-2-(N-acetyl-L-cysteinyl)amido-2-deoxy-alpha-D-glucopyranoside; MSH] in millimolar amounts (1). MSH has been isolated from a number of mycobacterial species, including Mycobacterium smegmatis, Mycobacterium bovis, and M. tuberculosis H37Rv (1, 5, 31, 45).

The basis of the toxicity of GSH to mycobacteria is unknown and not previously reported. One possibility is that the presence of high concentrations of GSH may result in an imbalance in a bacterium containing an alternative thiol for regulating reduction/oxidation activity (i.e., mycothiol).

Interestingly, GSH is similar in structure to penicillin precursors produced by Penicillium and Cephalosporium spp., and the -lactam form of GSH is penicillin-like. Spallholz has hypothesized that GSH is an evolutionary precursor of antibiotics produced by higher eukaryotes before the emergence of cellular immunity (44). Mycobacteria may possess some intrinsic sensitivity to this structure.

Nitric oxide (i.e., NO) and related reactive nitrogen intermediates are thought to be major antimicrobial agents produced during the host defense response (23, 24, 29, 30). In view of the high levels (millimolar concentrations) of GSH found in mammalian cells, the nitrosothiol GSNO is a strong candidate for an in vivo NO donor. In a genetic screen for Salmonella mutants resistant to GSNO, De Groote et al. recovered mutants with defects in dppD and dppA function (10), homologs of the two genes interrupted in the BCG mutant described here.

We have shown that GSNO is cytocidal for wild-type BCG at concentrations similar to those to which Salmonella is sensitive (1 to 2 mM). While the data demonstrate reduced uptake of both GSH and GSNO by the opp BCG mutant, the S-nitrosothiol clearly kills both mutant and wild-type cells in culture. GSH, on the other hand, is toxic only to the wild-type strain. It is possible that GSNO, but not GSH, is transported by more than one permease. Alternatively, unlike Salmonella, BCG may be sensitive to extracellular NO provided by GSNO, and transport of the nitrosothiol, either as a tri- or dipeptide, is not required for toxicity.

Note that the two methods of analysis of toxicity used ([³H] uracil incorporation, Tables 1 to 5, and growth, Fig. 5) yielded some inconsistencies in resistance levels. These are likely the result of differences between the two assays. [³H]uracil incorporation is a general evaluation of the metabolic state of the cells, since [³H]uracil is incorporated into metabolic pools, entering first RNA and later other macromolecules by degradation and reincorporation. The growth curves are a less sensitive indicator of the effects of these peptides on metabolism.

Uptake of GSNO in Salmonella and E. coli is dependent on the ggt locus, encoding the -glutamyltranspeptidase (GT) (46). GT transfers a -Glu group to an acceptor amino acid or peptide, releasing the dipeptide S-nitrosocysteinylglycine. This points to the possibility that the NO dipeptide is the actual toxic species in the toxicity of GSNO against Salmonella. GT activity has been described in a number of species of mycobacteria (M. smegmatis and Mycobacterium avium) (20, 40), and two ORFs homologous to the ggt gene are present in the Sanger database (Rv0773c and Rv2394). The latter contains a clear lipoprotein motif, suggesting that a transpeptidase is localized at the cell surface in mycobacteria (7).

The data in Tables 3, 4, and 5 suggest that the dipeptide L-Cys-Gly may be at least partially responsible for the toxicity of GSH, since we have demonstrated a low-level toxicity of L-Cys-Gly against BCG. The dipeptide is not active against the opp mutant. Further, the data in Table 4 suggests that L-Cys may be a toxic component of both the tri- and dipeptides. Since this amino acid enters cells by an as-yet-unidentified amino acid permease, all three strains are sensitive to its low-level toxicity. Finally, Gly has no effect on any of the three strains.

Several reports point to a crucial role of peptide transporters in microbial cell signaling and virulence. For example, di- and oligopeptide permeases were identified among a number of mutant loci affecting growth and survival of Staphylococcus aureus in multiple infection environments (9). In Borrelia spp., peptide-binding proteins of ABC-type transporters were found to be conserved those species causing Lyme disease (19). In the group A streptococci, the expression of the cysteine protease is reduced in a dipeptide permease mutant, and expression of the dpp operon is under the control of the Mga virulence regulator (38). The survival of the opp mutant of BCG in cultured, unactivated murine macrophages was unimpaired compared with its wild-type parent (data not shown). This result suggests that, in this assay, access to small peptides is not a major nutritional requirement of BCG.

In addition to the opp operon, the M. tuberculosis database contains an operon (Rv3663c to Rv3666c) homologous to the dpp operon of E. coli and B. subtilis. A tripeptide permease system (tpp) is present in enteric bacteria (3, 4) and L. lacti (11); a tpp operon has not been identified in the M. tuberculosis genome. The specificity of peptide transport systems has been established by transport studies combining single and multiple mutants, peptides, and their analogs (27, 36). The Opp of enteric bacteria transports any peptide up to six amino acids (13, 35), whereas the Opp of L. lactis is restricted to four to eight amino acids (21). The Dpp of enteric bacteria is specific for dipeptides, and the Tpp is specific for hydrophobic tripeptides (15). The data presented in this study suggest that the Opp of BCG may resemble that of E. coli and Salmonella, transporting both di- and tripeptides.

An alternative interpretation is that the opp designation assigned to this particular operon in the M. tuberculosis H37Rv database is in error and that the operon described here, spanning ORFs Rv1280c to Rv1283c, actually encodes a dipeptide permease system. This possibility is suggested by four observations. First, mutations in dpp confer resistance to GSNO in Salmonella spp. (10). Second, as mentioned earlier, two of the four genes in the opp operon of M. tuberculosis (Rv1283c and Rv1281c) show higher homology to dpp components of other species than to opp components (7). Third, unlike opp mutants of Bacillus (43) and Streptomyces (34), the BCG opp mutant described here is not resistant to the toxic tripeptide bialaphos. Fourth, the BCG opp mutant is resistant to the toxic effects of both GSH and L-Cys-Gly.

Further studies are required to understand peptide discrimination of the mycobacterial permeases. To this end, our laboratory has cloned the second annotated peptide permease (dpp) (Rv3663c to Rv3666c) from BCG and is engaged in constructing two additional mutants (dpp and a double dpp opp mutant) to complement studies with the opp mutant described here. Finally, construction of such mutants in M. tuberculosis, currently under way, will enable the analysis of the role of peptide transport and metabolism in mycobacterial pathogenesis.